Application of miR3980b in promoting flavonoid synthesis in rice grains
By silencing or inhibiting the expression of miR3980b in rice, a recombinant vector was constructed using STTM technology. This solved the problem of insufficient flavonoid biosynthesis in rice, significantly increased the flavonoid content and antioxidant activity in rice grains, and verified that miR3980b is a negative regulator that directly targets the OsUGT gene and regulates the molecular basis of flavonoid synthesis.
Patent Information
- Application Number
- CN202610623198.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-08
- Publication Date
- 2026-06-09
AI Technical Summary
In rice, existing technologies have limited research on miRNA-regulated flavonoid biosynthesis, making it difficult to effectively increase the flavonoid content and nutritional value in rice grains.
By silencing or inhibiting the expression of miR3980b, a recombinant vector was constructed using STTM technology and introduced into rice to increase the flavonoid content in rice grains.
It significantly increased the flavonoid content in rice grains, improved the nutritional quality of rice, enhanced its antioxidant activity, and verified that miR3980b is a negative regulator that directly targets the OsUGT gene and regulates the molecular basis of flavonoid synthesis.
Smart Images

Figure CN122168602A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a... miR3980b Application in promoting the synthesis of flavonoids in rice grains. Background Technology
[0002] Rice is the staple food for more than half of the world's population, and its germplasm resources are abundant. With the improvement of living standards, colored rice, rich in flavonoids and other functional components, has attracted much attention due to its combined nutritional and health benefits. Flavonoids are the main secondary metabolites and pigment sources in plants, possessing antioxidant activities and potentially reducing the risk of diseases such as diabetes. Their biosynthesis involves multiple steps catalyzed by key enzymes such as phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), chalcone isomerase (CHI), and flavanone 3-hydroxylase (F3H), and is regulated by transcription factors such as MYB and bHLH. In recent years, microRNAs (miRNAs) have also been found to participate in this regulatory network.
[0003] miRNAs are a class of 18-24 nucleotide non-coding RNAs that are conserved, tissue-specific, and time-dependent. Plant miRNAs are transcribed from RNA polymerase II into pri-miRNA, processed by DCL1 and other enzymes into pre-miRNA, and then cleaved into miRNA / miRNA. The double-stranded miRNA, after HEN1 methylation, is transported to the cytoplasm, loaded into AGO proteins to form the RISC complex, and exerts regulatory functions by cleaving target mRNAs or inhibiting translation. Studies have shown that miRNAs are widely involved in plant development, hormone signaling, stress responses, and secondary metabolism. For example, in rice, OsmiR396-OsGRF8 It can be directly controlled OsF3H To regulate the biosynthesis of flavonoids; in rice, OsmiR858 By acting on CHS / FLS1 Regulating flavonoid levels affects auxin transport and plant growth and development; in poplar, miR156 Overexpression can enhance anthocyanin-related structural genes LDOX The expression, UFGT and GST Promotes anthocyanin accumulation; in apples, miR5072 Through influence ANR Expression promotes the biosynthesis of anthocyanins in the peel of red apples after bagging is removed; in honeysuckle fruit, miR156h-3p and miR396a-3p It can negatively regulate the process of flavonoid biosynthesis UFGT Structural genes influence the biosynthesis of anthocyanins; in tea, miR167a, miR2593e, miR4380a, miR3444b Targeting structural genes in flavonoid metabolism CHI, ANR, DFR and C4HThe expression of these miRNAs regulates the biosynthesis of catechins. This evidence suggests that miRNAs can stably and efficiently regulate flavonoid biosynthesis.
[0004] In recent years, research on plant miRNAs has deepened, and it has been found that miRNAs can stably and effectively control the biosynthesis and accumulation of natural active ingredients such as flavonoids. However, there are relatively few reports on miRNAs regulating flavonoid biosynthesis in rice. Therefore, discovering and utilizing miRNAs that regulate flavonoid biosynthesis in rice is of great significance for cultivating rice varieties with higher nutritional value and quality. Summary of the Invention
[0005] The purpose of this invention is to provide a miR3980b The application of miR3980b in promoting the synthesis of flavonoids in rice grains addresses the problems existing in the prior art. By silencing or inhibiting the expression of miR3980b, the flavonoid content in rice grains can be significantly increased, indicating that miR3980b can regulate the synthesis of flavonoids in rice grains.
[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides silencing or suppression miR3980b Application in any of the following: (1) Application in promoting the synthesis of flavonoids in rice grains; (2) Application in the genetic improvement of flavonoid synthesis in rice grains; (3) Application in the cultivation of rice varieties with high flavonoid content; Among them, the miR3980b The nucleotide sequence is shown in SEQ ID NO.1.
[0007] This invention also provides silencing or suppression. miR3980b The application of the vehicle of expression in any of the following: (1) Application in promoting the synthesis of flavonoids in rice grains; (2) Application in the genetic improvement of flavonoid synthesis in rice grains; (3) Application in the cultivation of rice varieties with high flavonoid content; Among them, the miR3980b The nucleotide sequence is shown in SEQ ID NO.1.
[0008] The present invention also provides methods including silencing or suppression. miR3980b The use of the host bacteria of the expression vector in any of the following: (1) Application in promoting the synthesis of flavonoids in rice grains; (2) Application in the genetic improvement of flavonoid synthesis in rice grains; (3) Application in the cultivation of rice varieties with high flavonoid content; Among them, the miR3980b The nucleotide sequence is shown in SEQ ID NO.1.
[0009] This invention also provides a method for promoting the synthesis of flavonoids in rice grains, including silencing or inhibiting the synthesis of flavonoids in rice. miR3980b The steps of expressing and increasing the flavonoid content in rice grains; wherein, the... miR3980b The nucleotide sequence is shown in SEQ ID NO.1.
[0010] Preferably, the silencing or inhibition of rice miR3980b Methods of expression include: A cta sequence was inserted between the 3P and 5P precursor arm sequences of the nucleotide sequence shown in SEQ ID NO.1, and then ligated to the 5' and 3' ends of the STTM universal neck loop sequence, respectively, to obtain short tandem target mimic I and short tandem target mimic II; then, short tandem target mimic I and short tandem target mimic II were respectively ligated to an expression vector to obtain STTM- miR3980b -3P recombinant vector and STTM- miR3980b -5P recombinant vector; The STTM- miR3980b -3P recombinant vector or the STTM- miR3980b -5P recombinant vectors are introduced into rice through genetic transformation to silence or inhibit the growth of certain substances in rice. miR3980b Express.
[0011] Preferably, the nucleotide sequence of short tandem target mimic I is shown in SEQ ID NO.3, and the nucleotide sequence of short tandem target mimic II is shown in SEQ ID NO.2.
[0012] This invention also provides a method for cultivating rice varieties with high flavonoid content, including silencing or inhibiting the flavonoid content in rice. miR3980b The step of expressing and obtaining transgenic rice with increased flavonoid content in rice grains; wherein, the... miR3980b The nucleotide sequence is shown in SEQ ID NO.1.
[0013] Preferably, the silencing or inhibition of rice miR3980b Methods of expression include: A cta sequence was inserted into the middle of the nucleotide sequence shown in SEQ ID NO.1, and then ligated to the 5' and 3' ends of the STTM universal neck loop sequence, respectively, to obtain short tandem target mimic I and short tandem target mimic II; then, short tandem target mimic I and short tandem target mimic II were respectively ligated to an expression vector to obtain STTM- miR3980b-3P recombinant vector and STTM- miR3980b -5P recombinant vector; The STTM- miR3980b -3P recombinant vector or the STTM- miR3980b -5P recombinant vectors are introduced into rice via genetic transformation to silence or suppress the growth of certain substances in rice. miR3980b Genetically modified rice expressing [the desired characteristics].
[0014] Preferably, the nucleotide sequence of short tandem target mimic I is shown in SEQ ID NO.3, and the nucleotide sequence of short tandem target mimic II is shown in SEQ ID NO.2.
[0015] The present invention has at least the following beneficial effects: (1) This invention is the first to discover and verify miR3980b It is a negative regulator of flavonoid biosynthesis in rice. Through positive (overexpression) and negative (STTM silencing) genetic strategies, combined with physiological and biochemical assays and metabolomics analysis, it was confirmed that... miR3980b The negative regulatory function of miRNA in the accumulation of flavonoids in rice grains further improves the research progress on miRNA regulation of flavonoid synthesis in rice.
[0016] (2) This invention was first identified and verified. OsUGT for miR3980b The direct target gene was identified. Multiple experiments, including target gene prediction, RT-qPCR, transient expression assays in tobacco infected with Agrobacterium, Western blot, and Luciferase assays, confirmed the presence of the target gene. miR3980b Directly target the key enzyme gene in the final step of flavonoid synthesis OsUGT This reveals miR3980b-OsUGT "The molecular basis of the regulatory module."
[0017] (3) This invention has created several transgenic materials with significant breeding value. Successful construction... miR3980b Overexpression ( miR3980b-OE ), miR3980b silence( miR3980b-STTM A series of genetically modified materials, including miR3980b- STTM The material showed a significant increase in flavonoid content, providing directly usable germplasm resources and molecular targets for improving the nutritional quality of rice.
[0018] (4) The present invention systematically analyzes miR3980b A multi-dimensional chain of evidence regulating flavonoid synthesis. Integrating multi-level evidence from phenotypic observation, physiological and biochemical assays, metabolomics analysis, target gene validation, and downstream material functional validation, a complete experimental pathway validation from miRNA to target gene to phenotype was formed. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Picture 1 For identification miR3980b Overexpression ( miR3980b-OE (A) Plants; (A) PCR transgenic detection, hygromycin resistance gene fragment (750 bp) in miR3980b-OE (B) Amplification was observed in the control group, but not in the wild-type (WT) control; miR3980b qRT-PCR analysis of expression levels; data are expressed as mean ± standard deviation (n=3), asterisks in the figure represent t The significance of the difference was tested. represent P <0.001; Picture 2 Wild-type (WT) and overexpressing plants ( miR3980b-OE (A) Plant type at maturity, scale bar: 10 cm; (B) Grain type, scale bar: 1 cm; (CF) Plant height, grain width, number of tillers, and thousand-grain weight of wild-type plants (WT) and overexpression plants, respectively; data are expressed as mean ± standard deviation (n = 10), and asterisks in the figure represent... t The significance of the difference was tested. represent P <0.05, represent P <0.001; ns represents not significant; Picture 3 for miR3980b Effects of total flavonoid and polyphenol content and antioxidant activity in rice grains; (A) Wild-type (WT) and overexpression plants ( miR3980b-OE (A) Color comparison of sample extracts; (B) Total flavonoid content; (C) Polyphenol content; (D) Antioxidant activity; Data are expressed as mean ± standard deviation (n=3), and asterisks in the figure represent... t The significance of the difference was tested. represent P <0.05、 represent P <0.01、 represent P <0.001; Picture 4 for miR3980bThe expression pattern was determined; roots, stems, and leaves were used as mature organisms, and snRNA U6 was used as an internal control. Each experiment was performed in three biological replicates. Picture 5 For KEGG enrichment analysis and differential metabolite heatmap, the untranslated metabolites are: isovitexin-4'-O-glucoside, O-MethylChrysoeriol-8-C-glucoside, Tricin-5-O-Glucoside, Carlinoside, and Luteolin-4'-O-glucoside. 3,5,7,3',5'-pentahydroxy-4'-methoxyflavonoid-3-O-glucoside (Mearnsetin-3-O-glucoside) ), Tricetin-5-O-(6''-malonyl)glucoside, Vitexin-2''-O-glucoside; (A) Wild-type (WT) and overexpressing plants ( miR3980b-OE (A) KEGG pathway enrichment analysis of differential metabolites; (B) Clustering heatmap of differential metabolites; color levels represent relative content, pink represents high content, blue represents low content, the dendrogram on the left side of the heatmap represents the clustering results of differential metabolites, WT represents wild-type Yuzhou black glutinous rice, OE represents miR3980b-OE ; Picture 6 for miR3980b Effects on the expression of key genes and enzymes in flavonoid biosynthesis; (A) Distribution of selected key enzyme genes in different stages of the phenylpropane metabolic pathway; (B) Expression of key enzymes. Data are expressed as mean ± standard deviation (n=3); asterisks in the figure represent... t The significance of the difference was tested. represent P <0.05、 represent P <0.01、 represent P <0.001, ns represents not significant; Picture 7 STTM-mediated miR3980bExpression silencing; after pre-miRNA is processed by Dicer enzyme, it becomes a mature miRNA about 20-24 nt long. Some miRNA precursors produce a functional mature miRNA from each of their two arms, which target different sites, called 3P and 5P; (A, C) STTM knockdown miR3980b A schematic diagram of the medium for expression; (B, D) miR3980b exist STTM-3p and STTM-5p Expression levels in transgenic materials; data are expressed as mean ± standard deviation (n=3); asterisks in the figure represent... t The significance of the difference was tested. represent P<0.001 ;ns represents not significant; Picture 8 Wild type (WT) and miR3980b-STTM plant (STTM-3p / 5p) Agronomic traits; (A) Mature plant type diagram, scale bar: 10 cm; (B, C) Grain type diagram, scale bar: 1 cm; (DH) WT and STTM-3p / 5p Plant height, tiller number, grain length, grain width, and thousand-grain weight were statistically analyzed; data are expressed as mean ± standard deviation (n = 10), and asterisks in the figure represent... t The significance of the difference was tested. represent P< 0.05, ns represents not significant; Picture 9 for miR3980b-STTM Increase the total flavonoid and polyphenol content and antioxidant activity of rice grains; (A) Total flavonoid content; (B) Polyphenol content; (C) Antioxidant activity; Data are expressed as mean ± standard deviation (n = 3); Asterisks in the figure represent t The significance of the difference was tested. represent P<0.05 ;ns represents not significant; Picture 10 for miR3980b Quantitative analysis of target genes; data are expressed as mean ± standard deviation (n = 3); asterisks in the figure represent... t The significance of the difference was tested. represent P<0.05 , represent P <0.01、 represent P <0.001, ns represents not significant; Picture 11 Sequence and phylogenetic analysis of the target gene OsUGT; (A) phylogenetic tree analysis; (B) protein three-dimensional structure analysis. Picture 12 for OsUGT Target site analysis; Picture 13 The fluorescence detection results are from the transient expression experiment of Agrobacterium in tobacco. Picture 14 for miR3980b Effect on OsUGT protein expression levels; Picture 15 for miR3980b With target genes OsUGT The regulatory mechanism; (A) miR3980b With target genes OsUGT Schematic diagram of the construction of the dual-luciferase (LUC) reporter vector; (B) miR3980b With target genes OsUGT Dual-luciferase (LUC) reporter assay; data are expressed as mean ± standard deviation (n=3); asterisks in the figure represent t Significant difference test P <0.05、 P <0.01、 P <0.001; ns, not significant. Detailed Implementation
[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0026] This invention uses rice as material and discovers through near-isogenic line non-coding RNA sequencing. miR3980b Related to flavonoid synthesis, this study systematically analyzed the effects of genetics, molecular biology, biochemistry, and metabolomics on flavonoid synthesis. miR3980b The molecular mechanism regulating flavonoid biosynthesis in rice. Experiments revealed: (1) miR3980b It negatively regulates the accumulation of flavonoids in rice grains. miR3980b Overexpression resulted in a significant lightening of the seed coat color, a decrease in total flavonoid and polyphenol content, and a significant reduction in antioxidant activity; it also caused changes in multiple agronomic traits, including reduced plant height, shortened ear length, and smaller grains. Metabolomics analysis showed that differentially expressed metabolites were significantly enriched in the flavonoid biosynthesis pathway, with downregulation of multiple flavonoid-related metabolites.
[0027] (2) A short tandem target simulation (STTM) was successfully created using Wushan silkworm materials as a background. miR3980b Silent materials were used to verify their negative regulatory function. miR3980b The expression level was significantly reduced, while the total flavonoid and polyphenol content was significantly increased compared to the wild type, further confirming... miR3980b Negative regulation of flavonoid biosynthesis.
[0028] (3) Identification and verification OsUGT for miR3980b The target genes were identified. Based on target gene prediction and expression association analysis, five candidate target genes were screened, one of which encodes a key enzyme in the final step of flavonoid synthesis. OsUGT The expression of Agrobacterium in tobacco was confirmed by RT-qPCR, transient expression assay, Western blot, and Luciferase assay. miR3980b Direct inhibition OsUGT Express.
[0029] The above technical solution will be further described below with reference to specific embodiments.
[0030] Example 1 1. Construction of transgenic materials 1.1 Construction of STTM Materials Download from the website (https: / / www.mirbase.org / ) miR3980b The sequence involves inserting a cta sequence between the 3P and 5P precursor arms of the miR3980b sequence, ligating them to the 5' and 3' ends of the STTM universal neck loop sequence, respectively. Restriction sites: Kpnl, SalI (with the YFP tag-selected restriction site removed). pCAMBIA 1300-35S-eYFP On the carrier, STTM- miR3980b -3P, STTM- miR3980b -5P vector, and then the vector is introduced into rice through genetic transformation to construct miR3980b Knockout STTM material ( STTM-miR3980b (The vector construction and genetic transformation were both completed by Boyuan Biotechnology Co., Ltd.)
[0031] miR3980b The sequence is (SEQ ID NO.1): GAGAATCGACGGCCTCGGCCAGGACGAAGTGTCTGACTCCGGTGATGATGAGGGCCCGCCGGAGCCTGCGCCCCCAGCCAAAGCAGAACGCGTCTCCCGAGCTCAAGGGGAAGGCGCCCCTGACTGAGGCCGTCGATTC.
[0032] The sequence selected for constructing the STTM-miR3980b-3P vector is (SEQ ID NO.2): AGAATCGACGGctaCCTCGGCCAG GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT AAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAAT AGAATCGACGGctaCCTCGGCCAG. (The underlined sequence is the STTM universal neck ring sequence).
[0033] The sequence selected for constructing the STTM-miR3980b-5P vector is (SEQ ID NO.3): CCCTGACTGAGctaGCCGTCGATTGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATCCCTGACTGAGctaGCCGTCGATT.
[0034] 1.2 Construction of overexpression materials Will miR3980b The sequence was ligated into the PUN1301 vector (inserting the restriction enzyme site BamHI-Sacl) to construct... miR3980bThe overexpression vector was then introduced into rice via genetic transformation to construct... miR3980b Overexpression materials ( miR3980b-OE (The vector construction and genetic transformation were both completed by Boyuan Biotechnology Co., Ltd.)
[0035] Build miR3980b The overexpression vector sequence is (SEQ ID NO.4): GGATCCCCCCTGACTGAGCTAGCCGTCGATTGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATCCCTGACTGAGCTAGCCGTCGATTGAGCTC.
[0036] 2. Real-time quantitative PCR (1) Test reagents ChamQ SYBR qPCR Master Mix (Vazyme Q311), miRNA Unimodal SYBR qPCR Master Mix (Vazyme MQ102).
[0037] (2) Test materials Wild type: Wushan Silky Rice (WSSM), Yuzhou Black Glutinous Rice (YN); Genetically modified materials: miR3980b-OE , STTM- miR3980b.
[0038] In this experiment, the Ubiquitin internal control gene (Os03g0234200) was used as the internal control for common genes, and snRNA U6 was used as the internal control for rice miRNA.
[0039] Conventional gene qPCR primers were designed using the Quant Prime website, while miRNA qPCR primers were designed using the VazymemiRNA primer design software.
[0040] The reaction system and reaction procedure for Q311 are shown in Tables 1 and 2.
[0041] Table 1 Real-time quantitative PCR reaction system Table 2 RT-qPCR amplification program Run the melting curve program for the qPCR instrument.
[0042] The MQ102 reaction system and reaction procedure are shown in Tables 3 and 4.
[0043] Table 3 Real-time quantitative PCR reaction system Table 4 RT-qPCR Amplification Program Note: Primers used are listed in Table 5. The method calculates the result.
[0044] Table 5 Primers 3. Transient expression assay of Agrobacterium in tobacco infection 3.1 Carrier Construction Expanding through CE Design miR3980b Primers and adapter primers with relevant restriction sites (see Table 6) were used to amplify WSSM cDNA as a template. miR3980b The stop codon CDS sequence was removed, and the DNA was recovered after two rounds of PCR. Vector selection was performed. pCAMBIA 1300-35S-eYFP (Sal I / Kpn I) and pCAMBIA 1300-35S-eYFP (Sacl I / Kpn I), miR3980b Remove the YFP fluorescent tag. Transform into E. coli DH5α competent cells, sequence to ensure sequence accuracy, and extract plasmid.
[0045] Table 6 Primers for amplifying miR3980b and its key regulatory pathway genes, as well as adapter primers with relevant restriction sites. 3.2 Agrobacterium-mediated transformation (1) Place Agrobacterium GV3103 (Weidi Bio) stored at -80℃ on ice. When the ice and water are mixed, add 1 μL of the plasmid to be transformed and gently stir to mix. (2) Stand on ice for 5 min, in liquid nitrogen for 5 min, and in a 37°C water bath for 5 min; (3) Add 700 μL of antibiotic-free liquid LB medium to the tube, shake at 200 r / min for 2-3 h at 28℃; (4) Centrifuge at 6000 r / min for 2 min, and resuspend the bacterial block in 100 μL of supernatant using a pipette. Spread the supernatant onto LB solid medium containing the corresponding antibiotic. (5) Invert the container and incubate at 28℃ for 2-3 days.
[0046] 3.3 Transient expression of tobacco exogenous substances (1) Select a single Agrobacterium clone transformed with the expression plasmid and add it to 1 mL of LB liquid medium containing the corresponding resistance, and culture it at 28℃ and 250 r / min for 24 h. (2) Take 100-200 μL of the above bacterial culture and transfer it to 10 mL of LB liquid medium containing the corresponding antibiotic. Add 200 μL of 0.5M MES and 4 μL of 100 mM acetylsuccinone (AS). (3) Incubate at 28℃ on a shaker at 250 r / min for approximately 18 h until OD. 600 =1.0; (4) Centrifuge at 4000 r / min for 10 min, collect the bacterial cells, and resuspend them in premixed buffer (50 mL premixed buffer = 1 mL 10 nM MgCl2 + 0.5 mL 0.5 M MES) to OD. 600 =0.1; (5) Add 2 μL of 100 mM AS per milliliter of bacterial culture and let stand for more than 3 hours; (6) Select leaves of Tobacco Bunge during its vigorous growth period (about 1 month, before flowering), use a syringe without needle to draw up the bacterial solution, hold the front of the leaf with your finger, and inject the bacterial solution from the back of the leaf. (7) After dark treatment for 24-48 h, take samples and observe them with instruments.
[0047] 4. Western blot detection of protein expression levels 4.1 Sample Preparation (1) Take 100 mg of leaves expressing the target protein, freeze them in liquid nitrogen, and grind them into powder at low temperature; (2) Add SDS buffer (pH 6.8; 4% SDS; 0.1% bromophenol blue; 40% glycerol; 0.25 M Tris-HCl), and vortex to mix. (3) Heat at 95℃ for 10 min to denature the protein, then cool to room temperature; (4) Centrifuge at 12000 r / min for 10 min, take the supernatant to determine the protein concentration, and set aside for later use.
[0048] 4.2 SDS-PAGE polyacrylamide gel electrophoresis Electrophoresis was performed using the one-step stain-free PAGE gel preparation kit (8%) (Coollabo) according to the instructions.
[0049] 4.3 Transfer and Development (1) Using protein marker as a reference, remove excess SDS-PAGE gel after electrophoresis; (2) A semi-dry transfer system is used. The transfer instrument uses a "sandwich" structure: filter paper-PVDF membrane-adhesive-filter paper for the transfer (note the electrode direction). (3) After the transfer was completed, the PVDF membrane was washed with PBST for 5 min and then blocked in blocking buffer (20 mL PBST + 1 g skim milk powder) for 2 h. (4) Remove the blocking solution, add GFP primary antibody diluted 5000 times with PBST to completely immerse the membrane, and incubate at room temperature with shaking for 2 h (or incubate at 4℃ with shaking overnight). (5) Recover the primary antibody and wash the PVDF membrane three times with PBST for 5 min each time; (6) Primary antibody incubation: Dilute the secondary antibody 10,000 times with PBST, soak the PVDF membrane, and incubate with shaking for 1 h; (7) Add PBST to dilute the secondary antibody 10000 times, and incubate with shaking for 1 h. Recover the secondary antibody; (8) Wash the PVDF membrane three times with PBST, each time for 5 min.
[0050] (9) Immerse the PVDF membrane in the developer for about 1 min and image it using the ChemDoc high-sensitivity chemiluminescence imaging system.
[0051] 5. Dual-luciferase reporter gene assay 5.1 Carrier Construction Expanding through CE Design miR3980b Primers and adapter primers with relevant restriction sites (see Table 6) were used to amplify the miR3980b promoter using WSSM cDNA as a template. DNA was recovered after two rounds of PCR. Vector selection... 1300-35S (Xba I / EcoR I). Connect miR3980b to 1300-35S The cells were transformed into E. coli DH5α competent cells, sequenced to ensure sequence accuracy, and plasmids were extracted.
[0052] 5.2 Preparation of rice protoplasts The specific experimental method is as follows: (1) Prepare the enzyme hydrolysate, as shown in Table 7; Table 7. Enzyme hydrolysate preparation system (10 mL) (2) Using a blade, cut the leaf sheath of rice seedlings that have been rooted for about 15 days into 0.5 mm segments, and transfer them into 0.8 M Mannitol that has been restored to room temperature and equilibrate for 10 min. (3) Discard the Mannitol solution, add the enzyme digestion solution restored to room temperature, wrap the Erlenmeyer flask with aluminum foil to protect it from light, and place it in a vacuum chamber for 30 min under vacuum. Then, at room temperature, gently shake on a shaker at 50 r / min for 3 h; (4) Prepare PEG-CaCl2 solution, and prepare the system as shown in Table 8 (1 mL). Table 8. Preparation system of PEG-CaCl2 solution (1 mL) (5) When the enzymatic hydrolysis is complete, prepare W5 (prepare fresh for use). The preparation system is shown in Table 9 (prepare fresh for use). Table 9. W5 preparation system (50 mL) Soak 300-mesh sieve in 95% ethanol and then air dry at room temperature; (6) After the protoplasts are released, add 10 mL of W5 into the conical flask and release at 65 r / min for 10 min. (7) Rinse the sieve with 1-2 mL of W5, discard the enzyme hydrolysate, and rinse the residue back into the Erlenmeyer flask with 10 mL of W5. (8) Continue to release at 80 r / min for 10 min, then filter into a centrifuge tube; (9) Centrifuge at 100 g at room temperature for 8 min. Note that the centrifuge speed should be set to the slowest setting. Slowly aspirate the contents. (10) Suspend the protoplasts in 1 mL of W5 and gently resuspend the protoplasts; (11) Pipette 5 μL of protoplasts into a cell counting dish and count them (23-30 per cell). (12) Place in the dark and let stand at room temperature for 30-90 min; (13) At this time, MMG is prepared, and the preparation system is shown in Table 10; Table 10 MMG preparation system (10 mL) (14) Centrifuge at 100 g at room temperature for 8 min, remove the supernatant, and resuspend the protoplasm in MMG (the volume is the same as the volume of W5 in the previous step). (15) Add 5-10 μg of plasmid (10 μL volume) to 100 μL of protoplast, shake gently to mix, add 110 μL of PEG-CaCl2, shake gently to mix and place at room temperature (for Luciferase experiment, use 5 μL of plasmid). (16) Add 440 μL of W5 solution, invert the container to mix well, and stop the reaction; (17) Centrifuge at 100 g at room temperature for 8 min, discard 600 μL of supernatant, and add 800 μL of W5 to resuspend the protoplasts; (18) After 12 h at room temperature, centrifuge at 100 g for 8 min, discard 750 μL of supernatant, and gently mix before proceeding with subsequent experiments.
[0053] 5.2 Dual-luciferase reporter kit This test kit is a dual-luciferase reporter gene assay kit for fireflies and kidney spp. (Sangon Biotech, E608006).
[0054] (1) According to 10 5 Add protoplasts / 100 µL 1 × Cell Lysis Buffer to lysis buffer, mix by pipetting, and lyse thoroughly at room temperature for 10 min; (2) Centrifuge at 12,000 g for 2 min at 2~8℃, and collect the supernatant for testing; (3) Add 100 µL of Luciferase Reaction Reagent equilibrated to room temperature to a detection tube or microplate, carefully aspirate 20 µL of cell lysis supernatant into the well of the microplate, quickly vortex horizontally to mix, and immediately detect the activity of firefly luciferase reporter gene in a microplate reader. (4) Add 100 µL of freshly prepared Luciferase Reaction Reagent II working solution to the above reaction solution, quickly vortex horizontally to mix, and immediately detect the activity of Renaissance luciferase reporter gene in an ELISA reader.
[0055] 6. Determination of total flavonoid content in rice grains 6.1 Preparation of Standards (1) Accurately weigh 40 mg of rutin standard, dry it to constant weight, weigh 20 mg and dilute it to 100 mL with 10% methanol to obtain 0.2 mg / mL rutin standard stock solution; (2) Prepare the standard samples to be tested according to Table 11; Table 11 Standard System (10 mL) 6.2 Sample Solution Preparation (1) Remove the husk from the rice, dry it for 24 hours, grind it into fine powder, and pass it through a 200-mesh sieve; (2) Accurately weigh 500 mg ± 0.2 mg of white rice and 150 mg ± 0.2 mg of colored rice (red or black rice), repeat 3 times; (3) Add 5 mL of 10% methanol, extract by sonication for 6 h, centrifuge at 6000 r / min for 10 min, and transfer the supernatant to a 10 mL centrifuge tube; (4) Repeat step (3), transfer the two supernatants to the same centrifuge tube, make up to 10 mL with 10% methanol, and filter with a 0.45 μm organic filter membrane; (5) Prepare the sample solution according to Table 12.
[0056] Table 12 Sample solution system (10 mL) 6.3 Determination of total flavonoid content in standard samples and sample extracts (1) The absorbance of the standard was measured at a wavelength of 510 nm, and a standard curve was plotted with the concentration of rutin standard on the x-axis and the absorbance on the y-axis. (2) Measure the absorbance of the sample at a wavelength of 510 nm, and substitute the absorbance into the standard curve to calculate the total flavonoid content in the sample.
[0057] 7. Determination of polyphenol content in rice grains 7.1 Preparation of Standards (1) Accurately weigh 25 mg of gallic acid standard and dilute to 250 mL with 10% methanol to obtain 0.1 mg / mL gallic acid standard stock solution; (2) Prepare the standard samples to be tested according to Table 13; Table 13 Standard System (10 mL) 7.2 Sample Solution Preparation (1) Remove the husk from the rice, dry it for 24 hours, grind it into fine powder, and pass it through a 200-mesh sieve; (2) Accurately weigh 500 mg ± 0.2 mg of white rice and 150 mg ± 0.2 mg of colored rice (red or black rice), repeat 3 times; (3) Add 5 mL of 10% methanol, extract by sonication for 6 h, centrifuge at 6000 r / min for 10 min, and transfer the supernatant to a 10 mL centrifuge tube; (4) Repeat step (3), transfer the two supernatants to the same centrifuge tube, make up to 10 mL with 10% methanol, and filter with a 0.45 μm organic filter membrane; (5) Prepare the sample solution according to Table 14; Table 14 Sample solution system (10 mL) 7.3 Determination of polyphenol content in standard samples and sample extracts (1) The absorbance of the standard was measured at a wavelength of 765 nm, and a standard curve was plotted with the concentration of gallic acid standard as the abscissa and the absorbance as the ordinate. (2) Measure the absorbance of the sample at a wavelength of 765 nm, and substitute the absorbance into the standard curve to calculate the polyphenol content in the sample.
[0058] 8. Determination of antioxidant activity of rice grains 8.1 Preparation of Standards (1) Accurately weigh 2.5 mg of Trolox standard, dissolve it in 100 mL of 7.5 μmol / L phosphate buffer, mix by inversion, sonicate for 15 min to fully dissolve, dispense into 2 mL EP tubes, and store at -20℃; (2) Dilute it to concentration gradients of 100, 50, 25, 12.5, 6.25, and 3.125 μmol / L for later use; (3) Prepare the standard sample to be tested according to Table 15.
[0059] Table 15 Standard Product System 8.2 Sample Preparation (1) Remove the husk from the rice, dry it for 24 hours, grind it into fine powder, and pass it through a 200-mesh sieve; (2) Accurately weigh 500 mg ± 0.2 mg of white rice and 150 mg ± 0.2 mg of colored rice (red or black rice), repeat 3 times; (3) Add 5 mL of 10% methanol, extract by sonication for 6 h, centrifuge at 6000 r / min for 10 min, and transfer the supernatant to a 10 mL centrifuge tube; (4) Repeat step (3), transfer the two supernatants to the same centrifuge tube, make up to 10 mL with 10% methanol, and filter with a 0.45 μm organic filter membrane; (5) Prepare the sample solution according to Table 16.
[0060] Table 16 Sample Liquid System 8.3 Determination of antioxidant activity of test standards and sample extracts (1) Add the prepared standards and samples to the 96-well black microplate in accordance with Tables 15 and 16 above; (2) Antioxidant activity was determined by the ORAC method. It is necessary to set up a fluorescence natural decay control without the addition of AAPH free radicals and an AAPH free radical control without antioxidants. (3) The entire process must be maintained at 37℃, with an excitation wavelength of 485±20 nm and an emission wavelength of 530±20 nm. The fluorescence intensity is continuously measured once every 2 minutes, for a total of 60 cycles. (4) Set the initial fluorescence intensity to 1, and calculate the fluorescence intensity value f = fluorescence intensity value / initial fluorescence intensity value; (5) Calculate the area under the fluorescence decay curve (AUC), 16 AUC=2×(f0+f1+…+f n )-f0-f n ; (6) Plot a standard curve with Trolox concentration as the x-axis and the net integral area under the fluorescence decay curve as the y-axis; (7) Substitute the AUC of each well into the standard curve to obtain the antioxidant capacity (T0) of each sample after dilution. (8) ORAC value = T0 × [(V × N) / (m × 1000)] (V represents the volume of the extract, N represents the dilution factor, and m represents the mass of the extract).
[0061] 9. Results and Analysis 9.1 miR3980b genetic effects 9.1.1 miR3980b-OE Plant construction and identification For research miR3980b The function and regulatory mechanism of miR3980b were investigated by overexpressing miR3980b in black glutinous rice (black rice) from southern Henan. miR3980-OE The hygromycin selection marker gene carried on the vector was amplified by PCR to confirm the integration of the exogenous gene. Figure 1 (A). The expression level of miR3980b was detected by real-time quantitative PCR (qRT-PCR). The results showed that, compared with the wild type, the expression level of miR3980b in the overexpression line was significantly upregulated by 10-16 times. Figure 1 (B) indicates that the obtained overexpression material can be used for subsequent functional studies.
[0062] 9.1.2 miR3980b-OE agronomic traits of plants To investigate the effects of miR3980b overexpression on the growth and development of rice, wild-type Yuzhou black glutinous rice (WT) and... miR3980b-OE The strains were planted in rice paddies at the same time. Compared with the wild type, miR3980b-OE The plant height of the strain decreased ( Figure 2 (A, C) and shortened ear length ( Figure 2 D), decrease in thousand-grain weight ( Figure 2 (Middle F).
[0063] miR3980b-OE The seed coat color of the strain is significantly lighter than that of the wild type. Figure 2 (B) Flavonoids are the main source of pigments in rice seed coat, therefore it is speculated that... miR3980b It affects the synthesis of flavonoids in rice.
[0064] 9.1.3 miR3980b Negative regulation of total flavonoid and polyphenol content and antioxidant activity Flavonoids belong to a large class of polyphenols and possess antioxidant activity; therefore, this invention detects total polyphenols, flavonoids, and antioxidant activity. The results show that, compared to the wild type, miR3980b-OE-1 and miR3980b-OE-1 The color of the extract from the seed sample of the strain was significantly lighter. Figure 3 In the middle grade (A), the total flavonoid content decreased by 39.8% and 47.5% respectively, and the total polyphenol content decreased by 27.4% and 45.2% respectively. Figure 3 In the B and C groups, antioxidant activity decreased by 9.2% and 23.4%, respectively. Figure 3 (D, E). Proof miR3980b It negatively regulates the biosynthesis of flavonoids, thereby affecting grain pigment deposition and antioxidant activity.
[0065] 9.1.4 miR3980b expression patterns To further explore miR3980b The present invention has the following functions: miR3980b The expression patterns of the Wushan Silky Miao people were analyzed, and the quantitative results indicate that... miR3980b It is mainly expressed in leaves, ears, and grains during the grain-filling stage, with high expression in leaves during the grain-filling stage (3-10 days after pollination), indicating that... miR3980b It may be involved in regulating the expression of target genes during these two growth stages. Figure 4 ).
[0066] 9.1.5 Metabolomics Data Analysis Metabolomics analysis showed that the differentially metabolites were mainly enriched in the flavonoid synthesis pathway (ko00941). Figure 5 (A), and then analyzed the differential metabolites in the pathway. Compared with wild type (WT), the overexpressing plants ( miR3980b-OE The following major metabolites were significantly downregulated in the study: ferruginin-6-O-β-D-glucoside (Ladanetin-6-O-β-D-glucoside Luteolin-8-C-glucoside (Orientin), Isovitexin-7-O-glucoside (Saponarin), 6,7-dihydroxy-1,3-dimethoxyxanthen-9-one, etc. Figure 5 (B) The above-mentioned significant metabolic differences belong to flavonoid components, and specifically to glycosylated flavonoids, which further indicates... miR3980b It participates in flavonoid synthesis and is associated with flavonoid glycosylation.
[0067] To elucidate the regulatory role of miR3980b in flavonoid metabolism, this invention further investigates at the transcriptional level, using qRT-PCR to target key structural genes in the flavonoid synthesis pathway (such as...). PAL , F3H , CAD , DFR , ANS , UFGT (etc.) in wild type and miR3980b-OE The expression in the grains was analyzed. The results showed that, compared to the wild type, miR3980b-OE in strains F3H Induced expression but not significantly different, expression levels of most key structural genes were downregulated, and UFGT and CAD Reduced by approximately 80% Figure 6 It is speculated that miR3980b may be involved in regulating flavonoid synthesis.
[0068] 9.1.6 Construction and Identification of Short Tandem Target Simulation (STTM) Plants The miR3980b precursor produces miR3980b-3P and miR3980b-5P, which have different expression levels and functions. To verify that the above phenotypic changes and flavonoid content changes are regulated by miR3980b, miR3980b-3P / -5P silencing materials were constructed in Wushan Simiao (white rice) using short tandem target simulation (STTM) technology. miR3980b-STTM-3P / -5P () Figure 7 (A, C); qRT-PCR results showed that the expression level of miR3980b was significantly lower than that of wild type ( Figure 7 (B and D in the original text) indicates that the material was successfully constructed and can be used for subsequent phenotypic verification.
[0069] 9.1.7 Agronomic traits of plants simulated by short tandem targets (STTM) To verify silence miR3980bThe effects on agronomic traits of rice, comparing wild-type Wushan Simiao (WSSM) with STTM The transgenic lines were simultaneously planted in rice paddies. Statistical results of major agronomic traits showed that, compared to the wild type, STTM-3P The plant height of the strain increased significantly. Figure 8 (A, D) STTM-5P Increased thousand-grain weight of the strain ( Figure 8 (H), while other traits showed no significant differences ( Figure 8 (B, C, E, F, and G).
[0070] 9.1.8 Increased flavonoid content in plants simulated by short tandem target tactic (STTM) To verify silence miR3980b The regulatory effect on flavonoid biosynthesis, STTM-3P / -5P The total flavonoid and polyphenol content of mature seeds from the transgenic lines was measured. The results showed that, compared with wild-type Wushan Simiao, STTM-3P The total flavonoid content of the strain increased by 76%, the total polyphenol content increased by 9.5%, and the antioxidant activity increased significantly by 26%, which is the opposite of the decrease in flavonoid content in the overexpression material. STTM-5P There were no significant differences in the total flavonoid and polyphenol content and antioxidant activity among the strains, proving that... miR3980b Negative regulation of flavonoid biosynthesis in rice grains ( Figure 9 It is speculated that the gene is miR3980b-3P-terminus that targets and regulates flavonoid synthesis.
[0071] 9.2 miR3980b Regulation mechanism 9.2.1 miR3980b-OE Prediction of target genes The above results indicate that miR3980b It negatively regulates flavonoid synthesis. To investigate its regulatory mechanism, the online website Plantgrn (http: / / plantgrn.noble.org / psRNATarget / ) was used to study its effects. miR3980b-3P Predicting, screening, classifying, and performing quantitative PCR analysis on target genes ( Figure 10 ),Discover miR3980b It is associated with the following genes: glucosidase genes related to the biosynthesis of rice flavonoids. OsUGT Cinnamate dehydrogenase OsCAD9 Unknown functional domain gene family not related to rice flavonoid biosynthesis OsDUF Polygalacturonase OsPGL2 Pectin methyl esterase OsPME .
[0072] In the preliminary experiments, miR3980bCompared with STTM-silenced lines, overexpression of STTM-expressed lines showed significant differences in flavonoid and polyphenol content and antioxidant activity. Candidate genes were screened using a combination of target gene prediction and pathway analysis. 。 speculation OsUGT It is a target gene of miR3980b, because OsUGT The conversion of unstable aglycones into stable glycoside derivatives during flavonoid synthesis is crucial for the accumulation, stability, and biological function of flavonoids, and therefore it was chosen as a target gene for further validation.
[0073] 9.2.2 Target Genes OsUGT Sequence Analysis 9.2.2.1 OsUGT Homology analysis To identify target genes OsUGT The gene function was determined by studying its gene family through sequence comparison and similarity analysis; phylogenetic analysis and protein sequence analysis confirmed that the gene belongs to the glycosyltransferase family and its function is conserved. Figure 11 ).
[0074] 9.2.2.2 OsUGT Target site analysis miRNAs can regulate the expression of target genes by cleaving their mRNA. Therefore, this invention has preliminarily analyzed... miR3980b The base sequence that may bind to this gene ( Figure 12 Further experiments are needed to study the specific cleavage site using 5'RACE, so further experimental verification is required.
[0075] 9.2.3 miR3980b Inhibit target genes OsUGT expression 9.2.3.1 Transient expression experiment of Agrobacterium in tobacco infection To further verify miR3980b With predicted target genes OsUGT To investigate the direct regulatory relationship between them, this invention utilized the Benzodiacetic tobacco transient expression system for co-transformation experiments. First, an effector vector (35S-) was constructed. miR3980b ,Will miR3980b The mature sequence is placed under the CaMV 35S promoter drive) and the reporter vector (35S- OsUGT -YFP, will OsUGT (The target sequence was fused with YFP for expression). After transforming Agrobacterium tumefaciens into the above vectors, they were co-injected into tobacco leaves, and the intensity of YFP fluorescence signal was observed to assess the expression. miR3980b right OsUGT The inhibitory effect.
[0076] The results showed that, when expressed alone... OsUGT A strong YFP fluorescence signal was detected in the leaves of YFP-positive control; while when OsUGT -YFP and miR3980b When co-expressed, the fluorescence intensity of YFP was significantly reduced. Further experiments were conducted with different concentrations of... miR3980b The co-infiltration experiment of bacterial suspension showed that the fluorescence intensity of YFP increased with... miR3980b The concentration decreases with increasing concentration. Figure 13 ).
[0077] 9.2.3.2 Western Blot Protein Detection Experiment Next OsUGT Different combinations of YFP were sampled and proteins were extracted. Western blot analysis was performed to detect YFP expression levels. Concentration was checked before the experiment to ensure consistent loading amounts. Experimental results were consistent with fluorescence microscopy observations. 35S::miR3980b The increase in YFP protein leads to a decrease in YFP protein levels. Figure 14 ).
[0078] 9.2.3.3 Luciferase Experiment Meanwhile, to further verify and clarify miR3980b With target genes OsUGT To investigate the interaction between them, this invention conducted a dual-luciferase activity reporter assay, which was performed by extracting protoplasts. The experimental results showed that... miR3980b It will inhibit OsUGT The expression ( Figure 15 ).
[0079] Other sequences involved in this invention: OsUGT The gene sequence is (SEQ ID NO.5):
[0080] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Silence or suppression miR3980b Application in any of the following: (1) Application in promoting the synthesis of flavonoids in rice grains; (2) Application in the genetic improvement of flavonoid synthesis in rice grains; (3) Application in the cultivation of rice varieties with high flavonoid content; in, The miR3980b The nucleotide sequence is shown in SEQ ID NO.
1.
2. Silence or suppression miR3980b The application of the vehicle of expression in any of the following: (1) Application in promoting the synthesis of flavonoids in rice grains; (2) Application in the genetic improvement of flavonoid synthesis in rice grains; (3) Application in the cultivation of rice varieties with high flavonoid content; in, The miR3980b The nucleotide sequence is shown in SEQ ID NO.
1.
3. Includes silence or inhibition miR3980b The use of the host bacteria of the expression vector in any of the following: (1) Application in promoting the synthesis of flavonoids in rice grains; (2) Application in the genetic improvement of flavonoid synthesis in rice grains; (3) Application in the cultivation of rice varieties with high flavonoid content; in, The miR3980b The nucleotide sequence is shown in SEQ ID NO.
1.
4. A method for promoting flavonoid synthesis in rice grains, characterized in that, Including silencing or inhibiting rice miR3980b The steps of expressing and increasing the flavonoid content in rice grains; wherein, the miR3980b The nucleotide sequence is shown in SEQ ID NO.
1.
5. The method for promoting flavonoid synthesis in rice grains as described in claim 4, characterized in that, The silencing or inhibition of rice miR3980b Methods of expression include: A cta sequence was inserted between the 3P and 5P precursor arm sequences of the nucleotide sequence shown in SEQ ID NO.1, and then ligated to the 5' and 3' ends of the STTM universal neck loop sequence, respectively, to obtain short tandem target mimic I and short tandem target mimic II; then, short tandem target mimic I and short tandem target mimic II were respectively ligated to an expression vector to obtain STTM- miR3980b -3P recombinant vector and STTM- miR3980b -5P recombinant vector; The STTM- miR3980b -3P recombinant vector or the STTM- miR3980b -5P recombinant vectors are introduced into rice through genetic transformation to silence or inhibit the growth of certain substances in rice. miR3980b Express.
6. The method for promoting flavonoid synthesis in rice grains as described in claim 5, characterized in that, The nucleotide sequence of short tandem target mimic I is shown in SEQ ID NO.3, and the nucleotide sequence of short tandem target mimic II is shown in SEQ ID NO.
2.
7. A method for cultivating rice varieties with high flavonoid content, characterized in that, Including silencing or inhibiting rice miR3980b The step of expressing and obtaining transgenic rice with increased flavonoid content in rice grains; wherein, the... miR3980b The nucleotide sequence is shown in SEQ ID NO.
1.
8. The method for cultivating rice varieties with high flavonoid content as described in claim 7, characterized in that, The silencing or inhibition of rice miR3980b Methods of expression include: A cta sequence was inserted into the middle of the nucleotide sequence shown in SEQ ID NO.1, and then ligated to the 5' and 3' ends of the STTM universal neck loop sequence, respectively, to obtain short tandem target mimic I and short tandem target mimic II; then, short tandem target mimic I and short tandem target mimic II were respectively ligated to an expression vector to obtain STTM- miR3980b -3P recombinant vector and STTM- miR3980b -5P recombinant vector; The STTM- miR3980b -3P recombinant vector or the STTM- miR3980b -5P recombinant vectors are introduced into rice via genetic transformation to silence or suppress the growth of certain substances in rice. miR3980b Genetically modified rice expressing [the desired characteristics].
9. The method for cultivating rice varieties with high flavonoid content as described in claim 8, characterized in that, The nucleotide sequence of short tandem target mimic I is shown in SEQ ID NO.3, and the nucleotide sequence of short tandem target mimic II is shown in SEQ ID NO.2.