Panax notoginseng phospholipase gene pnpla1-21 and application thereof

By cloning the Panax notoginseng phospholipase gene PnPLA1-21 and verifying its disease-resistant function in Panax notoginseng using RNAi technology, the problem of resistance to root rot in Panax notoginseng was solved, a novel disease-resistant strategy based on genetic engineering was provided, and the resistance of Panax notoginseng to Fusarium oxysporum was enhanced.

CN122168643APending Publication Date: 2026-06-09YUNNAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YUNNAN AGRICULTURAL UNIVERSITY
Filing Date
2026-04-20
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Panax notoginseng is susceptible to root rot caused by soil pathogens during artificial cultivation, especially Fusarium oxysporum. It lacks natural disease-resistant genes, and current control methods mainly rely on chemical pesticides, which affect the quality of medicinal materials and environmental health.

Method used

The phospholipase gene PnPLA1-21 of Panax notoginseng was cloned, and its function in the defense response of Panax notoginseng was verified by transient RNAi silencing technology. The pHellsgate 2-PnPLA1-21 RNAi vector was constructed and transiently transformed into Panax notoginseng leaves to observe changes in resistance to Fusarium oxysporum.

Benefits of technology

The study verified that the expression level of the PnPLA1-21 gene is positively correlated with the resistance of Panax notoginseng to root rot, providing a novel disease resistance strategy through genetic engineering and enhancing the resistance of Panax notoginseng to Fusarium oxysporum.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168643A_ABST
    Figure CN122168643A_ABST
Patent Text Reader

Abstract

The application discloses a panax notoginseng phospholipase gene PnPLA1-21 and application thereof. The nucleotide sequence of the PnPLA1-21 gene is shown as SEQ ID NO:1, and the protein encoded by the PnPLA1-21 gene is shown as SEQ ID NO:2. The application clones the gene, constructs an RNAi carrier pHellsgate 2-PnPLA1-21 by using a Gateway technology, transforms the agrobacterium after the PnPLA1-21 gene in panax notoginseng leaves is instantaneously silenced, inoculates fusarium solani, and carries out resistance analysis. The results show that the disease spot area of the panax notoginseng leaves is significantly expanded after the RNAi silencing, is about 2 times of that of a control group, and the expression level of the PnPLA1-21 is positively correlated with the disease resistance. The application proves for the first time that the PnPLA1-21 positively regulates the resistance of panax notoginseng to the root rot pathogenic bacteria, and can be used for cultivating transgenic panax notoginseng plants resistant to the root rot, and provides new gene resources and technical support for panax notoginseng disease resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic engineering, and in particular to a Panax notoginseng phospholipase gene PnPLA1-21 and its applications. Background Technology

[0002] Panax notoginseng (Burkill) FH Chen is a traditional and precious Chinese medicinal herb with effects such as promoting blood circulation, removing blood stasis, stopping bleeding, and relieving pain. It is widely used to treat chronic cardiovascular and cerebrovascular diseases such as arteriosclerosis, hypertension, and thrombosis. However, during the artificial cultivation of Panax notoginseng, due to continuous cropping obstacles and the accumulation of soil microorganisms, it is highly susceptible to infection by pathogens in the soil, leading to root rot. Root rot has become one of the major diseases restricting the sustainable development of the Panax notoginseng industry. Among them, Fusarium spp. is the most important pathogen, especially Fusarium solani, which causes the most serious damage.

[0003] Currently, no wild germplasm resources of Panax notoginseng have been found, and there is a lack of natural sources of disease-resistant genes. Therefore, the screening of disease-resistant germplasm and the identification of resistance genes are particularly important. Breeding disease-resistant varieties of Panax notoginseng is an effective strategy to solve the problem of root rot, and the discovery of disease-resistant genes is the core link in disease-resistant breeding. In recent years, some resistance-related genes have been identified in Panax notoginseng, such as the disease-related protein genes PnPR1, PnPLA-21, and PnPR-like, as well as transcription factors PnMYB2, PnWRKY35, and PnWRKY15.

[0004] Phospholipases play a crucial role in plant defense responses. Phospholipases are a class of enzymes that specifically hydrolyze glycerophospholipids, and can be classified into four main categories based on their hydrolysis sites: PLA, PLB, PLC, and PLD. Among them, PLA1 hydrolyzes the sn-1 position of glycerophospholipids, releasing free fatty acids and lysophospholipids. When plants are subjected to pathogen stress, PLA1 can rapidly release free α-linolenic acid from membrane lipids, which enters the α-linolenic acid metabolic pathway and is catalyzed by key enzymes such as LOX, AOC, and AOS to be converted into jasmonic acid (JA). This jasmonic acid then induces the expression of downstream defense-related genes, enhancing the plant's immune response.

[0005] Previous studies have shown that knocking out the AtPLA1-Ⅰγ3 gene in Arabidopsis thaliana enhances resistance to Plasmodiophora brassicae; overexpression of AtpPLAIIIα leads to a two-fold increase in the JA / SA ratio and upregulation of the defense gene PR1, thereby enhancing resistance to turnip wrinkle virus (TCV). In cotton, GhPLP2 participates in resistance to dahlia wilt by maintaining the fatty acid metabolic pool required for JA biosynthesis and activating the JA signaling pathway.

[0006] However, to date, there have been no reports, either domestically or internationally, on the cloning, functional verification, or application of the Panax notoginseng phospholipase gene PnPLA1-21 in resistance to root rot. Currently, the control of root rot still mainly relies on chemical pesticides, which not only affects the quality of medicinal materials but also poses potential risks to the environment and human health. Therefore, identifying and verifying endogenous disease-resistant genes in Panax notoginseng and developing novel disease-resistant strategies based on genetic engineering has significant scientific research value and promising industrial application prospects. Summary of the Invention

[0007] The purpose of this invention is to provide a Panax notoginseng phospholipase gene PnPLA1-21 and its application, revealing its function and application in improving the resistance of Panax notoginseng to Fusarium solani.

[0008] The above-mentioned technical objective of the present invention is achieved through the following technical solution: A Panax notoginseng phospholipase gene PnPLA1-21, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0009] More preferably, the Panax notoginseng phospholipase gene PnPLA1-21 contains a complete open reading frame encoding a protein with the amino acid sequence shown in SEQ ID NO:2.

[0010] This invention also provides the application of the Panax notoginseng phospholipase gene PnPLA1-21 in improving the resistance of Panax notoginseng to root rot pathogens.

[0011] More preferably, the pathogen causing root rot is Fusarium oxysporum.

[0012] This invention also provides a method for verifying the effect of improving the resistance of Panax notoginseng to Fusarium oxysporum in the above applications, comprising the following steps: S1. Cloning the phospholipase gene PnPLA1-21 from Panax notoginseng; S2. Design gene-specific primers with attB linkers to amplify the PnPLA1-21 RNAi fragment, and construct the pHellsgate 2-PnPLA1-21 RNAi vector using Gateway technology. S3. The recombinant vector pHellsgate 2-PnPLA1-21 and the empty vector were transformed into Agrobacterium tumefaciens EHA105 competent cells, respectively. S4. Puncture fresh Panax notoginseng leaves and inject Agrobacterium tumefaciens solution containing recombinant vector and empty vector respectively; S5. After removing the bacterial fluid from the wound, inoculate with Fusarium oxysporum mycelium cake; S6. By observing phenotypes, counting lesion areas, and detecting the expression level of PnPLA1-21 by qRT-PCR, we analyzed the changes in resistance to Fusarium oxysporum after gene silencing.

[0013] Further preferably, the OD of the Agrobacterium bacterial solution in step S4 is... 600 The value was 0.4-0.6, and the inoculation volume was 100 µL.

[0014] In a further preferred embodiment, the diameter of the Fusarium oxysporum mycelium disc in step S5 is 1 cm, and the culture conditions after inoculation are 25°C, 16 h light / 8 h dark, and phenotypic observation and sampling are performed after 72 h of culture.

[0015] This invention also provides the application of the Panax notoginseng phospholipase gene PnPLA1-21 in the cultivation of Panax notoginseng plants with enhanced resistance to root rot.

[0016] In summary, the present invention has the following beneficial effects: Firstly, this invention is the first to clone the phospholipase gene PnPLA1-21 from Panax notoginseng and verify its function in the Panax notoginseng defense response using RNAi transient silencing technology, filling a technological gap in this field.

[0017] Secondly, through systematic gene expression analysis and resistance verification, this invention shows that PnPLA1-21 has a positive regulatory effect on Fusarium oxysporum infection, that is, the expression level of this gene is positively correlated with the resistance of Panax notoginseng to root rot.

[0018] Thirdly, this invention provides complete experimental data including gene cloning, expression analysis (different tissues, different degrees of root rot, treatment with multiple hormones and α-linolenic acid), RNAi vector construction, transient transformation, pathogen inoculation, phenotypic observation, lesion area statistics, and qRT-PCR verification. The results are reliable and reproducible. Attached Figure Description

[0019] Figure 1This is a schematic diagram of the expression of the PnPLA-21 gene in the main roots of Panax notoginseng at different degrees of root rot in this invention. Figure 2 This is a schematic diagram of the changes in the expression level of the PnPLA-21 gene in the roots of Panax notoginseng under different degrees of root rot, provided by an embodiment of the present invention; Figure 3 This is a schematic diagram showing the relative expression changes of the PnPLA-21 gene in different parts of three-year-old Panax notoginseng in this invention; Figure 4 This is a schematic diagram of transient PnPLA1-21 RNAi expression in Panax notoginseng leaves provided in this embodiment of the invention; A. Phenotypic analysis of Panax notoginseng leaves 72 h after inoculation with Fusarium oxysporum; B. Relative expression level of PnPLA1-21 after 24 h of transient silencing with PnPLA1-21 RNAi; C. Size of lesions in Panax notoginseng leaves; D. Analysis of gene expression level of PnPLA1-21 RNAi in Panax notoginseng leaves 72 h after inoculation with Fusarium oxysporum. Detailed Implementation

[0020] The present invention will be further described in detail below with reference to the accompanying drawings.

[0021] Example 1: The phospholipase gene PnPLA1-21 was cloned from Panax notoginseng. The nucleotide sequence of the Panax notoginseng phospholipase gene PnPLA1-21 is shown in SEQ ID NO:1.

[0022] The full-length sequence of the protein coding segment of the Panax notoginseng phospholipase gene PnPLA1-21 is 1074 bp, encoding 357 amino acids. The encoded protein has a molecular weight of 4.00 kDa and contains a GXGXG domain, as shown in SEQ ID NO:2.

[0023] The phospholipase gene PnPLA-21 of Panax notoginseng was cloned, and the PnPLA-21 gene was transiently silenced. The resistance of Panax notoginseng leaves to Fusarium oxysporum after silencing was investigated, and finally a PnPLA-21 gene with disease resistance was obtained.

[0024] Application verification methods include: Total RNA was extracted from Panax notoginseng using an RNA extraction kit. The extracted total RNA was used as a template for reverse transcription. The total RNA was reverse transcribed into cDNA using reverse transcription polymerase chain reaction. The PnPLA-21 gene was cloned based on the cDNA. Primers with homologous arms containing attB and attB adapters were designed and used for PCR amplification of the PnPLA1-21 RNAi fragment. The pHellsgate 2-PnPLA1-21 recombinant plasmid was constructed using the Gateway BP Clonase™ II enzyme mix kit (Invitrogen). The recombinant plasmid pHellsgate 2-PnPLA1-21 was inserted into DH5α competent Escherichia coli cells, transformed into Agrobacterium EHA10B by heat shock, and then silenced by adding bacterial solution to detached leaves. Resistance analysis was then performed.

[0025] Example 2 (1) Cloning and sequence analysis of PnPLA1-21 gene Total RNA was extracted from Panax notoginseng samples. The samples were ground into powder using liquid nitrogen and placed in centrifuge tubes. Total RNA was extracted using the Magen RNA Extraction Kit. Reverse transcription was performed using the PrimeScript RT reagent Kit (TAKARA RR047A) from Baosheng Biotechnology Co., Ltd. The reaction system and procedure were as follows: 1 µg of total RNA was added sequentially to 2.0 μL of 5×gDNA Eraser Buffer, 1.0 μL of gDNA Eraser, and RNase-free dH2O to 10 μL. The mixture was incubated at 42℃ for 2 min or at room temperature for 5 min. After the reaction, the mixture was placed on ice, and 1.0 μL of PrimeScript RT EnzymeMix I, 1.0 μL of RT Primer Mix, 4.0 μL of 5×PrimeScript Buffer 2 (for Real Time), and 4.0 μL of RNase-free dH2O were added. The mixture was incubated at 37℃ for 15 min, then at 85℃ for 5 s. The mixture was then stored at -20℃ for later use.

[0026] Using synthesized cDNA as a template, the target gene fragment is amplified. The upstream and downstream primers used are as follows: SEQ ID NO: 3: 5' atggaaagaaggaggtggtt 3'; SEQ ID NO:4: 5'ctataccatgctctgtattgtgg 3'; PCR cloning was performed under the following conditions: 94℃ for 5 min; 94℃ for 30 s, 57℃ for 30 s, 72℃ for 60 s, for 35 cycles; 72℃ for 7 min. After PCR, 4 μL was used for agarose gel electrophoresis to detect the specificity and size of the amplified products. TA cloning of the PCR products was then performed using the following reaction system and procedure: 1.5 μL of PCR product was added to 1 μL of pGEM-T Vector (50 ng / μL) and 2.5 μL of 2×Ligation solution I, mixed thoroughly, and incubated overnight at 16℃. The ligation product was transformed into *E. coli* DH5α using a heat shock transformation method. Positive clones were screened using LB solid medium containing kanamycin (kan). Several single colonies were selected, and after shaking, the inserted PnPLA1-21 clone was identified using universal primers. The identified clone was sequenced, and the final PnPLA1-21 cDNA was completely consistent with the predicted CDS sequence, with a total length of 1074 bp. It is a complete open reading frame encoding a protein containing 357 amino acid residues with a molecular weight of 4.00 kDa and containing a GXGXG domain, indicating that it is the *Panax notoginseng* PnPLA1-21 gene.

[0027] (2) Expression analysis of PnPLA1-21 Expression analysis of the PnPLA1-21 gene was performed using the following upstream primers: SEQ ID NO: 5: 5' actttgcgccctggaattct 3'; The downstream primer is: SEQ ID NO:6: 5'tgaccgcgagatctagtcca 3'; The relative expression levels of genes were detected using Novizan SYBR qPCR mix enzyme and an ABI 176 QuantStudio 5 Flex real-time PCR system (Applied Biosystems, USA). A total of 20 μL of reaction mixture consisted of ChamQ Universal SYBR qPCR Master Mix (Vazyne Biotech Co., Ltd., Nanjing, China), primer pairs, and cDNA template. PnACT2 (GenBank: KF815706.2) was used as the internal control gene for Panax notoginseng, and Nt18s rRNA (GenBank accession number: AB158612.1) was used as the internal control gene for tobacco. Three biological replicates were performed. -ΔΔCRelative expression levels were calculated using the t-method. The reaction conditions were: pre-denaturation at 95°C for 30 s, followed by cyclic reaction: denaturation at 95°C for 10 s, reaction at 60°C for 30 s, for 40 cycles. Then, a melting curve reaction was performed: reaction at 95°C for 15 s, reaction at 60°C for 60 s, and reaction at 95°C for 15 s. The reaction mixture consisted of 1 μL cDNA, 0.5 μL forward primer, 0.5 μL reverse primer, 10 μL SYBR qPCR mix enzyme, and 8 μL ddH2O.

[0028] The results are as follows Figure 1 , Figure 2 and Figure 3 As shown, the expression level of PnPLA1-21 is positively correlated with the degree of root rot, and it is specifically highly expressed in fibrous root tissues that are highly correlated with the course of the disease.

[0029] Example 3 Construction of PnPLA1-21-RNAi vector and resistance analysis after transient expression in Panax notoginseng 1. Construction of PnPLA1-21-pHellsgate 2 RNAi vector Primers with attB1 and attB2 linkers at both ends were designed, and the interference fragment was selected at a 400 bp position in the non-conserved region of the PnPLA1-21 gene. The primer sequences are as follows: SEQ ID NO: 7: 5'ggggacaagtttgtacaaaaaagcaggctTGGGTGTGGGTATTCGGTTG3'; SEQ ID NO: 8: 5'ggggaccactttgtacaagaaagctgggtCGTCATCCACCCATTTTGGC3'; The PnPLA1-21 sequence with adapters at both ends was cloned. The PCR product was purified by gel extraction and sequenced. After confirmation, BP homologous recombination was performed using the Thermo Fisher Gateway BP Clonase™ II Enzyme Mixture Kit Recombinant Recombinant Kit (catalog number: 11789020) to ligate PnPLA1-21 into the RNAi vector pHELLSGATE2. The BP recombination reaction system consisted of 10 µL of attB-PnPLA1-21 product, 150 ng of pHellsgate 2 plasmid, and TE buffer (pH=8.0) to a final volume of 8 µL. After incubating at 25 °C for 1 h, 1 µL of proteinase K (2 µg / µL) was added, followed by brief centrifugation and termination of the reaction at 37 °C for 10 min. 5 µL of the homologous recombination product was transformed into DH10B competent cells. Positive clones were screened using LB agar containing 90 mg / L spectinomycin (Spe). Eight single colonies were selected, and bacterial water analysis was performed. The samples were then sent to Qingke Biotechnology Co., Ltd. for sequencing. After successful sequencing, plasmids were extracted from the *E. coli* culture containing the pHELLSGATE2-PnPLA1-21 vector. The pHELLSGATE2-PnPLA1-21 recombinant plasmid vector and the pHellsgate 2 vector were distributed and transformed into *Agrobacterium tumefaciens* EHA105. The cells were incubated in the dark at 30°C for 48 h. Six single colonies were randomly selected for PCR screening of positive clones. After successful detection, the colonies were stored in 50% glycerol at -80°C for later use.

[0030] 2. Transient expression analysis of RNAi vector in Panax notoginseng leaves Agrobacterium EHA105 containing the recombinant plasmid pHellsgate2-PnPLA1-21 and the empty vector pHELLSGATE2 was streaked into LB solid medium (containing 90 mg / L Spe and 25 mg / L Rif) for activation. After incubation at 28°C in the dark for 48 h, the bacterial growth was scraped into MGL medium (containing 90 mg / L Spe and 50 mg / L AS) and cultured at 28°C with shaking at 200 rpm for 5-6 h until the OD600 value reached 0.6-0.8. Two-year-old Panax notoginseng leaves with uniform growth and no disease were selected. Small holes were punctured at the same location using a sterile syringe. 100 µL of Agrobacterium tumefaciens containing the recombinant vector pHellsgate 2-PnPLA1-21 and the empty vector were respectively inoculated onto the leaves as experimental and control groups, with two control groups and two laboratory samples each. After 24 h, samples were taken from both the first control group and the treatment group, with five biological replicates. These samples were used for pre-inoculation analysis to determine whether RNAi interference silencing had occurred. RNA was extracted, and the expression level of the PnPLA1-21 gene was detected using qRT-PCR. Results showed that, compared with the empty vector, the expression level of the PnPLA1-21 gene in the leaves was significantly downregulated after 48 h of infection with the RNAi vector containing pHellsgate 2-PnPLA1-21. Figure 4 B) indicates that the RNA interference vector was successfully constructed and PnPLA1-21 expression was inhibited; thus, further resistance analysis can be performed.

[0031] 3. Analysis of resistance to Fusarium oxysporum after transient expression of RNAi vector in Panax notoginseng leaves. In the above experiment, samples were taken at 48 h to verify the success of RNAi interference. In the second treatment group and the experimental group, Agrobacterium tumefaciens bacterial solution was aspirated from the wound with sterile filter paper at 48 h, and Fusarium oxysporum f. sp. blocks were inoculated and placed in a light incubator for cultivation. The degree of leaf rot was observed. At 72 h, the lesion area phenotype was observed. Disease symptoms on Panax notoginseng leaves were recorded using a digital camera (Nikon), and the lesion area size was measured using ImageJ software. Samples were rapidly frozen at -80°C, and five biological replicates were set up. Further analysis of the expression level of PnPLA1-21 after inoculation with Fusarium oxysporum f. sp. via qRT-PCR was performed. The results showed that 72 h after inoculation with Fusarium oxysporum f. sp., the rot area of ​​Panax notoginseng leaves after PnPLA1-21 RNAi was significantly aggravated compared to the uninoculated group, with the lesion area approximately twice that of the uninoculated group. Figure 4 A, C). qRT-PCR results showed that 72 h after inoculation with Fusarium oxysporum, the expression level of PnPLA1-21-RNAi was significantly downregulated (A, C). Figure 4D). In summary, expression of the PnPLA1-21-RNAi vector significantly reduced the expression level of PnPLA1-21 in Panax notoginseng leaves, and the reduced expression level of PnPLA1-21 increased susceptibility to Fusarium oxysporum. This indicates that PnPLA1-21 has a positive regulatory effect on resistance to Fusarium oxysporum, a root rot pathogen.

[0032] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A Panax notoginseng phospholipase gene PnPLA1-21, characterized in that, The nucleotide sequence of the Panax notoginseng phospholipase gene PnPLA1-21 is shown in SEQ ID NO:

1.

2. The Panax notoginseng phospholipase gene PnPLA1-21 according to claim 1, characterized in that, The Panax notoginseng phospholipase gene PnPLA1-21 contains a complete open reading frame, encoding a protein with the amino acid sequence shown in SEQ ID NO:

2.

3. The application of the Panax notoginseng phospholipase gene PnPLA1-21 according to claim 1 or 2 in improving the resistance of Panax notoginseng to root rot pathogens.

4. The application according to claim 3, characterized in that: The pathogen causing root rot is Fusarium oxysporum.

5. A method for verifying the effect of improving the resistance of Panax notoginseng to Fusarium oxysporum in the application described in claim 3, characterized in that, Includes the following steps: S1. Cloning the phospholipase gene PnPLA1-21 from Panax notoginseng; S2. Design gene-specific primers with attB linkers to amplify the PnPLA1-21 RNAi fragment, and construct the pHellsgate 2-PnPLA1-21 RNAi vector using Gateway technology. S3. The recombinant vector pHellsgate 2-PnPLA1-21 and the empty vector were transformed into Agrobacterium tumefaciens EHA105 competent cells, respectively. S4. Puncture fresh Panax notoginseng leaves and inject Agrobacterium tumefaciens solution containing recombinant vector and empty vector respectively; S5. After removing the bacterial fluid from the wound, inoculate with Fusarium oxysporum mycelium cake; S6. By observing phenotypes, counting lesion areas, and detecting the expression level of PnPLA1-21 by qRT-PCR, we analyzed the changes in resistance to Fusarium oxysporum after gene silencing.

6. The method according to claim 5, characterized in that, The OD of the Agrobacterium tumefaciens bacterial solution in step S4 600 The value was 0.4-0.6, and the inoculation volume was 100 µL.

7. The method according to claim 5, characterized in that, The Fusarium oxysporum mycelium discs described in step S5 are 1 cm in diameter. After inoculation, the culture conditions are 25°C, 16 h light / 8 h dark. Phenotypic observation and sampling are performed after 72 h of culture.

8. The application of the Panax notoginseng phospholipase gene PnPLA1-21 as described in claim 1 in the cultivation of Panax notoginseng plants with enhanced resistance to root rot.