A high-performance laccase mutant based on multi-source gene recombination and application thereof

Abstract

This invention discloses a high-performance laccase mutant constructed based on multi-source gene recombination and its applications. Using BspLac from Bacillus sp. SL-1 and BLTCLac from Bacillus licheniformis TCCC111219 as templates, a mutant library DS was constructed using DNA shuffling technology. Two high-performance laccase mutants, DS2 and DS5, were obtained through screening. Dynamic enzyme production analysis showed that the laccase activity of DS2 peaked at 1922 U / L after 24 hours, equivalent to twice that of the original strain; the laccase activity of DS5 peaked at 1337 U / L after 24 hours, equivalent to 1.4 times that of the original strain. Simultaneously, experimental verification showed that DS2 and DS5 achieved degradation rates of 83% and 89% for malachite green, respectively. This laccase mutant significantly improved the detoxification efficiency of synthetic dyes and possesses good potential for industrial application.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a high-performance laccase mutant constructed based on multi-source gene recombination and its application in dye degradation. Background Technology

[0002] Lacase (EC 1.10.3.2) is a copper-containing polyphenol oxidase widely found in fungi, bacteria, plants, and insects. Lacase utilizes molecular oxygen as an electron acceptor to catalyze the oxidation of various aromatic compounds, including phenols, aromatic amines, polyphenols, and their derivatives, while simultaneously reducing oxygen to water. Due to its broad substrate spectrum and the fact that the reaction produces only water as a byproduct, lacase is considered an environmentally friendly green biocatalyst. In recent years, with the rapid development of synthetic biology and enzyme engineering, research on the application of lacase in fields such as biobleaching, food processing, biosensors, and environmental remediation has become increasingly in-depth.

[0003] Laccases exhibit unique application potential in the field of organic pollution degradation. Rapid modern industrial development has led to the entry of large quantities of recalcitrant organic pollutants, such as synthetic dyes, polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), pesticides, and endocrine disruptors, into the environment, posing a serious threat to ecosystems and human health. Traditional physicochemical treatment methods often suffer from drawbacks such as high cost, high energy consumption, and the potential for secondary pollution. Laccases, due to their highly efficient catalytic oxidation capabilities for various aromatic pollutants, can promote the structural cleavage, demethylation, deamination, or polymerization of pollutants under mild conditions, thereby reducing their toxicity or improving their biodegradability. For example, laccases have significant decolorizing effects on synthetic dyes such as anthraquinones, azo dyes, and triphenylmethanes, and also demonstrate good degradation performance for PAHs. Therefore, developing high-performance laccases for the bioremediation of organic pollutants has become a research hotspot in the field of environmental biotechnology.

[0004] However, naturally derived laccases generally suffer from limitations in practical applications, such as low enzyme activity, poor stability, narrow pH adaptability, and insufficient expression levels. While laccases from different sources differ in structure and catalytic properties, single-source laccases often fail to simultaneously meet the industrial requirements of high-efficiency catalysis, broad-spectrum substrate adaptability, and high stability. For example, fungal laccases typically have high redox potentials, but they are easily inactivated under alkaline environments and high temperatures; bacterial laccases, while exhibiting good thermal and pH stability, have relatively low catalytic efficiency. To address these shortcomings of single laccases, researchers have attempted to modify enzyme molecules through physicochemical mutagenesis, site-directed mutagenesis, or directed evolution. However, traditional mutagenesis methods are often highly random, involve arduous screening processes, and have low positive mutation rates; site-directed mutagenesis relies on a deep understanding of the relationship between enzyme structure and function, making it difficult to achieve synergistic optimization of multiple traits; and conventional directed evolution typically uses a single gene as a template, which, limited by the genetic diversity of the starting template, results in limited performance improvements in the obtained mutants.

[0005] DNA shuffling, a multi-source gene recombination technology, involves randomly digesting multiple homologous genes with DNase I to generate a random fragment library. This is followed by primerless PCR repolymerization and primer-assisted PCR amplification to achieve fragment recombination between genes from different sources, thus mimicking gene recombination in natural evolution at the molecular level. Compared to directed evolution using a single gene as a template, DNA shuffling can integrate beneficial mutations from multiple parental genes in a shorter time, effectively broadening the genetic diversity of the mutant library and significantly increasing the probability of obtaining high-performance mutants. Currently, the application of enzyme molecular modification strategies based on multi-source gene recombination in the construction of laccase mutants is still relatively limited, especially in the targeted optimization of organic pollutant degradation performance, where there are few reports. Summary of the Invention

[0006] To address the current problems of low enzyme activity, poor stability, and narrow pH adaptability of laccase, as well as the low detoxification efficiency of laccase for synthetic dyes, this invention provides a high-performance laccase mutant constructed based on multi-source gene recombination and its applications.

[0007] The specific technical solution of this invention is as follows:

[0008] In a first aspect, the present invention provides a high-performance laccase mutant constructed based on multi-source gene recombination. The amino acid sequence of the laccase mutant is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0009] Secondly, this invention provides the encoding gene for the aforementioned laccase mutant. Based on the laccase mutant provided by this invention, the gene encoding this laccase mutant should still fall within the protection scope of this invention.

[0010] Thirdly, the present invention provides a recombinant expression vector carrying the coding gene of the above-mentioned laccase mutant.

[0011] A recombinant expression vector is a DNA molecule used to introduce a foreign gene into a host cell for expression. Based on the laccase mutant nucleotide sequence provided by this invention, the recombinant expression vector can be constructed by linking the laccase mutant nucleotide sequence of this invention to various vectors using conventional methods in the art. Various conventional vectors in the art, such as various plasmids, bacteriophages, or viral vectors, linked with the laccase mutant nucleotide sequence of this invention, should all fall within the scope of protection of this invention.

[0012] Preferably, the recombinant expression vector is a plasmid, bacteriophage, or viral vector.

[0013] Fourthly, the present invention provides a host cell carrying the above-mentioned coding gene or the above-mentioned recombinant expression vector.

[0014] Preferably, the host cell is Escherichia coli.

[0015] Fifthly, the present invention provides the application of the above-mentioned laccase mutant in the degradation of triphenylmethane synthetic dyes.

[0016] Preferably, the triphenylmethane synthetic dye is malachite green.

[0017] Furthermore, the present invention also provides a method for degrading triphenylmethane synthetic dyes, comprising the following steps:

[0018] The aforementioned laccase mutant was added to a system containing triphenylmethane-based synthetic dyes for catalytic reaction. For example, catalytic degradation of malachite green was verified using this mutant. The degradation rate of malachite green by the mutant was over 80%, significantly higher than that of the wild type. This laccase mutant significantly improved the detoxification efficiency of synthetic dyes.

[0019] Compared with the prior art, the present invention has the following technical effects:

[0020] (1) This invention uses BspLac, a laccase derived from Bacillus sp. SL-1, and BLTCLac, a laccase derived from Bacillus licheniformis TCCC111219, as templates. A mutant library DS was constructed using DNA shuffling technology, and two high-performance laccase mutants, DS2 and DS5, were obtained through screening. Dynamic enzyme production analysis showed that the laccase activity of DS2 peaked at 1992 U / L after 24 hours, equivalent to twice that of the original strain; the laccase activity of DS5 peaked at 1383 U / L after 24 hours, equivalent to 1.4 times that of the original strain. Enzymatic property analysis showed that the optimal temperature for DS2 was 90℃, and for DS5 it was 70℃, demonstrating its high-temperature stability. The optimal pH for both DS2 and DS5 was 5.0. Notably, compared to most fungal laccases, DS2 exhibited good catalytic activity within a pH range of 3.0–7.0, showing a wider pH adaptability. It is evident that DS2 and DS5 possess excellent enzymatic properties.

[0021] (2) In addition, experimental verification showed that the degradation rates of malachite green by DS2 and DS5 reached 83% and 89% respectively, which were significantly higher than those of wild type. This laccase mutant significantly improved the detoxification efficiency of synthetic dyes and has good potential for industrial application. Attached Figure Description

[0022] Figure 1 The results of the initial and secondary screening of laccase mutants are shown.

[0023] Figure 2 Results of enzyme production by fermentation of wild-type laccase BspLac and DS2 and DS5 mutants.

[0024] Figure 3 Results of enzymatic property tests on laccase mutants DS2 and DS5.

[0025] Figure 4 Results of dye decolorization performance tests for laccase mutants DS2 and DS5. Detailed Implementation

[0026] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0027] The reagents used in the following examples are:

[0028] ClonExpress Ultra One Step Cloning Kit V3, 2×Phanta Max Master Mix (Dye Plus) were purchased from Novizan, 2×Magic Green Taq SuperMix were purchased from Tolo Harbour, Dpn I enzyme was purchased from Beyotime, rCutSmart™ buffer was purchased from NEB, 50×TAE buffer was purchased from Beyotime, PCR product purification kit and plasmid extraction kit were purchased from Daling Biotechnology, and DNase I was purchased from Promega.

[0029] The culture medium used in the following examples is:

[0030] Screening plates (g / L): 12.0 g tryptone, 24.0 g yeast extract, 12.54 g potassium dihydrogen phosphate, 2.31 g dipotassium hydrogen phosphate, 4 mL glycerol, 2 mM CuSO4, 0.5 mM ABTS and 3 g agar. Sterilize at 121 ℃ for 20 min. After the medium cools to below 60 ℃, add kanamycin sulfate and 0.1 mM IPTG.

[0031] Colorimetric plates (g / L): 12.0 g tryptone, 24.0 g yeast extract, 12.54 g potassium dihydrogen phosphate, 2.31 g dipotassium hydrogen phosphate, 4 mL glycerol, 2 mM CuSO4, 0.5 mM ABTS and 3 g agar. Sterilize at 121 ℃ for 20 min. After the culture medium cools to below 60 ℃, add kanamycin sulfate and 0.1 mM IPTG.

[0032] Seed culture medium (g / L): 10.0 g tryptone, 5.0 g yeast extract, 10.0 g sodium chloride, sterilized at 121 ℃ for 20 min, and kanamycin sulfate was added to a final concentration of 50 μg / mL before use.

[0033] Fermentation medium (g / L): 12.0 g tryptone, 24.0 g yeast extract, 12.54 g potassium dihydrogen phosphate, 2.31 g dipotassium hydrogen phosphate, 4 mL glycerol, 2 mM CuSO4, sterilized at 121 ℃ for 20 min. Before use, add kanamycin sulfate to a final concentration of 50 μg / mL and 0.1 mM IPTG.

[0034] Example 1: Construction of laccase mutants

[0035] The laccase BspLac used in this embodiment is derived from Bacillus sp. SL-1 (GeneBank accession number: KU711667.1), and the laccase BLTCLac used is derived from Bacillus licheniformis TCCC111219 (GeneBank accession number: MK946982). Laccase mutants were constructed using the BspLac and BLTCLac genes, as follows:

[0036] Using pET-28a-BspLac plasmid as a template, PCR amplification was performed with primers BspLac-F and BspLac-R; using pET-28a-BLTCLac plasmid as a template, PCR amplification was performed with primers BLTCLac-F and BLTCLac-R. After verification by agarose gel electrophoresis, the parental gene fragment of approximately 1539 bp was cut and recovered. The two parental genes were mixed in equal proportions, and 1.5 ng of template gene (3 ng total), 0.3 U DNase I, 5 μL 10× buffer, and 1 μL 20 mM MgSO4 were added to a 50 μL reaction system. 2+ Add ddH2O to a final volume of 50 μL, react at 15℃ for 2 min, then heat at 90℃ for 10 min to inactivate DNase I. Observe and cleave random fragments of 80-100 bp by 2% agarose gel electrophoresis.

[0037] Primer-free PCR was performed using the recovered fragments as templates and primers: 25 μL of 2×Magic Green Taq Mix and 25 μL of the 80-100 bp product were added to a 50 μL reaction mixture; the PCR program was as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 95℃ for 15 s, annealing at 57℃ for 30 s, and extension at 72℃ for 30 s, for a total of 40 cycles; and finally, complete extension at 72℃ for 5 min. 5 μL of the primer-free PCR product was subjected to 1% agarose gel electrophoresis to observe repolymerization and was then recovered. Using the primerless PCR product as a template, primer-based PCR was performed with primers pET-28a-BspLac-F and pET-28a-BspLac-R: 1 μL of primerless PCR product, 2 μL of upstream primer, 2 μL of downstream primer, 20 μL of 2×Magic Green Taq Mix, and 25 μL of ddH2O were added to a 50 μL reaction mixture. The PCR program was: 95℃ pre-denaturation for 3 min; followed by 30 cycles of 95℃ denaturation for 15 s, 57℃ annealing for 30 s, and 72℃ extension for 30 s; and a final extension at 72℃ for 5 min. After verification by 1% agarose gel electrophoresis, a fragment of approximately 1.5 kb was recovered. Using the ClonExpress Ultra One Step Cloning Kit V3, this fragment was ligated to the expression vector Tac to obtain the mutant plasmid library Tac-DS.

[0038] The plasmid library was transformed into *E. coli* BL21(DE3) competent cells, plated on selection plates, and incubated at 37°C until distinct single colonies appeared. Six mutants with larger color-changing zones were selected from the selection plates. Using *BspLac* as a positive control, these mutants were transferred to chromogenic plates and incubated at 28°C for 12 hours. The results showed that the color-changing zones of the mutants were significantly larger than those of the control. Based on the size and intensity of the purple color-changing zone around the colonies, two laccase mutants with larger color-changing zones and deeper color were selected and named DS2 and DS5, respectively. Figure 1 As shown; other mutants showed lighter color changes and poorer performance. The amino acid sequences of DS2 and DS5 are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively, and the nucleotide sequences are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively. It is evident that this embodiment utilizes DNA shuffling technology, which is expected to successfully screen for laccase mutants with better performance. Therefore, DS2 and DS5 were used for further verification.

[0039] The primer sequences used in this embodiment are as follows:

[0040] pET-28a-BSP-F: CTTTAAGAAGGAGATATACCATGAAGCTAGAGAAGTTCGTCG, as shown in SEQ ID No. 5.

[0041] pET-28a-BSP-R: TTGTTAGCAGCCGGATCTCATCATTGATGTCGCACGTCC, as shown in SEQ ID No. 6.

[0042] BLTCLac-F: ATGAAACTTGAAAAATTCGTTGACCG, as shown in SEQ ID No. 7.

[0043] BLTCLac-R: TTGATGACGAACATCTGTCACT, as shown in SEQ ID No. 8.

[0044] BspLac-F: TGAGCTAGAGAAGTTCGTCGA, as shown in SEQ ID No. 9.

[0045] BspLac-R: TCATTGATGTCGCACGTCC, as shown in SEQ ID No. 10.

[0046] Example 2: Fermentation of mutant enzymes

[0047] 10 μL of *E. coli* BL21(DE3) transformed with BspLac, BLTCLac, DS2, and DS5, respectively, were inoculated into 4 mL of LB liquid medium containing kanamycin sulfate and cultured overnight at 37 °C and 200 rpm. 1 mL of the overnight culture was transferred to 50 mL of fermentation medium and cultured at 37 °C and 200 rpm until the bacterial growth rate reached OD500. 600 When the enzyme concentration reached approximately 0.8, 1 mM CuSO4 and 0.1 mM IPTG were added, followed by incubation at 28 ℃ and 200 rpm for 24 h. Samples were then taken to determine laccase activity. The specific procedure was as follows: the fermentation broth was collected into clean centrifuge tubes in a clean bench, centrifuged at 4 ℃ and 8000 rpm for 10 min, and the supernatant was used to determine laccase activity. The results are as follows: Figure 2 As shown.

[0048] The results showed that during fermentation at 28 ℃ and 200 rpm, the laccase activity of DS2 peaked at 1922 U / L after 24 h, which was twice that of the starting strain BspLac; the laccase activity of DS5 peaked at 1337 U / L after 24 h, which was 1.4 times that of the starting strain BspLac. The laccase activities of BspLac and BLTCLac peaked at 954 U / m and 333 U / L after 24 h, respectively.

[0049] Example 3: Enzymatic properties of laccase mutant DS

[0050] To investigate the enzymatic properties of the obtained laccase mutants, the optimal temperature and pH were studied for DS2 and DS5, respectively. The results are as follows: Figure 3 As shown. Optimal temperature determination: Laccase was placed in a water bath at different temperatures ranging from 40℃ to 80℃ (in 10℃ intervals) for 3 minutes. Laccase activity was determined according to the laccase activity assay method, with the highest activity defined as 100%. Optimal pH determination: Laccase activity was determined according to the laccase activity assay method under citrate buffer conditions ranging from pH 3.0 to 7.0 (in 1.0 intervals), with the highest activity also defined as 100%.

[0051] The results showed that, Figure 3 As shown in Figure A, the optimal temperature for DS2 is 80℃, and the optimal temperature for DS5 is 70℃; Figure 3 As shown in B, the optimal pH for both DS2 and DS5 is 5.0. Notably, compared to most fungal laccases, DS2 exhibits good catalytic activity within a pH range of 3.0–7.0, demonstrating a wider pH adaptability.

[0052] Example 4: Dye decolorization performance of laccase mutant DS

[0053] Malachite green is a typical triphenylmethane synthetic dye, widely used in aquaculture, textile printing and dyeing, and leather processing due to its bright color, strong tinting strength, and low cost. However, malachite green has high biotoxicity and is carcinogenic, teratogenic, and mutagenic. Its residues in the environment can persist for a long time, posing a serious threat to aquatic ecosystems and human health. Therefore, developing efficient biological treatment methods for degrading malachite green is of significant environmental importance.

[0054] To evaluate the degradation performance of the laccase mutant obtained in this invention on organic dyes, a decolorization experiment was conducted using malachite green as a substrate. The reaction system was as follows: the laccase activity was uniformly adjusted to 500 U, the final concentration of malachite green was set to 30 mg / L, and the volume was increased to 3 mL with citrate buffer (pH 5.0). The mixture was then incubated in a water bath at 50°C for 2 h. After the reaction, the residual concentration of malachite green in each system was measured, and the decolorization rate was calculated. The results are as follows: Figure 4 As shown.

[0055] The results showed that after 2 hours of reaction, the decolorization rates of malachite green by both mutants DS2 and DS5 were higher than 80%, with DS5 showing the highest decolorization rate at 89%. These results indicate that the laccase mutants constructed in this invention have excellent degradation capabilities for the triphenylmethane dye malachite green, and possess significant application potential in the field of dye wastewater bioremediation.

[0056] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0057] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A high-performance laccase mutant constructed based on multi-source gene recombination, characterized in that: The amino acid sequence is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. The encoding gene of the laccase mutant as described in claim 1.

3. A recombinant expression vector carrying the coding gene as described in claim 2.

4. The recombinant expression vector as described in claim 3, characterized in that: The recombinant expression vector is a plasmid, bacteriophage, or viral vector.

5. A host cell carrying the coding gene of claim 2 or the recombinant expression vector of claim 4.

6. The recombinant expression vector as described in claim 5, characterized in that: The host cell is Escherichia coli.

7. The application of the laccase mutant as described in claim 1 in the degradation of triphenylmethane synthetic dyes.

8. The application as described in claim 7, characterized in that: The triphenylmethane-based synthetic dye is malachite green.

9. A method for degrading triphenylmethane-based synthetic dyes, characterized in that: Includes the following steps: The laccase mutant as described in claim 1 is added to a system containing triphenylmethane synthetic dyes to carry out a catalytic reaction.

Images