Chimera dsrna, complex for preventing and treating bursaphelenchus xylophilus and application thereof
By combining chimeric dsRNA with chitosan nanocomposite, the stability and delivery problems in pine wilt disease control were solved, achieving efficient and environmentally friendly pine wilt disease control and significantly improving insecticidal efficiency and control effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ANHUI AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-03-26
- Publication Date
- 2026-06-23
AI Technical Summary
Existing pine wilt control technologies suffer from problems such as high cost, difficulty in eradication, environmental pollution, and drug resistance. Furthermore, dsRNA has poor stability in the natural environment and within plants, and there is a lack of efficient delivery methods.
A nanocomposite consisting of chimeric dsRNA (LefDirect) and chitosan was delivered via trunk injection. The chimeric dsRNA simultaneously targets the Let-526, EF1, and flp-1 genes of pine wood nematode. The chitosan nanocarrier protects the dsRNA, thereby improving its stability and control efficacy.
It significantly improved the insecticidal efficiency of pine wilt disease, with a mortality rate of 88.8% after 96 hours of treatment, and significantly reduced the yellowing rate of pine trees. It is environmentally friendly and easy to operate, making it suitable for forest protection.
Smart Images

Figure CN122256351A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular, this invention relates to a chimeric dsRNA, complex, and application of pine wood nematode control. Background Technology
[0002] Pine wilt disease (PWD), also known as pine wilt, is called "the cancer of pine trees" and is a globally recognized quarantine disease caused by the pine wood nematode. The pine wood nematode spreads primarily in two ways: natural dispersal, which involves the nematode's own movement and short-distance transmission via insect vectors such as longhorn beetles; and human-mediated dispersal, which involves transporting wood and wood products carrying the nematode for long-distance transmission. Statistics show that 17 species of Pinaceae plants in China have been confirmed as natural hosts for the pine wood nematode, covering the genus *Pinus* (…). Pinus ) and the genus Larch ( Larix The widespread transmission of pine wilt disease, consisting of two main groups, has had a serious impact on the economy and the ecological environment.
[0003] Currently, the control of pine wilt nematode mainly relies on methods such as infested tree removal and chemical control. However, infested tree removal is costly and difficult to eradicate, while chemical control easily leads to environmental pollution, pesticide residues, and resistance. Therefore, the development of efficient, green, and sustainable new control technologies is urgently needed. RNAi technology provides a highly specific green solution for the control of pine wilt nematode. Its principle is to deliver dsRNA homologous to the key genes of the target pest, inducing gene silencing and causing the pest to die. CN201910976104.9 discloses the pine wilt nematode. tra-1 Gene and dsRNA targeting this gene; CN202411502030.2 discloses the pine wood nematode. Esg11 The gene and its dsRNA were identified, and the dsRNA showed a mortality rate of 71.67% for controlling pine wood nematode; CN202410641329.X disclosed eight species targeting pine wood nematode. V-ATPase dsRNA of genes and its application. However, directly applying dsRNA to the control of forest pests faces many challenges: (1) dsRNA targeting a single gene may lead to decreased efficacy or resistance due to gene redundancy or mutation in pests; (2) dsRNA is easily degraded in the natural environment and in plants, and has poor stability; (3) there is a lack of efficient and suitable dsRNA delivery methods for forest trees. Summary of the Invention
[0004] This invention aims to overcome the shortcomings of existing technologies and provide a highly efficient, stable, and environmentally friendly solution for the control of pine wood nematodes. This invention provides a chimeric dsRNA, a complex, and its applications for the control of pine wood nematodes.
[0005] Specifically, the technical solution is as follows: In one aspect, the present invention provides a chimeric dsRNA, the sequence of which is shown in SEQ ID NO.5.
[0006] In this invention, the chimeric dsRNA is derived from three key lethal target genes of the pine wood nematode: Let-526 (200bp) EF1 (200 bp) and flp-1 (330 bp) These three gene fragments were sequentially ligated using overlap extension PCR to construct a chimeric gene sequence with a total length of 730 bp (SEQ ID NO.4). Using this chimeric gene sequence as a template, the corresponding chimeric dsRNA was synthesized through in vitro transcription. Let-526 The gene sequence is shown in SEQ ID NO.1. EF1 The gene sequence is shown in SEQ ID NO.2. flp-1 The gene sequence is shown in SEQ ID NO.3.
[0007] In this invention, the chimeric dsRNA is also named "LefDirect".
[0008] In one aspect, the present invention provides a complex comprising chimeric dsRNA, said complex being composed of chimeric dsRNA and nano-chitosan, which are formed into a nanocomposite through electrostatic self-assembly. The chitosan-dsRNA complex of the present invention effectively protects dsRNA from degradation by nucleases in the environment and significantly improves the interference efficiency of dsRNA against pine wood nematodes.
[0009] In one aspect, the present invention discloses a method for preparing a complex comprising chimeric dsRNA, the method comprising: (1) Prepare buffer solutions: Prepare pH 4.5, 100 mM sodium acetate buffer and 100 mM sodium sulfate buffer; (2) Dissolving chitosan: Dissolve chitosan in sodium acetate buffer solution; (3) Dissolving dsRNA: Dissolve dsRNA in nuclease-free water and mix with sodium sulfate buffer; (4) Mixing and granulation: Mix the chitosan solution with the dsRNA solution, heat at 55°C and immediately vortex at high speed to promote the formation of nanoparticles; (5) Centrifugation and collection: After high-speed centrifugation for a period of time, a white precipitate was obtained, which is the complex nanoparticle of chimeric dsRNA.
[0010] In some embodiments, the present invention discloses a method for preparing a complex comprising chimeric dsRNA, the method comprising: (1) Prepare buffer solutions: Prepare 100 mM sodium acetate buffer (pH 4.5) and 100 mM sodium sulfate buffer; (2) Dissolving chitosan: Dissolve chitosan in sodium acetate buffer to prepare a 0.02% (w / v) solution; (3) Dissolving dsRNA: Dissolve 20 μg of dsRNA in 50 μL of nuclease-free water and mix with 50 μL of sodium sulfate buffer; (4) Mixing and granulation: Mix 100 μL of chitosan solution with 100 μL of dsRNA solution, heat at 55°C for 1 minute, and then immediately vortex at high speed for 30 seconds to promote the formation of nanoparticles; (5) Centrifugation and collection: Centrifuge at 13,000 xg for 10 minutes to obtain a white precipitate, which is the complex nanoparticle of chimeric dsRNA.
[0011] In one aspect, the present invention discloses the application of chimeric dsRNA in the prevention and control of pine wood nematode infection in pine trees, the sequence of which is shown in SEQ ID NO.5.
[0012] In one aspect, the present invention discloses the application of the complex comprising chimeric dsRNA in the prevention and control of pine wood nematode infection in pine trees.
[0013] In one aspect, the present invention discloses a product for preventing pine trees from being infected with pine wood nematode, the product containing chimeric dsRNA, the sequence of which is shown in SEQ ID NO.5.
[0014] In some embodiments, the product is a kit containing chimeric dsRNA.
[0015] In one aspect, the present invention discloses the use of a complex containing chimeric dsRNA in the preparation of products for preventing and controlling pine wood nematode infection in pine trees.
[0016] In one aspect, the present invention discloses a method for preventing pine wood nematode infection in pine trees, the method comprising directly injecting the product of the present invention containing chimeric dsRNA into the trunk of a pine tree infected with or at risk of infection by pine wood nematode.
[0017] In some embodiments, the product is a complex containing chimeric dsRNA.
[0018] In some embodiments, the injection method is as follows: the prepared chitosan-LefDirect complex solution (recommended dsRNA working concentration of 3000 ng / μL) is injected into holes at a 45-degree angle downwards at different locations on the base of the trunk (hole diameter of about 2 mm, depth to the xylem) at a dose of about 30 μL per pine tree. The solution is then slowly injected into the holes, and the holes are sealed with sterile absorbent cotton or tree wound dressing after injection. Beneficial effects
[0019] (1) Multi-target high-efficiency lethality: The chimera LefDirect of this invention can simultaneously silence three key genes of pine wood nematode ( Let-526 , EF1 , flp-1 It produces a synergistic lethal effect. Pot experiments showed that its insecticidal efficiency was significantly higher than that of single-gene dsRNA, with a corrected mortality rate of 88.8% for pine wilt nematodes after 96 hours of treatment.
[0020] (2) High stability: Chitosan nanocarriers effectively encapsulate dsRNA, significantly improving its stability in plants and the environment, and prolonging its action time.
[0021] (3) Significant control effect: The application of chitosan-LefDirect complex by injection into the trunk can effectively inhibit the infection of black pine by pine wood nematode. Experimental data showed that on the 32nd day after treatment, the yellowing rate of black pine needles could be reduced to 23.5%, which was significantly lower than that of the positive control (100%) and the unencapsulated dsRNA treatment group (44.5%).
[0022] (2) Environmentally friendly and easy to operate: This technology is based on the principle of RNAi, is safe for non-target organisms, and reduces the environmental pollution caused by traditional chemical pesticides. The trunk injection method is simple to operate and is suitable for practical scenarios of forest protection. Attached Figure Description
[0023] Figure 1 The effect of dsLet526 injection on the yellowing rate of black pine; Note: The group included a nuclease-free water treatment group, a pine wilt nematode inoculation group, and a pine wilt nematode inoculation followed by dsLet526 injection group. Photos were taken every 7 days to record the yellowing rate of black pine.
[0024] Figure 2 The effect of dsEF1 injection on the yellowing rate of black pine; Note: The group included a nuclease-free water treatment group, a pine wilt nematode inoculation group, and a dsEF1 injection group after pine wilt nematode inoculation. Photos were taken every 7 days to record the yellowing rate of black pine.
[0025] Figure 3The effect of dsflp-1 injection on the yellowing rate of black pine was studied. Note: The study included a water treatment group without nuclease, a pine wilt nematode inoculation group, and a dsflp-1 injection group after pine wilt nematode inoculation. Photos were taken every 7 days to record the yellowing rate of black pine.
[0026] Figure 4 Effect of injecting chimeric dsRNA (LefDirect) on the yellowing rate of black pine. Note: The treatment included a nuclease-free water treatment group, a pine wilt nematode inoculation group, and a pine wilt nematode inoculation followed by dsRNA (LefDirect) injection group. Photos were taken every 7 days to record the yellowing rate of black pine.
[0027] Figure 5 The effect of chitosan-delivered chimeric dsRNA (LefDirect) on the yellowing rate of black pine; Note: The study included a nuclease-free water treatment group, a pine wilt nematode inoculation group, and a pine wilt nematode inoculation followed by dsRNA (LefDirect) injection group. Photos were taken every 7 days to record the yellowing rate of black pine.
[0028] Figure 6 The effect of spray chimeric dsRNA (LefDirect) on the yellowing rate of black pine. Note: The study included a nuclease-free water treatment group, a pine wilt nematode inoculation group, and a dsRNA (LefDirect) spray treatment group after pine wilt nematode inoculation. Photos were taken every 7 days to record the yellowing rate of black pine. Detailed Implementation
[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.
[0030] 1. Target gene screening and design and synthesis of chimeric dsRNA (LefDirect) 1.1 Total RNA extraction and cDNA synthesis from Pine Wood Nematode Pine wood nematodes were collected and allowed to stand for 3-4 hours. Then, 500 μL of the nematode suspension from the bottom was aspirated and centrifuged at 5000 rpm for 5 minutes, discarding the supernatant. 500 μL of TRIzol reagent was added, and the mixture was flash-frozen in liquid nitrogen. Total RNA was extracted from the pine wood nematodes strictly according to the TRIzol method instructions. The concentration and purity of the extracted RNA were determined using a NanoDrop ND1000 spectrophotometer (an A260 / A280 ratio between 1.8 and 2.0 was considered acceptable). Subsequently, the first-strand cDNA was synthesized using the Novozymes HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) according to the instructions, starting with 1 μg of total RNA. The cDNA was stored at -20°C for later use.
[0031] 1.2 Target gene screening and primer design Based on the local transcriptome database of *Pinus wiltus*, three key lethal target genes were identified through homology comparison using known *C. elegans* gene sequences: Let-526 , EF1 and flp-1 Using the SnapDragon-dsRNADesign online design software, PCR amplification primers for synthesizing dsRNA templates and primers for qPCR were designed for the CDS regions of each gene (GenScript online design website). All primers used for in vitro transcription template amplification had the T7 promoter sequence (TAATACGACTCACTATAGGG) added to the 5' end. Simultaneously, specific primers for overlap extension PCR were designed to construct chimeric genes, ensuring seamless splicing of the three fragments. All primer sequences are detailed in Table 1.
[0032] Table 1 Primer sequence information used in this invention
[0033] Note: The bolded base sequence in the table: TAATACGACTCACTATAGGG is the T7 promoter sequence. 1.3 Construction of chimeric gene sequences First, using the synthesized cDNA as a template, PCR amplification was performed using the corresponding gene PCR primers in Table 1 to obtain... Let-526 (200 bp, SEQ ID NO.1) EF1 (200 bp, SEQ ID NO.2) and flp-1A DNA fragment of 330 bp (SEQ ID NO. 3) was obtained. The PCR reaction system (25 μL) consisted of: 1 μL of the front primer, 1 μL of the back primer, 1 μL of cDNA template, 12.5 μL of 2×PCRMix, and 9.5 μL of ddH2O. The reaction program was: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, and 72°C extension for 30 s, for a total of 34 cycles; and a final extension at 72°C for 10 min. The amplified product was verified by 1.5% agarose gel electrophoresis and then purified by gel extraction.
[0034] Then, using the three purified gene fragments as templates, overlap extension PCR was performed using the bridging PCR primers designed in Table 1. The three fragments were precisely spliced in the order Let-526 - EF1 - flp-1 to obtain a chimeric gene sequence with a total length of 730 bp (SEQ ID NO.4). The bridging PCR used the same reaction procedure and system, but the reaction volume was increased to 100 μL (each component was increased proportionally) to obtain sufficient product. The PCR product was purified using a DNA purification kit from Promega.
[0035] 1.4 In vitro transcriptional synthesis of dsRNA 1.4.1 Synthesis of single-gene dsRNA The Promega T7 RiboMAX™ Express RNAi System kit was used. A 20 μL reaction mixture was prepared in a sterile 1.5 mL centrifuge tube: 10 μL 2×Buffer, 2 μL T7 Enzyme Mix, and approximately 1 μg of purified target gene T7-DNA template. The volume was brought to 20 μL with RNase-free ddH2O. After gentle mixing and brief centrifugation, the mixture was incubated at 37°C for 3 hours.
[0036] After incubation, place the reaction tube in a 70°C water bath (the water volume should submerge half the height of the tube) for 10 minutes to heat shock, inactivating the enzyme and promoting double-strand formation. Then let it stand at room temperature for about 20 minutes to allow the temperature to drop naturally to around 37°C.
[0037] Prepare RNase A dilution buffer: Add 1 μL of RNase A to 199 μL of RNase-free ddH2O and mix well. Add 1 μL of this dilution buffer and 1 μL of RQ1 DNase to each reaction system, mix gently, and incubate at 37°C for 30 minutes to degrade single-stranded RNA and residual DNA template.
[0038] After the reaction was complete, 50 μL of 95% ethanol and 2 μL of 3M sodium acetate (pH 5.2) were added, and the mixture was gently mixed and incubated at 4°C for 30 minutes to precipitate dsRNA. Subsequently, the mixture was centrifuged at 12000 g for 15 minutes in a centrifuge pre-cooled to 4°C, and the supernatant was carefully discarded.
[0039] Add 750 μL of pre-cooled 75% ethanol to the precipitate, gently wash the precipitate, centrifuge at 7500 g for 5 minutes at 4°C, and discard the ethanol eluent. Centrifuge again briefly (4°C, 7500 g, 30 seconds), remove the remaining liquid with a pipette, and air dry the precipitate at room temperature for about 2 minutes with the cap open.
[0040] Finally, add an appropriate amount (30-50 μL) of nuclease-free water to dissolve the dsRNA based on the amount of precipitate. Measure the dsRNA concentration using a NanoDrop ND1000, aliquot, and store at -80°C for later use.
[0041] 1.4.2 Chimeric dsRNA (LefDirect) synthesis Using the purified 730 bp chimeric gene sequence as a template, in vitro transcription was performed strictly following the same kit operation steps, reaction system, and purification process as described in Section 1.4.1 above to synthesize chimeric dsRNA (SEQ ID NO.5), named "LefDirect". Its concentration and quality were verified using a NanoDrop ND1000 and then stored at -80℃.
[0042] The chimeric dsRNA (SEQ ID NO.5) is as follows: 5'-CGACCAAUACCAACAAUAGUGUGGAGAACAUUUUCCAGAAGAUUGGCGCCAUUCCUCCG AGACUGCAUCCAGAACUCGGGAUGCACAACGCUUUCCCCUUUGGAAAUAUGAACGCCUUCUUGGAAGUGAUCAAACAGAACUCUGGAUCCGGGGACUCCAUGAAUUUUGACUUUGGUCCCUUGAUGAAUCAGGCCUCUUCAAAGGAAGCCCAAGAAAUGGGAAAAGGUUCCUUCAAGUACGCCUGGGUGUUGGACAAGCUGAAGGCUGAGCGUGAACGUGGUAUUACCAUCGAUAUCGCUCUGUGGAAGUUCGAGACUUCCAGGUACUACGUGACCAUCAUCGAUGCCCCUGGCCAUCGUGAUUUUAUCAAGAACAUGAUCACUGGUACUUCUCAGGCUGAUGGAUGUUAUGGACCAGGCUCUGAUCAACGAGCUCAUGGAAGAAGUUCAGCACGCAAAACCACAGAAAAGAGAUUCCAAAUUUACAGGAGAGUUCGGCAAAAAAGGAAGUGAGCCCAACUUUUUGCGGUUCGGCAAACGCGCAGCUCCCGCCCCCAACGCGGCCGGCGCCAAUUUCCUGCGUUUCGGGAAAUCGGGCGCGGAUCCAAACUUCUUGCGCUUCGGGAAACGAGCCACCGAGUUCCGCCUCGACGCCACCGAACCCAACUUCCUGAGGUUCGGCAAACGACCCGACCCCUCGGCCAUGAGCAACAACUUUUUGAGGUUCGGGA-3’ Example 2. Construction of dsRNA delivery systems (complexes containing chimeric dsRNA, chitosan-LefDirect complexes) Preparation of buffer: Prepare 100 mM sodium acetate buffer (pH 4.5) and 100 mM sodium sulfate buffer. (2) Dissolving chitosan: Dissolve chitosan in sodium acetate buffer to prepare a 0.02% (w / v) solution. (3) Dissolving dsRNA: Dissolve 20 μg dsRNA in 50 μL nuclease-free water and mix with 50 μL sodium sulfate buffer. (4) Mixing and granulation: Mix 100 μL chitosan solution with 100 μL dsRNA solution, heat at 55°C for 1 minute and then immediately vortex at high speed for 30 seconds to promote nanoparticle formation. (5) Centrifugation and collection: Centrifuge at 13,000 xg for 10 minutes to obtain a white precipitate (i.e., nanoparticles, chitosan-LefDirect complex), and use the supernatant to calculate the dsRNA encapsulation efficiency.
[0043] Example 3. Application Method The application method of this invention is trunk injection. Using a microsyringe, the prepared chitosan-LefDirect complex solution (recommended dsRNA working concentration of 3000 ng / μL) is injected into holes drilled at a 45-degree angle downwards at different locations on the base of the trunk (hole diameter approximately 2 mm, depth to the xylem). The solution is then slowly injected into the holes, and the holes are sealed with sterile absorbent cotton or tree wound dressing after injection.
[0044] Test Example: Verification Test of Prevention and Control Efficacy (1) Culture of pine wood nematodes The pine wood nematodes used in the experiment were provided by the Plant Nematode Laboratory of the College of Plant Protection, Anhui Agricultural University, and were passaged and cultured in our laboratory. In a 26℃ dark incubator, *Botrytis cinerea* (a type of pine nematode) grown on PDA plates was used. Botrytis cinerea The nematodes were subcultured using mycelium as a food source. They were periodically transferred to fresh mycelial plates. During testing, the Bellman funnel method was used to separate the nematodes, which had been cultured for approximately two weeks, from the plates and collect them in sterile water to obtain a pure, active suspension of pine wood nematodes for subsequent experiments.
[0045] (2) In vitro immersion test: lethal effect of different dsRNAs on pine wood nematodes RNAi efficiency was assessed using an immersion method. Approximately 30 μL of pine wood nematode suspension (concentration approximately 15 nematodes / μL, totaling about 450 active nematodes) and 30 μL of dsRNA solution at a concentration of 600 ng / μL were added to each 1.5 mL clean centrifuge tube. The test setup included: a negative control group (containing only nuclease-free water with dsEGFP), single-gene dsRNA treatment groups (dsLet-526, dsEF1, dsflp-1), a chimeric dsRNA treatment group (LefDirect), and multiple gene dsRNA groups for comparison (see Table 2). Each group had three replicates. The 1.5 mL centrifuge tubes containing pine wood nematodes were incubated at 26°C in the dark. At 48 h, 72 h, and 96 h after treatment, the number of dead nematodes was observed and counted under a stereomicroscope (those without a response to needle touch were considered dead). The mortality rate was calculated and corrected (natural mortality rate was subtracted). One-way ANOVA was performed using GraphPadPrism 8 software. Results are expressed as mean ± standard deviation, with different letters indicating significant differences.
[0046] The test results (see Table 2) showed that, 96 h after treatment, compared with the negative control group (3.3%), the corrected mortality rates of the dsLet-526, dsEF1, and dsflp-1 treatment groups reached 86.7%, 84.4%, and 80.6%, respectively. The chimeric LefDirect exhibited the highest lethality at all time points, with a corrected mortality rate as high as 88.8% after 96 h.
[0047] Table 2. Lethality of different gene-specific dsRNAs against pine wood nematodes at different time points.
[0048] Note: Lowercase letters following the data in the same column in the table represent the results of the significance analysis. At a significance level of α=0.05, different letters indicate statistically significant differences, while the same letters indicate no significant differences.
[0049] (3) Pot test: Effect of different treatments on the yellowing rate of black pine Healthy, uniformly grown bare-root black pine seedlings (approximately 35 cm in length) were selected for an outdoor potted simulation experiment. One seedling was planted in each pot and managed using standard methods.
[0050] The test groups are as follows:
[0051] Negative control group: injected with 30 μL of nuclease-free water; Positive control group: each seedling was inoculated with 30 μL of pine wood nematode suspension (concentration approximately 15 nematodes / μL, totaling approximately 450 active nematodes), without dsRNA treatment. Test groups: each seedling was inoculated with an equal amount of pine wood nematode suspension. 12 hours later (after initial nematode colonization), 30 μL of dsRNA solutions with different treatments (concentration of 3000 ng / μL) were injected into the base of the stem. The test groups included: single-gene dsRNA groups (dsLet-526, dsEF1, dsflp-1), unencapsulated LefDirect group, and chitosan-encapsulated LefDirect complex group. In addition, a spray control group was established: after nematode inoculation, the entire seedling leaf surface and stem were uniformly sprayed with chitosan-LefDirect complex solution (total amount equivalent to the dsRNA amount in the injection group).
[0052] Observation and Statistics: Each treatment group contained 3 black pine seedlings, and the entire test was independently replicated 3 times (i.e., 9 seedlings per treatment). Starting from day 1 of the treatment, each seedling was photographed every 7 days (days 1, 8, 16, 24, and 32) for record-keeping (see [reference]). Figures 1-6 The yellowing rate of all needles was calculated (number of yellowed needles / total number of needles × 100%). Data were also analyzed using ANOVA and multiple comparisons (α = 0.05).
[0053] Control effect of single-gene dsRNA: By day 32, 100% of the needles in the positive control group were yellowed (Tables 3-5). In contrast, the yellowing rate in the dsLet-526 treatment group was significantly reduced to 43.3% ( Figure 1 & Table 3). The yellowing rate in the dsEF1 treatment group was significantly reduced to 47.1% ( Figure 2 & Table 4). The yellowing rate in the dsflp-1 treatment group was significantly reduced to 66.8% (see Table 4). Figure 3 (Table 5). This confirms the effectiveness of these three target genes at the in vivo level.
[0054] Table 3. Changes in the yellowing rate of black pine after injection of dsLet526 (%)
[0055] Note: Lowercase letters following data in the same column in the table represent the results of significance analysis. At a significance level of α=0.05, different letters indicate statistically significant differences, while the same letters indicate no significant differences. Table 3-8 follows the same rules, and the interpretation of its letter identifiers is consistent with this.
[0056] Table 4. Changes in the yellowing rate of black pine after injection of dsEF1 (%)
[0057] Table 5. Changes in the yellowing rate of black pine after injection of dsflp-1 (%)
[0058] 3.2 The preventive and therapeutic effects of chimeric dsRNA (LefDirect) The yellowing rate on day 32 after injection of unembedded LefDirect was 44.5%. Figure 4 (Table 6) The effect was comparable to dsLet-526 and dsEF1, but superior to dsflp-1 single treatment. Injection of the chitosan-encapsulated LefDirect complex significantly enhanced the prevention and control effect. On day 32, the yellowing rate further decreased significantly to 23.5% ( Figure 5 (See Table 7). The results were statistically significantly different from the unencapsulated group and all single-gene treatment groups (different letters), highlighting the key synergistic effect of chitosan nanocarriers in protecting dsRNA and prolonging its action time.
[0059] Table 6. Changes in yellowing rate of black pine after injection of chimeric dsRNA (LefDirect) (%)
[0060] Table 7. Changes in yellowing rate of black pine after injection of chitosan-delivered chimeric dsRNA (LefDirect) (%)
[0061] 3.3 Comparison Test of Application Methods When chitosan-LefDirect complex was applied by spraying, the yellowing rate of black pine needles remained as high as 96.4% on day 32. Figure 6 (Table 8) There was no statistically significant difference between the dsRNA spraying method and the positive control group (100%) (same letters), indicating that the dsRNA spraying method was not effective in controlling pine wilt disease. This result contrasts sharply with the injection method (which reduced the yellowing rate from 100% to 23.5%), clarifying that trunk injection is an indispensable application method for achieving efficient control in this technical scheme.
[0062] Table 8. Changes in yellowing rate of black pine after spray chimeric dsRNA (LefDirect) (%)
[0063] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A chimeric dsRNA, characterized in that, The sequence of the chimeric dsRNA is shown in SEQ ID NO.
5.
2. A complex comprising chimeric dsRNA, characterized in that, The complex consists of chimeric dsRNA and nano-chitosan, which form a nanocomplex through electrostatic self-assembly; wherein the sequence of the chimeric dsRNA is shown in SEQ ID NO.
5.
3. A method for preparing the complex comprising chimeric dsRNA as described in claim 2, characterized in that, The method includes: (1) Prepare buffer solutions: Prepare pH 4.5, 100 mM sodium acetate buffer and 100 mM sodium sulfate buffer; (2) Dissolving chitosan: Dissolve chitosan in sodium acetate buffer solution; (3) Dissolving dsRNA: Dissolve dsRNA in nuclease-free water and mix with sodium sulfate buffer; (4) Mixing and granulation: Mix the chitosan solution with the dsRNA solution, heat at 55°C and immediately vortex at high speed to promote the formation of nanoparticles; (5) Centrifugation and collection: After high-speed centrifugation for a period of time, a white precipitate was obtained, which is the complex nanoparticle of chimeric dsRNA.
4. The application of chimeric dsRNA in the prevention and control of pine wood nematode infection in pine trees, characterized in that, The sequence of the chimeric dsRNA is shown in SEQ ID NO.
5.
5. The use of a complex comprising chimeric dsRNA according to claim 2 in the prevention and control of pine wood nematode infection in pine trees.
6. A product for preventing pine trees from being infected with pine wood nematode, the product containing chimeric dsRNA, the sequence of which is shown in SEQ ID NO.
5.
7. The use of the complex comprising chimeric dsRNA as described in claim 2 in the preparation of a product for preventing and controlling pine wood nematode infection.
8. A method for preventing pine trees from being infected with pine wood nematodes, characterized in that, The method involves directly injecting a product containing chimeric dsRNA into the trunk of a pine tree infected with or at risk of infection by pine wood nematode, the sequence of which is shown in SEQ ID NO.
5.
9. The method according to claim 8, characterized in that, The product containing chimeric dsRNA is a complex containing chimeric dsRNA, the complex being composed of chimeric dsRNA and nano-chitosan, which are formed into a nanocomposite through electrostatic self-assembly; wherein the sequence of the chimeric dsRNA is shown in SEQ ID NO.
5.
10. The method according to claim 9, characterized in that, The injection method involves drilling holes at a 45-degree angle downwards at different locations on the base of the tree trunk, with a diameter of approximately 2 mm and a depth reaching the xylem, using the prepared complex solution containing chimeric dsRNA at the working concentration and dosage. The solution is then slowly injected into the holes, and the holes are sealed with sterile absorbent cotton or tree wound dressing after injection.
Citation Information
Patent Citations
Pine wood nematode tra-1 gene and application thereof to development interference
CN110777149A
DsRNA of eight targeting bursaphelenchus xylophilus V-ATPase genes and application
CN118389515A
Application of Bursaphelenchus xylophilus Esg11 gene and dsRNA and interference vector thereof in prevention and treatment of Bursaphelenchus xylophilus
CN119552859A