Application and method of dsrna of nivha-a gene in controlling brown planthopper
By silencing the V-ATPase gene of the brown planthopper using dsRNA of the NlVHA-A gene, the bottleneck problem of RNA interference technology in the control of brown planthopper was solved, and the biological control effect of reducing the survival rate and feeding impact of brown planthopper was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HENAN UNIVERSITY
- Filing Date
- 2026-03-30
- Publication Date
- 2026-06-23
AI Technical Summary
Existing technologies lack efficient, specific, and environmentally friendly biological control techniques to address the control of brown planthoppers. In particular, RNA interference technology faces bottlenecks in insect gene target selection and delivery, and the function and role of the V-ATPase subunit gene in brown planthoppers have not been fully studied.
Using dsRNA of the NlVHA-A gene, the V-ATPase gene of the brown planthopper was silenced by RNA interference technology. A biological reagent was prepared and injected into the brown planthopper. Combined with stabilizers such as trehalose, TE buffer and mannitol, the survival rate and feeding impact of the brown planthopper were reduced.
It effectively reduced the survival rate of brown planthoppers, the honeydew secretion and weight gain of emerging females, and reduced their direct feeding impact on rice, thus achieving the effect of biological control.
Smart Images

Figure CN122256354A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to biological control, particularly the green biological control of brown planthoppers. Background Technology
[0002] Rice is the staple food for half the world's population; therefore, increasing rice yield is of paramount importance in agricultural production. However, the brown planthopper, a major pest of rice, consistently ranks first among rice pests due to its short life cycle, high reproductive rate, and migratory nature. Since the 1970s, my country has long relied on organophosphates and neonicotinoids, leading to resistance in brown planthoppers to many pesticides, a sharp decline in natural enemies, and ecological imbalance in paddy fields. Therefore, the research and application of highly efficient, specific, and environmentally friendly biological control technologies have become a research hotspot both domestically and internationally.
[0003] RNA interference (RNAi) refers to the phenomenon where exogenous or endogenous double-stranded RNA (dsRNA) specifically induces gene expression silencing. RNAi triggers homologous mRNA degradation through exogenous dsRNA, and has advantages such as high interspecies specificity, easy degradation, and no residue, and is considered a core technology for next-generation green pest control.
[0004] The bottleneck to the commercialization of RNAi lies in "efficient targets" and "efficient delivery". On the one hand, the insect gene family is large and functionally redundant, requiring the screening of "lethal genes" that are essential for survival and whose sequences are conserved; on the other hand, it is necessary to ensure that the target gene lacks high homology in non-target organisms in order to reduce ecological risks.
[0005] V-ATPase (vacuolar-type ATPase) is a multi-substrate pump composed of a peripheral V1 complex (AH subunit) and an intracellular V0 complex. It pumps H⁺ into the extracellular space or organelle lumen through ATP hydrolysis, maintaining pH homeostasis, osmotic pressure, and neurotransmitter release. Application CN 111440810A discloses the application of dsRNA of the V-ATPase-V0 domain gene in locust control, primarily causing splitting of the locust's dorsal line, arching of its back, and death. However, the effect of V-ATPase gene dsRNA on brown planthoppers remains unknown.
[0006] There are no existing reports on using the V-ATPase subunit gene of brown planthopper as an RNA interference target for its control. The function of the relevant gene and its role in the growth, feeding and survival of brown planthopper still need further research and development. Summary of the Invention
[0007] To solve the above-mentioned technical problems, the present invention proposes a...NlVHA-A Application and methods of dsRNA in the control of brown planthopper.
[0008] The technical solution of this invention is implemented as follows: On the one hand, requesting protection NlVHA-A The application of dsRNA of genes in the control of brown planthoppers, among which NlVHA-A The gene is the brown planthopper V-ATPase gene.
[0009] Furthermore, the above NlVHA-A The CDS sequence of the gene is shown in SEQ ID No. 1.
[0010] Furthermore, the above NlVHA-A The amino acid sequence encoded by the gene is shown in SEQ ID No. 2.
[0011] Furthermore, the above-mentioned dsRNA includes the sense strand nucleotide sequence as shown in SEQ ID No. 3 and the antisense strand nucleotide sequence that is inversely complementary to it.
[0012] Secondly, a request for protection. NlVHA-A The dsRNA of the gene, wherein the dsRNA comprises the sense strand nucleotide sequence as shown in SEQ ID No. 2 and the antisense strand nucleotide sequence that is inversely complementary to it.
[0013] Thirdly, a biological agent for controlling brown planthoppers is provided, comprising the aforementioned dsRNA.
[0014] Furthermore, the above reagents also contain solvents or stabilizers; the stabilizers are reagents used to stabilize dsRNA, such as trehalose, TE buffer, and mannitol.
[0015] The concentration of dsRNA prepared in this application in the above-mentioned biological reagents is 2000 ng / µL.
[0016] Fourthly, a method for controlling brown planthopper pests is provided, which involves injecting the brown planthoppers with the aforementioned biological reagent.
[0017] Furthermore, the aforementioned brown planthoppers are third-instar nymphs of the brown planthopper; based on the mass of dsRNA in the biological reagent, the injection dose per brown planthopper is 40 ng.
[0018] The present invention has the following beneficial effects: This invention provides NlVHA-A The application of genes, through silencing brown planthoppers NlVHA-A Genes can reduce the survival rate of brown planthoppers, the honeydew production and weight gain of emerging females, thereby reducing the direct impact of brown planthoppers on rice and achieving the goal of prevention and control.
[0019] This invention clones the V-ATPase gene of the brown planthopper. NlVHA-A The encoded protein sequence was obtained through in vitro synthesis. NlVHA-A The dsRNA of the gene was injected into the brown planthopper. Detection NlVHA-A Gene expression levels and survival rate of brown planthoppers on rice. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 The image shows the results of agarose gel electrophoresis detection of the NlVHA-A gene.
[0022] Figure 2 This is a diagram showing the sequence alignment results of the NlVHA-A gene.
[0023] Figure 3 This diagram illustrates the expression pattern of the NlVHA-A gene in the brown planthopper, where A represents the expression level of the NlVHA-A gene at different instars of the brown planthopper, and B represents the expression level of the NlVHA-A gene in different tissues of the brown planthopper. Different letters indicate significant differences.
[0024] Figure 4 The image shows the agarose gel electrophoresis results of the dsRNA corresponding to the NlVHA-A gene.
[0025] Figure 5 Figure 1 shows the silencing effect of the NlVHA-A gene in brown planthopper after microinjection of dsRNA and the results of related phenotypic assays. In the figure, A represents the silencing effect of the NlVHA-A gene in brown planthopper after microinjection of dsRNA; B represents the survival rate of brown planthoppers feeding on rice after NlVHA-A gene silencing; C represents the honeydew secretion of newly emerged females 48 hours after feeding on rice after NlVHA-A gene silencing; and D represents the percentage weight gain of newly emerged females 48 hours after feeding on rice after NlVHA-A gene silencing. Asterisks indicate statistical significance: * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.
[0026] Figure 6 Phenotypic diagram of death in brown planthopper after NlVHA-A gene silencing. Detailed Implementation
[0027] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0028] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0029] Table 1. Reagents used in this invention
[0030]
[0031] Table 2. Primers used in this invention
[0032]
[0033] In this application, the brown planthoppers were reared at a temperature of 28 °C, a humidity of 75%, and a photoperiod of 16 L:8 D.
[0034] Example 1
[0035] I. Gene Cloning
[0036] 1. Extraction of total RNA
[0037] Four brown planthoppers were collected using a homemade trematode and placed in a 1.5 mL centrifuge tube. Total RNA was extracted from the brown planthoppers using the TRIzol method, as follows:
[0038] ① Add one grinding bead and 500 µL of RNAiso Plus reagent to an RNasefree centrifuge tube containing brown planthoppers, tighten the cap, grind thoroughly in a grinder, and let stand on ice for 5 min.
[0039] ② Add 100 µL of chloroform to a centrifuge tube, invert to mix thoroughly, and let stand on ice to separate the layers. Centrifuge at 4 ℃, 12000 rpm for 15 min;
[0040] ③ Transfer the supernatant to a brand new 1.5 mL RNase-free centrifuge tube, add 200 µL of isopropanol, invert the tube, and let it stand on ice for 1 h to precipitate. Centrifuge at 4 ℃, 12000 rpm for 10 min;
[0041] ④ Discard the supernatant, add 500 µL of 75% anhydrous ethanol (prepared fresh before use), gently invert, and wash the precipitate. Centrifuge at 7500 rpm for 5 min at 4 ℃;
[0042] ⑤ Repeat step ④;
[0043] ⑥ Drying;
[0044] ⑦ Add 10 µL of RNase-free H2O to dissolve the RNA;
[0045] ⑧ RNA quality was detected by agarose gel electrophoresis, and 1 µL of RNA purity and concentration were detected by micro-spectrophotometer.
[0046] ⑨ Brown planthopper cDNA synthesis was performed according to the HiScript Ⅳ All-in-One Ultra RT Super Mix for qPCR instructions, and it was used as a PCR amplification template.
[0047] 2. Cloning of the NlVHA-A gene
[0048] The nucleotide sequence of the NlVHA-A gene was obtained from the NCBI database, and PCR primers were designed using Primer 5. PCR amplification was performed using these primers in the following system: 25 µL Phanta Flash Master Mix, 1 µL each of the PCR primers, 1 µL cDNA, and double-distilled water to a final volume of 50 µL. The PCR reaction steps were: 98 °C pre-denaturation for 30 s; 98 °C denaturation for 10 s; 60 °C annealing for 5 s; 72 °C extension for 2 s, repeated 35 times, followed by a final extension at 72 °C for 1 min.
[0049] After electrophoresis of the PCR products using 1% agarose gel, the PCR products were ligated into pCE3 Blunt Vector (Novizan) using the Ultra-Universal TOPOCloning Kit and transformed into E. coli DH5α competent cells. The cells were then plated on ampicillin-containing plates and cultured overnight. Single colonies were picked for PCR verification. Correct colonies were sent to the company for sequencing (Qingke Biotechnology Co., Ltd.). Results are as follows... Figure 1 As shown. Sequencing results were compared and analyzed with sequences in the NCBI database using Bioedit software, as shown below. Figure 2 As shown in the figure. The CDS sequence of the NlVHA-A gene was successfully obtained as shown in SEQ ID No. 1, and the amino acid sequence it encodes is shown in SEQ ID No. 2.
[0050] NlVHA-A gene CDS sequence:
[0051]
[0052] The amino acid sequence encoded by the NlVHA-A gene is as follows:
[0053] MTLPKVKDVEKEGQYGYVFAVSGPVVTAEKMSGSAMYELVRVGHYELVGEIIRLEGDMATIQVYEETSGVTVGDPVLRTGKPLSVELGPGIMGSIFDGIQRPLKDINELSNSIYIPKGVNVPALSRTTAWEFHPLNIKVGSHITGGDEYAIVHENTLVKHKLILPPRSKGTVKYLAPPGNYTVDDIVLETEFDGERSKFTMLQVWPVRQPRPVTEKLPANYPLLTGQRVLDSLFPCVQGGTTAIPGAFGCGKTVISQALSKYSNSDVIVYVGCGERGNEMSEVLRDFPELTVEIDGVTESIMKRTALVANTSNMPVAAREASIYTGITLSEYFRDMGYNVSMMADSTSRWAEALREISGRLAEMPADSGYPAYLGARLASFYERAGRVKCLGNPDREGSVSIVGAVSPPGGDFSDPVTSATLGIVQVFWGLDKKLAQRKHFPSINWLISYSKYMRALDDFYDKNYAEFVPLRTKVKEILQEEEDLSEIVQLVGKASLAESDKITLEVAKVLKDDFLQQNSYSAYDRFCPFYKTVGMLKNMIAFYDMARHAVESTAQSENKITWSVIKDSMGNILYQLSSMKFKDPQKEGETKLKADFEQLHEDIQQAFRNLED (SEQ ID No.2).
[0054] 3. Spatiotemporal expression pattern of the NlVHA-A gene in the brown planthopper
[0055] Brown planthoppers were dissected under a stereomicroscope in 1% PBS buffer. Samples were taken from the intestines, fat body, salivary glands, testes, and ovaries, and then rapidly frozen in liquid nitrogen. Simultaneously, samples from different instars of brown planthoppers (nymphal instars and males / females) were collected using homemade trematode tubes, rapidly frozen in liquid nitrogen, and then stored in an ultra-low temperature freezer. The expression of the NlVHA-A gene in different tissues and in different instars was detected using quantitative real-time PCR. Quantitative primers were designed using Primer Primer 5. Following the instructions for the SupReal QPurple Universal SYBR qPCR MasterMix(U+) (Novizan), a 10 µL PCR reaction system was selected, including 5 µL of SYBR, 2 µL of cDNA template, 0.4 µL of primers (mixed), and 2.6 µL of ddH2O. The amplification program was: 95 ℃ for 10 min; 95 ℃ for 10 s, 60 ℃ for 1 min, for 40 cycles. Using the NlRPS gene as an internal reference, the relative expression level of the target gene was determined by 2... –∆∆Ct The method is used for calculation.
[0056] The results showed that the NlVHA-A gene was expressed in all instars and tissues, with the highest expression in first-instar nymphs and male adults. Figure 3 A), the NlVHA-A gene is most highly expressed in the midgut tissue. Figure 3 B).
[0057] Example 2: dsRNA Synthesis
[0058] Following Example 1, the target fragments of the NlVHA-A gene and the enhanced green fluorescent protein (EGFP) gene were amplified, ligated, and transformed, and then identified by PCR, followed by sequencing. 100 µL of the correctly sequenced bacterial culture was added to 5 mL of liquid LB medium containing ampicillin and incubated overnight in a shaker.
[0059] Plasmids were extracted from the overnight culture using the M5 Plasmid Miniprep plus kit. dsRNA primers were designed using Primer primier5 (see Table 2), and the T7 promoter sequence was added to the front end of the primers.
[0060] PCR amplification of the NlVHA-A and EGFP gene plasmids was performed using dsRNA primers, followed by purification of the amplified products using the Fast Pure GelDNA Extraction Mini Kit. The purified DNA template, once its concentration and quality were deemed acceptable, became the template for dsRNA synthesis, and its nucleotide sequences are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively. dsRNA synthesis was performed according to the instructions of the MEGA script™ T7 Transcription Kit. The electrophoresis diagram of NlVHA-A gene dsRNA synthesis is shown below. Figure 4 As shown.
[0061] The sequence of the dsRNA of the NlVHA-A gene:
[0062] CTGTGGTTACGGCAGAAAAGATGTCAGGATCGGCTATGTACGAGCTGGTGAGAGTCGGCCATTATGAACTGGTCGGAGAAATCATTCGTCTTGAAGGCGACATGGCTACCATCCAGGTATACGAAGAAACATCAGGTGTGACAGTGGGTGATCCAGTGCTGAGAACTGGCAAGCCGTTGTCCGTGGAACTTGGACCTGGTATCATGGGCAGCATTTTTGACGGTATCCAGAGACCTC TGAAGGACATCAATGAGCTGTCAAACAGCATCTACATCCCCAAGGGAGTCAACGTGCCTGCTCTAAGCAGAACCACTGCCTGGGAATTCCATCCATTGAACATCAAAGTCGGCAGCCATATTACCGGAGGAGACGAATATGCCATTGTACACGAGAACACCCTTGTCAAACACAAACTCATTCTGCCACCACGATCCAAGGGAACCGTCAAATATCTTGCCCCTCCTGGCAACTACAC (SEQ ID No. 3).
[0063] The sequence of the dsRNA of the EGFP gene:
[0064] ACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGA CGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACA (SEQ ID No.4).
[0065] Example 3: Application of dsRNA
[0066] Third-instar nymphs of the brown planthopper were selected, and 40 ng of dsEGFP or dsNlVHA-A was injected into the middle portion of the midcoxel and hind coxel of their thorax using a microinjection apparatus. The specific method is as follows:
[0067] ① Collect a number of third-instar brown planthopper nymphs and anesthetize them with CO2 for 10 seconds;
[0068] ②Inject the dsRNA of the NlVHA-A gene into the glass capillary using a micro-pipette;
[0069] ③ After adding the sample, install the glass capillary tube into the microinjector and inject the dsRNA into the brown planthopper under a stereomicroscope.
[0070] ④ Using the same method, the dsRNA of the EGFP gene was injected into the brown planthopper as a negative control.
[0071] ⑤ After the brown planthopper nymphs recover from the injection, transfer them to rice plants.
[0072] Samples were taken at 24 h, 48 h, and 72 h post-injection to verify the silencing effect, with four biological replicates per replicate (four worms per replicate). Quantitative real-time PCR was used to detect whether the expression level of the target gene was inhibited. The specific method is as follows:
[0073] ① Collect brown planthopper nymphs after injection of dsRNA, and extract total RNA using the method described in Experiment 1 to obtain injected brown planthopper RNA and cDNA;
[0074] ② Using brown planthopper cDNA as a template, following the instructions of the SupReal QPurple Universal SYBR qPCR MasterMix(U+) (Novizan), a 10 µL PCR reaction system was selected, including 5 µL of SYBR, 2 µL of cDNA template, 0.4 µL of primers (mixed), and 2.6 µL of ddH2O. The amplification program was: 95 ℃ for 10 min; 95 ℃ for 10 s, 60 ℃ for 1 min, for 40 cycles;
[0075] ③ Use 2 -△△Ct The expression level of the NlVHA-A gene in brown planthopper was calculated, and the difference between different treatment groups was determined by independent samples t-test.
[0076] ④ After confirming silencing, transfer the brown planthoppers injected with dsNlVHA-A and dsEGFP to rice paddies and record the number of survivors daily until all emerge.
[0077] Brown planthoppers were microinjected with dsNlVHA-A and the control group dsEGFP, respectively. Gene silencing efficiency was assessed at 24 h, 48 h, and 72 h. Compared with the dsEGFP treatment group, the expression level of the NlVHA-A gene was significantly reduced at 24 h, 48 h, and 72 h after dsNlVHA-A injection, with a decrease of 96.55% at 24 h, 92.80% at 48 h, and 96.84% at 72 h. This indicates that dsNlVHA-A can effectively inhibit the expression of NlVHA-A. Figure 5 A, Table 3).
[0078] Table 3. Detection of NlVHA-A gene silencing effect in brown planthopper
[0079]
[0080] To investigate the role of the NlVHA-A gene in brown planthoppers, RNAi technology was used to reduce the expression of this gene, and the planthoppers were placed on rice plants for observation of their growth and development. Approximately 30 brown planthoppers were placed on each rice plant, with three replicates. Daily observations and mortality rates were recorded. After the brown planthopper nymphs emerged, newly emerged females were transferred to rice plants. The honeydew secretion and percentage weight gain within 48 hours of feeding were measured using the wax bag method, and statistical differences between different treatments were analyzed.
[0081] The experimental results showed that, compared with the dsEGFP control group, the survival rate of brown planthoppers injected with dsNlVHA-A generally decreased at each observation time point, and the difference between groups gradually increased with the extension of treatment time. Specifically, the survival rates of the dsEGFP group from day 1 to day 9 were 97.98%, 91.52%, 90.19%, 87.84%, 87.84%, 86.73%, 82.73%, 82.27%, and 78.27%, respectively; while those of the dsNlVHA-A group were 97.80%, 90.78%, 80.15%, 55.52%, 34.92%, 22.32%, 17.03%, and 15.66%, respectively. Compared with the dsEGFP group, the survival rates of the dsNlVHA-A group were 0, 0.74, 10.04, 32.32, 52.92, 64.41, 65.24, and 62.61 percentage points lower on days 1-8, respectively. These results indicate that dsNlVHA-A treatment significantly reduces the survival rate of brown planthoppers, and the inhibitory effect gradually increases with prolonged treatment time. Figure 5 B, Table 4).
[0082] Table 4. Survival rate of third instar nymphs of the brown planthopper on rice after injection with dsNlVHA-A and dsEGFP.
[0083]
[0084] Phenotypic observation of brown planthopper mortality after RNAi: After injection of dsRNA into the NlVHA-A gene, brown planthopper nymph mortality mainly manifested in two ways, primarily incomplete molting and shriveling of the skin. Figure 6 ).
[0085] The amount of honeydew secreted and the weight gain of emerging female brown planthoppers were further measured, as shown in Tables 7 and 8.
[0086] The results showed that, compared with the dsEGFP control group, the weight gain of brown planthoppers after NlVHA-A gene silencing was significantly reduced in rice, with a decrease of 72.83% (P < 0.001). Figure 5 C).
[0087] Similarly, compared with the dsEGFP control group, the honeydew secretion of brown planthoppers after NlVHA-A gene silencing was also significantly reduced on rice, with a decrease of 48.47% (P = 0.026). Figure 5 D).
[0088] This invention, based on targeting the NlVHA-A gene of the brown planthopper, constructs and applies dsRNA to achieve silencing of the NlVHA-A gene using RNA interference technology. The dsRNA can be injected into brown planthoppers to control them. It can also be applied to the development of transgenic insect-resistant crops expressing the dsRNA, for example, using modern biotechnology to create transgenic rice that overexpresses the NlVHA-A gene dsRNA, thus breeding new brown planthopper-resistant rice varieties. Adding a dsRNA stabilizer allows the NlVHA-A gene dsRNA to be applied in the field. The protein encoded by the brown planthopper NlVHA-A gene can be used as a target for drug development to control brown planthoppers. In summary, the brown planthopper NlVHA-A gene, its encoded protein, and dsRNA have promising applications and are of great significance for the control of brown planthoppers.
[0089] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. NlVHA-A Application of dsRNA in the control of brown planthopper.
2. As described in claim 1 NlVHA-A The application of dsRNA of the gene in the control of brown planthopper is characterized by: The NlVHA-A The gene is the brown planthopper V-ATPase gene.
3. As described in claim 2 NlVHA-A The application of dsRNA of the gene in the control of brown planthopper is characterized by: The NlVHA-A The CDS sequence of the gene is shown in SEQ ID No.
1. Its encoded amino acid sequence is shown in SEQ ID No.
2.
4. As described in claim 1 NlVHA-A The application of dsRNA of the gene in the control of brown planthopper is characterized by: The dsRNA includes the sense strand nucleotide sequence as shown in SEQ ID No. 3 and the antisense strand nucleotide sequence that is its reverse complement.
5. NlVHA-A The dsRNA of a gene is characterized by: The dsRNA includes the sense strand nucleotide sequence as shown in SEQ ID No. 3 and the antisense strand nucleotide sequence that is its reverse complement.
6. A biological reagent for controlling brown planthoppers, characterized in that: It contains the dsRNA as described in claim 5.
7. The biological reagent for controlling brown planthoppers according to claim 6, characterized in that: The reagent also contains a solvent or a stabilizer; the stabilizer is a reagent used to stabilize dsRNA.
8. The biological reagent for controlling brown planthoppers according to claim 7, characterized in that: The concentration of the dsRNA in the biological reagent according to claim 5 is 2000 ng / µL.
9. A method for controlling brown planthopper pests, characterized in that: The brown planthopper is injected with the biological reagent according to any one of claims 6-8.
10. The method for controlling brown planthopper pests according to claim 9, characterized in that: The brown planthoppers were third-instar nymphs of the brown planthopper; the injection dose per brown planthopper was 40 ng, based on the mass of dsRNA in the biological reagent.
Citation Information
Patent Citations
Locusta migratoria V-ATPase-V0 structural domain genes and application of dsRNA of locusta migratoria V-ATPase-V0 structural domain genes in pest control
CN111440810A