Mutated gene of cs gai gene for regulating seed germination of cucumber at low temperature and application thereof

By using CRISPR/Cas9 gene editing technology to perform site-directed mutations on the cucumber CsGAI gene, the problem of low germination rate of cucumber seeds at low temperatures was solved, the germination rate and low-temperature tolerance of cucumber seeds were improved, and genetic resources were provided to support the breeding of new varieties.

CN122256367APending Publication Date: 2026-06-23INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-02-12
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Cucumber seeds have a low germination rate and delayed germination time under low temperature conditions, which affects planting and production, and there is a lack of effective gene regulation methods.

Method used

The CRISPR/Cas9 gene editing technology was used to perform site-directed mutations on the cucumber CsGAI gene, and a gene editing vector pCas9CsGAI targeting the CsGAI gene was constructed. This vector was then transformed into cucumber plants to inhibit the expression and activity of the CsGAI gene and improve the germination rate of seeds at low temperatures.

Benefits of technology

It significantly improved the germination rate, germination potential, and germination index of cucumber seeds at low temperatures, enhanced the low-temperature resistance of cucumber seeds, and provided genetic resources for the breeding of new low-temperature resistant cucumber varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256367A_ABST
    Figure CN122256367A_ABST
Patent Text Reader

Abstract

This invention discloses a method for regulating cucumber seed germination at low temperatures. CsGAI Mutated genes and their applications. This invention constructs a targeted gene... CsGAI The gene editing vector pCas9CsGAI was used to transform cucumbers, and the resulting plasmid was then transformed into cucumbers. CsGAI Genetically modified plants were used for field hybridization and pollination, molecular identification, and phenotypic identification to prove that when CsGAI CsGAI CsGAI CsGAI CsGAI CsG When gene function is lost or weakened, the relative germination rate, relative germination potential, and relative germination index of cucumbers increase, and their cold tolerance improves. This invention lays the foundation for revealing the genetic and biological mechanisms of cold tolerance during cucumber germination, provides new gene resources for the cultivation of cold-tolerant cucumbers, and is of great significance for cucumber cold research and the breeding of new cold-tolerant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and molecular breeding technology, specifically to a method for regulating cucumber seed germination at low temperatures. CsGAI Mutated genes and their applications. Background Technology

[0002] cucumber( Cucumis sativus Cucumber (L.) is one of the world's most important economic vegetable crops. Originating in tropical rainforests, cucumber is a typical cold-sensitive plant. The normal temperature for cucumber seed germination is 24-28℃. Previous studies have shown that the critical temperature for low-temperature germination in cucumber is 13-17℃. However, early spring direct seeding is an important planting method, and low temperatures delay seed germination and reduce seedling emergence rates. Therefore, low-temperature seed germination is crucial for the normal growth of cucumber. Low temperatures not only delay seed germination time and reduce germination rates but also lead to yield reduction, making it a significant limiting factor in cucumber production. Therefore, identifying the key genes regulating low-temperature germination in cucumber provides important theoretical guidance for creating new cucumber varieties tolerant to low temperatures during germination.

[0003] Plant hormones gibberellin (GA) and abscisic acid (ABA) play key regulatory roles in seed dormancy and germination. GA promotes seed germination, while ABA maintains seed dormancy. DELLA transcription factors, as core repressors of the GA signaling pathway, are negatively regulated by GA. Gibberellin-insensitive protein (GAI), belonging to the DELLA family, is a repressor of the GA signaling pathway. The Arabidopsis DELLA family contains five members: GAI, RGA, RGL1, RGL2, and RGL3. Among them, GAI, RGA, and RGL2 are the main inhibitors of Arabidopsis seed germination.

[0004] Currently, regarding cucumbers CsGAI There are relatively few reports on gene-related research. Low temperatures reduce seed germination rates and delay germination time, posing a threat to cucumber production. Research on cucumbers... CsGAI Genes that promote cucumber seed germination under low temperatures are of great significance for cucumber production. Summary of the Invention

[0005] The purpose of this invention is to address the above-mentioned problems by providing a method for regulating cucumber seed germination at low temperatures. CsGAI Mutated genes and their applications.

[0006] To achieve its objective, the present invention employs the following technical solution: The first aspect of the present invention provides a mutated CsGAI The mutation refers to the gene shown in SEQ ID NO.2. CsGAIThe gene's CDS sequence has a frameshift mutation involving a deletion of base G at position 181 from the 5' end, or as shown in SEQ ID NO.2. CsGAI The gene's CDS sequence undergoes a frameshift mutation by deleting the CG base at position 180-181 from the 5' end.

[0007] A second aspect of the invention provides a carrier comprising the above-described mutant. CsGAI Gene.

[0008] The third aspect of the present invention provides the above-described mutation. CsGAI The application of genes or vectors in any of the following: (1) Application in regulating cucumber seed germination at low temperatures; (2) Application in improving the germination rate of cucumber seeds at low temperatures; (3) Application in the preparation of cucumber varieties with high seed germination rate at low temperatures; (4) Application in the preparation of cucumber mutants with high seed germination rate at low temperature.

[0009] The above-mentioned applications inhibited [the growth of cucumbers]. CsGAI Gene expression and / or activity can lead to increased low-temperature tolerance during cucumber seed germination, resulting in higher germination rates of cucumber seeds at low temperatures; the inhibition... CsGAI Gene-related methods include gene editing and RNA interference.

[0010] Preferably, in the above application, CRISPR / Cas9 gene editing technology is used to edit the target cucumber genome. CsGAI Genes were modified to obtain genes containing the aforementioned mutations. CsGAI Gene-edited plants of the gene, wherein the target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.4.

[0011] A fourth aspect of the present invention provides a method for creating cucumber mutants with high seed germination rates under low temperatures, wherein the method is a gene editing method, employing CRISPR / Cas9 gene editing technology on cucumbers. CsGAI Genes undergo site-directed mutations to obtain CsGAI Gene mutants; CsGAI The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the mutant... CsGAI The CDS sequence of the gene undergoes the following mutation: as shown in SEQ ID NO.2. CsGAI The gene's CDS sequence undergoes a frameshift mutation with a deletion of base G at position 181 from the 5' end, or, as shown in SEQ ID NO.2. CsGAI The gene's CDS sequence undergoes a frameshift mutation by deleting the CG base at position 180-181 from the 5' end.

[0012] A fifth aspect of the present invention provides a method for improving the germination rate of cucumber seeds at low temperatures, comprising: [the method described above] mutated [a specific type of seed]. CsGAI Genes or vectors are transferred into the cucumber varieties that need to be improved.

[0013] The above-mentioned method for improving the germination rate of cucumber seeds at low temperatures targets the region located on chromosome 1 of cucumber. CsGAI CRISPR / Cas9 gene editing was performed, and the gene encoding the Cas9 protein and an expression vector carrying sgRNA were transferred into the cucumber plants to be improved. After screening and culture, the mutants were obtained. CsGAI The germination rate of seeds from the transgenic cucumber plants obtained by the gene was significantly improved at low temperatures.

[0014] Preferably, the expression vector is pCas9. CsGAI, pCas9 The backbone of CsGAI is pKSE402 Carrier.

[0015] Preferably, the target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.4.

[0016] The beneficial effects of this invention are: This invention constructs a targeted CsGAI pCas9, a gene editing vector CsGAI was then used to transform cucumbers to obtain... CsGAI Genetically modified plants were used for field hybridization and pollination, molecular identification, and phenotypic identification to prove that when CsGAI When gene function is lost or weakened, the relative germination rate, relative germination potential, and relative germination index of cucumbers increase, and their cold tolerance improves. This invention not only lays an important foundation for revealing the genetic and biological mechanisms of cold tolerance in cucumbers during germination, but also provides new gene resources for the cultivation of cucumbers tolerant to cold during germination, which is of great significance for research on cucumber cold tolerance and the breeding of new cold-tolerant varieties. Attached Figure Description

[0017] Picture 1 The structural map of the pKSE402 vector.

[0018] Picture 2 For cucumber CsGAI Comparison of sequencing results of mutant plants.

[0019] Picture 3 for CsGAI Comparison of low-temperature tolerance during germination period between mutant and wild type: (A) CsGAI Mutants and wild types CsGAIGene expression levels; (B) CsGAI Germination statistics of one experimental group after low-temperature treatment of mutant and wild-type seeds; (C) CsGAI The relative germination rate, relative germination potential, and relative germination index of mutant and wild-type seeds after low-temperature treatment. Detailed Implementation

[0020] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0021] Unless otherwise specified, the reagents and methods used in the following examples are conventional methods; the reagents used are commercially available unless otherwise specified.

[0022] The primer sequences used in the examples were all synthesized by Shanghai Bioengineering Technology Co., Ltd.

[0023] Source of experimental materials: Cucumber material CU2: The plant exhibits vigorous growth and strong branching. The fruit is elongated, with both the peel and flesh of mature fruits being white. It is used as a material for cucumber transformation and is sensitive to low temperatures during the germination period. It is a known variety, described in the 2022 research paper "Targeted creation of new mutants with compact plant architecture using CRISPR / Cas9genome editing by an optimized genetic transformation procedure in cucurbitplants" published by Tongxu Xin in Volume 9, uhab086 of *Horticulture Research*.

[0024] This laboratory has a record of the application and guarantees to release it to the public for verification experiments within twenty years from the date of application.

[0025] Example 1: Cucumber CsGAI Gene identification Gibberellin-insensitive protein (GAI) belongs to the DELLA family and is a repressor of the GA signaling pathway. Our research team previously used near-isogenic lines to target the major locus of the low-temperature tolerance gene during cucumber germination. qLTG1.1 The genome was precisely located to a physical region of 46.3 kb, containing three genes; this was determined through sequence alignment and expression analysis. Csa1G408720 (Right now CsaV3_1G031060 The candidate gene is GAI, a DELLA transcription factor from the GRAS gene family, named... CsGAI Subcellular localization results indicate that the gene is located in the cell nucleus; analysis of the levels of endogenous and exogenous hormones GA and ABA, as well as gene expression in biosynthetic metabolic pathways, indicate that... CsGAI Regulating seed germination at low temperatures through GA and ABA signaling pathways (see reference The...) qLTG1.1 candidate gene CsGAI regulates low temperature seed germination incucumber, Li et al., 2022, DOI: 10.1007 / s00122-022-04097-w).

[0026] CsGAI The gene is located on cucumber chromosome 1, and its DNA sequence is shown in SEQ ID NO.1. It is 2622 bp in length and contains one exon. CsGAI The CDS sequence of the gene is shown in SEQ ID NO.2, which is 1608 bp in length. The gene encodes a protein containing 535 amino acids (the sequence of which is shown in SEQ ID NO.3).

[0027] Example 2, Cucumber CsGAI Construction of gene editing vectors right CsGAI Genetic targeting was performed using CRISPR / Cas9 technology via an online website (http: / / skl.scau.edu.cn / ). CsGAI sgRNA was designed by selecting a specific site (SEQ ID NO.4, GAGCGTCTCGAATCCGCTA) at the N-terminus. Oligo dimer gRNA was prepared using the forward primer CsGAI-sgRNA-F (SEQ ID No.5) and the reverse primer CsGAI-sgRNA-R (SEQ ID No.6), and then processed using an endonuclease. Bsa I and T4 ligases were used to construct the Oligo dimer to... pKSE402 The carrier skeleton is thus obtained as pCas9 CsGAI vector. A vector used for gene editing. pKSE402 From Huang Sanwen's research group at the Chinese Academy of Agricultural Sciences, its structural diagram is as follows: Picture 1 As shown, the expression cassette containing Cas9 protein and sgRNA is in pKSE401Based on the existing technology, eGFP is inserted. When the vector is successfully transformed into plant cells, the eGFP sequence will be expressed and translated to produce green fluorescent protein. The fluorescence emitted by eGFP can be seen under a fluorescence microscope. Thus, the luminescence of eGFP can be observed in vivo and without harming the plant, and successfully transformed cell lines or plants can be screened.

[0028] The nucleotide sequence of the sgRNA-specific primer is as follows: CsGAI-sgRNA-F (SEQ ID NO.5): 5'-ATTGGAGCGTCTCGAATCCGCTA-3'; CsGAI-sgRNA-R (SEQ ID NO. 6): 5'-AAACTAGCGGATTCGAGACGCTC-3'.

[0029] The specific operating steps are as follows: (1) Annealing The PCR reaction system (50 μL reaction volume, reagents placed on ice) is as follows:

[0030] In the reaction system, CsGAI-sgRNA-F is the Forward oligo, and CsGAI-sgRNA-R is the Reverse oligo.

[0031] PCR reaction procedure: React at 95°C for 4 minutes, then cool to 20°C at a rate of 0.1°C per second. Dilute 10-fold after the reaction. The PCR product is then used in the next ligation reaction.

[0032] (2) Ligation: The ligation system (15 μL reaction system, reagents placed on ice) is as follows:

[0033] The PCR reaction program is as follows:

[0034] Thus, the target sgRNA was ligated to the vector via PCR amplification, enzyme digestion, and ligation. The ligation product was transformed into competent E. coli cells, and positive clones were screened to construct the cucumber vector. CsGAI Editing carrier pCas9 CsGAI. The correctly identified recombinant plasmid was transformed into Agrobacterium strain EHA105 and genetically transformed using the low-temperature sensitive cucumber material 'CU2'.

[0035] Example 3: Obtaining transgenic cucumber plants The pCas9 vector constructed in Example 2 After CsGAI was transformed into Agrobacterium EHA105, cucumber was transformed.

[0036] 1. Preparation and transformation of Agrobacterium competent cells Take 100 μL of Agrobacterium competent cells, freeze and thaw them on ice, add 1 μg of plasmid DNA, mix gently, place on ice for 5 min, flash freeze in liquid nitrogen for 5 min, incubate at 37℃ for 5 min, add 700 μL of LB liquid medium, and thaw at 28℃ and 200 rpm for 2-3 h. Then, evenly spread the bacterial culture onto solid medium containing the appropriate antibiotic. Incubate upside down at 28℃ for 2-3 days, and select single colonies for PCR identification of positive clones.

[0037] 2. Cucumber genetic transformation (1) Seed disinfection: Take plump and uniform 'CU2' cucumber seeds, soak them in 55℃ warm water for 15 minutes, and remove the seed coat. In a clean bench, first wash with 75% anhydrous ethanol for 30 seconds, then soak in 6.5% NaClO solution for 15 minutes, gently shaking during the process, and finally rinse 5 times with sterile water.

[0038] (2) Seed germination: Transfer the sterilized seeds to the prepared seed germination medium and incubate them in the dark at 28°C for about 1 day.

[0039] (3) Preparation of Agrobacterium tumefaciens culture: Select a single positive Agrobacterium colony and place it in 1 mL of LB liquid medium containing kanamycin and rifampicin (50 mg / L). Incubate overnight at 28°C and 200 rpm. Add the cultured culture to 5 mL of LB liquid medium containing kanamycin and rifampicin (50 mg / L) at a ratio of 1:1000. Incubate at 28°C and 200 rpm. When the OD value of the culture is 0.6-0.8, centrifuge at 4000 rpm for 10 min, collect the Agrobacterium, resuspend the cells in IM liquid medium, and dilute the culture to an OD value of 0.2-0.3.

[0040] (3) Cucumber explant preparation: Take the germinated seeds, in a clean bench, cut off about 1 / 3 of the cotyledons at the far end, remove the hypocotyl, separate the two cotyledons, and each cotyledon will form a U-shaped wound at the near end, thus obtaining the explant.

[0041] (4) Agrobacterium bacterial solution infection: The cut cotyledon explants were placed in centrifuge tubes containing bacterial solution, ultrasonically cleaned, and then vacuumed for 30 min.

[0042] (5) Co-culture: After infection, spread the explants on filter paper and gently blot dry the attached bacterial solution. Place sterilized filter paper on IM solid medium, and then evenly place the bacterial solution-infected explants on the medium. Incubate at 25°C in the dark for 4 days.

[0043] (6) Differentiation culture: After 4 days of dark culture, the explants were inserted obliquely upwards into a differentiation medium containing 100 mg / L kanamycin and cultured and screened under light. After culturing at 25℃ for about 25 days, fluorescent buds were observed using a fluorescence microscope.

[0044] (7) Elongation culture: Cut off the cotyledons of the well-grown fluorescent buds and place them in an elongation culture medium for light culture.

[0045] (8) Rooting culture: Place the elongated fluorescent buds on the rooting medium to induce rooting.

[0046] (9) Transplanting: After the seedlings have grown strong roots, they are hardened off in a light-incubator and then transplanted to a greenhouse for growth.

[0047] Example 4: Identification of transgenic positive lines of cucumber When the transgenic cucumber in Example 3 had grown in a greenhouse for one week, fresh plant leaves were taken, and DNA was extracted using the CTAB method. The DNA was then analyzed using primer pairs SEQ ID NO. 7 and 8, and primer pairs SEQ ID NO. 9 and 10, respectively. CsGAI The Cas9 gene and sgRNA of the gene were amplified by PCR and then subjected to first-generation sequencing.

[0048] The Cas9 PCR primer sequences are as follows: Csa9 F (SEQ ID NO.7): 5' gacaagaagtactcgatcggc 3'; Csa9 R (SEQ ID NO.8): 5' gtcagatcctgatggtgctc 3'.

[0049] CsGAI The sgRNA PCR primer sequences for the gene are as follows: GAI-JC F (SEQ ID NO.9): 5' GGTGGTGGAAGTGATGGTA 3'; GAI-JC-R (SEQ ID NO.10): 5' CAGTAGCAGTAGCAGTGGCA 3'.

[0050] Sequencing identification revealed two T0 generation gene-edited plants. T1 generation gene-edited plants were obtained through self-pollination of the T0 generation plants. Fresh leaves from the T1 generation plants were then collected, and DNA was extracted using the CTAB method. PCR amplification was performed using primers SEQ ID NO. 9 and 10. The PCR products were sequenced, and homozygous T1 generation gene-edited plants were selected. Sequencing results for the T0 and T1 generation gene-edited plants are shown in Table 1 and [Table data missing]. Picture 2 .mutation gai-1 The CDS sequence shown in SEQ ID NO.2 is missing base 181, resulting in a mutation. gai-2 The CDS sequence shown in SEQ ID NO.2 is missing bases 180-181. gai-1 and gai-2 All of these resulted in premature termination of amino acid translation; specific sequencing results are shown in Table 2.

[0051] Table 1

[0052] Table 2

[0053] Example 5: Phenotypic Identification of Transgenic Cucumber The sequencing-identified samples from Example 4 were... gai-1 or gai-2 Homozygous mutant T1 generation plants were transplanted into multi-span greenhouses, and homozygous T2 generation seeds were obtained through single-plant self-pollination. Simultaneously, cucumber material 'CU2' (i.e., wild type) was planted. To avoid interference from seed dormancy on the experimental results, low-temperature tolerance phenotype assessment was conducted 5 months after seed harvest.

[0054] Combine cucumber material 'CU2' (i.e., wild type, WT) and gai-1 , gai-2 Homozygous mutant seeds were treated in a light incubator. The experiment consisted of four biological replicates, each with 15 seeds, arranged in a randomized block design. Each experimental group was treated as follows: first, at 13℃ in the dark for 14 days; after the 14-day low-temperature treatment, the seeds were transferred to 28℃ for 7 days. From the first day of the 13℃ treatment to the last day of the 28℃ treatment, the number of germinated seeds was recorded daily, and the relative germination rate, relative germination potential, and relative germination index were calculated. The experiment setup included placing the seeds after 14 days at 13℃ at 28℃ to observe whether ungerminated seeds would germinate at room temperature, eliminating the interference of seed non-germination on the experiment. The germination rate at room temperature served as a control to accurately examine the effect of low temperature on the number of germinating seeds.

[0055] Germination rate (GR) refers to the percentage of all seeds that germinate within a specified time period out of the total number of seeds tested. Germination potential (GE) refers to the percentage of seeds that germinate when the daily number of germinated seeds reaches its peak during the germination process. Germination index (GI) is an indicator for evaluating seed vigor. GI = ∑(Gt) / (Dt), where Gt is the number of germinations per day during the final period of the germination test, Dt is the number of germination days, and ∑ is the sum.

[0056] Relative germination rate (RGR) = Germination rate on day 14 at low temperature / Germination rate on day 7 at normal temperature Relative germination energy (RGE) = Germination rate on day 8 at low temperature / Germination rate on day 7 at normal temperature Relative Germination Index (RGI) = Germination Index at Low Temperature / Germination Rate at Room Temperature on Day 7 In the above formula, the germination rate is the cumulative germination rate. For example, the germination rate on the 7th day at room temperature refers to the total germination rate from the first day of treatment at 13℃ to the 7th day of treatment at 28℃.

[0057] After low temperature treatment, gai-1, gai-2 The relative germination rate, relative germination potential, and relative germination index for each experimental replicate compared to the wild type are shown in Table 3.

[0058] Table 3

[0059] In summary, as shown in Table 3, Picture 3 As shown, CsGAI After mutation, CsGAI The expression level of the gene was reduced, and the relative germination rate, relative germination potential and relative germination index of the transgenic plants were significantly increased, and the seed cold resistance was improved.

[0060] CsGAI

[0061] CsGAI The amino acid sequence of the protein encoded by the gene is as follows (SEQ ID NO.3): MGPFDSAASSGGSSSSSSGSSSSSTVTKPQDIDGLLAGAGYRVRSSDLHNVAQRLERLESAMVNSSSEISQLASDAVHYNPSDIGSWVDSILSELDQTATLPSDLPDFPDLFSVSNQTDGSVSWTDPCVAAQHQNLGQHQLTVVTAMEEDSGIKLVHMLVTCADSIHRGDFPLAGSLIVEMQSLLSGINTECGIGKVAGYFIDALTRRVFTPHDTITSTTGFEDVLLYHHYYEACPYLKFAHFTANQAILEAFDGHDCVHVIDFNLMHGLQWPALIQALALRPGGPPLLRLTGIGPPSPDGRDSLREIGLRLAELARSVNVRFAFRGVAAARLEDVKPWMLQVSPKETVAVNSVMQLHRLLGNNQSSSAMEMVLGWIRSLNPKIMTVVEQEADHNQTGFLERFTEALFYYSTMFDSLEACCMMPEKGLAEMYLQREICNVVSCEGSARVERHEPLVKWRSRLRQAGFRALHLGSNAFKQASMLLTLFSAEGFSIEENEGCLTLGWHSRPLIAASAWQAAPPPDSNANHHPFGVIV。

Claims

1. A mutated CsGAI Genes are characterized by: The mutation refers to the one shown in SEQ ID NO.

2. CsGAI The gene's CDS sequence has a frameshift mutation involving a deletion of base G at position 181 from the 5' end, or as shown in SEQ ID NO.

2. CsGAI The gene's CDS sequence undergoes a frameshift mutation by deleting the CG base at position 180-181 from the 5' end.

2. A vector comprising the mutant of claim 1 CsGAI Gene.

3. The mutation as described in claim 1 CsGAI The use of the gene or the vector of claim 2 in any of the following: (1) Application in regulating cucumber seed germination at low temperatures; (2) Application in improving the germination rate of cucumber seeds at low temperatures; (3) Application in the preparation of cucumber varieties with high seed germination rate at low temperatures; (4) Application in the preparation of cucumber mutants with high seed germination rate at low temperature.

4. The application according to claim 3, characterized in that: Inhibition in cucumber CsGAI Gene expression and / or activity can lead to increased low-temperature tolerance during cucumber seed germination, and increased germination rate of cucumber seeds at low temperatures. The inhibition CsGAI Gene-related methods include gene editing and RNA interference.

5. The application according to claim 4, characterized in that: CRISPR / Cas9 gene editing technology was used to edit the genome of the target cucumber. CsGAI Genes are modified to obtain genes containing the mutation described in claim 1. CsGAI Gene-edited plants of the gene, wherein the target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.

4.

6. A method for creating cucumber mutants with high seed germination rate under low temperature, characterized in that: The method described is a gene editing method, employing CRISPR / Cas9 gene editing technology on cucumbers. CsGAI Genes undergo site-directed mutations to obtain CsGAI Gene mutants; The CsGAI The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the mutant... CsGAI The CDS sequence of the gene undergoes the following mutation: as shown in SEQ ID NO.

2. CsGAI The gene's CDS sequence undergoes a frameshift mutation with a deletion of base G at position 181 from the 5' end, or, as shown in SEQ ID NO.

2. CsGAI The gene's CDS sequence undergoes a frameshift mutation by deleting the CG base at position 180-181 from the 5' end.

7. A method for improving the germination rate of cucumber seeds at low temperatures, characterized in that: Including the mutation described in claim 1 CsGAI The gene or the vector described in claim 2 is transferred into the cucumber variety to be improved.

8. The method according to claim 7, characterized in that: Located on chromosome 1 of cucumber CsGAI The gene was edited using CRISPR / Cas9. A gene encoding the Cas9 protein and an expression vector carrying sgRNA were transferred into the desired improved cucumber variety. After screening and cultivation, the mutant containing the mutation described in claim 1 was obtained. CsGAI The germination rate of seeds from the transgenic cucumber plants obtained by the gene was significantly improved at low temperatures.

9. The method according to claim 8, characterized in that: The expression vector is pCas9. CsGAI, pCas9 The backbone of CsGAI is pKSE402 Carrier.

10. The method according to claim 6 or 8, characterized in that: The target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.4.