Application of dsrna of cyp4c1 gene in preventing and treating sitobion avenae
By using dsRNA interference technology to silence the CYP4C1 gene of the wheat aphid, the problem of unstable control effect of imidacloprid seed treatment was solved, achieving efficient control and environmentally friendly control of the wheat aphid.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF PLANT PROTECTION HEBEI ACAD OF AGRI & FORESTRY SCI
- Filing Date
- 2026-03-26
- Publication Date
- 2026-06-23
AI Technical Summary
Existing imidacloprid seed treatment technology has problems with unstable efficacy and unclear adaptation mechanisms of wheat aphids when controlling wheat long-tubed aphids, resulting in unsatisfactory control effects.
Using dsRNA of the CYP4C1 gene of the wheat aphid, RNA interference technology was used to interfere with the expression of the CYP4C1 gene in the wheat aphid. The dsRNA was then used to silence the CYP4C1 gene to enhance its sensitivity to imidacloprid.
It significantly inhibits the survival rate and aphid production of wheat aphids, increases the sensitivity of wheat seeds treated with imidacloprid, solves the problem of unstable control effect, and leaves no chemical residues, meeting the requirements of green agriculture.
Smart Images

Figure CN122256380A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural pest control technology, specifically to the application of dsRNA of the CYP4C1 gene in the control of wheat aphid. Background Technology
[0002] The wheat aphid is one of the major pests affecting wheat production, and it is the dominant aphid species in most wheat-growing areas of my country. Statistics show that wheat aphid infestations affect an area of 17 million hectares annually in China, accounting for 62% of the total wheat planting area, leading to yield reductions of 15%–30%, and even up to 50% in severe years. Imidacloprid seed treatment, as a novel aphid control technology, can effectively control aphid damage throughout the entire wheat growth cycle and has been widely promoted and applied in major wheat-producing areas of my country. However, in recent years, the efficacy of imidacloprid seed treatment for wheat aphid control has been inconsistent, and as imidacloprid degrades, its concentration within wheat plants gradually decreases, potentially producing a sublethal effect on aphids. Therefore, elucidating the adaptation mechanism of wheat aphids to imidacloprid seed treatment can provide a theoretical basis for promoting imidacloprid seed treatment technology for wheat aphid control.
[0003] The mechanism of RNA interference (RNAi) technology is as follows: exogenous double-stranded RNA (dsRNA) enters the organism and is cleaved by the Dicer enzyme into small interfering RNAs (siRNAs) of 21-23 nt. After binding to the RNA-induced silencing complex, the siRNA binds to target mRNAs with complementary sequences and is recognized by Dicer, thereby causing a decrease in the expression level of the target gene. In recent years, the method of screening RNA target genes by in vitro feeding or injection of dsRNA has been widely used for the identification and functional analysis of key genes in insect growth and development, thereby achieving the inhibition of target gene expression.
[0004] The detoxification metabolic system is a crucial component of insects' defense against harmful external substances (such as plant secondary metabolites and pesticides), with cytochrome P450 enzymes participating in the first stage of the detoxification process. Overexpression or mutation of P450 enzymes can lead to insecticide resistance in insects. Studies have shown that the CYP321A8 gene in the beet armyworm is associated with its resistance to chlorpyrifos, cypermethrin, and deltamethrin; knocking out the CYP9A186 gene in the beet armyworm significantly increases its sensitivity to abamectin. Therefore, interfering with the expression of key CYP genes to increase the sensitivity of the wheat aphid to insecticides holds promise for effective control of this pest. Summary of the Invention
[0005] The purpose of this invention is to provide a dsRNA of the CYP4C1 gene of the wheat aphid and its application, in order to solve the problems of unclear adaptation mechanism and unstable control effect of wheat aphid after imidacloprid seed treatment.
[0006] To achieve the above objectives, the present invention provides the following technical solution: a cDNA of the CYP4C1 gene of the wheat aphid, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0007] The present invention also discloses a dsRNA of the CYP4C1 gene of the wheat aphid, wherein the dsRNA is obtained by transcription of the cDNA and is used to specifically silence the expression of the CYP4C1 gene of the wheat aphid. The nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.
[0008] This invention also discloses a method for preparing dsRNA of the wheat aphid CYP4C1 gene, which is used to prepare the dsRNA of the wheat aphid CYP4C1 gene, specifically including the following steps:
[0009] S1. Total RNA was extracted from adult wheat aphids and used as a template for reverse transcription to obtain cDNA;
[0010] S2. Design specific primers for the CYP4C1 gene of the wheat aphid. Using the cDNA obtained in S1 as a template, amplify the target fragment of the CYP4C1 gene by PCR technology.
[0011] S3. After recovering and purifying the target fragment from S2, it was ligated into the pEASY-T3 cloning vector, transformed into E. coli Trans1-T1 competent cells, screened for positive clones containing the target fragment, and sequenced to verify them, and constructed a recombinant plasmid.
[0012] S4. Using the recombinant plasmid constructed in S3 as a template, PCR amplification was performed using specific primers containing the T7 promoter sequence to obtain a transcription template containing the T7 promoter.
[0013] S5. Using the transcription template obtained in S4, perform in vitro transcription and purification using an in vitro transcription kit to obtain dsRNA.
[0014] Furthermore, the nucleotide sequences of the specific primers in S2 are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0015] Furthermore, the nucleotide sequences of the specific primers containing the T7 promoter sequence in S4 are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0016] This invention also discloses the application of cDNA in the control of wheat aphid.
[0017] This invention also discloses the application of dsRNA in the control of wheat aphid.
[0018] Furthermore, the dsRNA was introduced into the nymphs of the wheat aphid via a feeding method to achieve control of the wheat aphid.
[0019] Furthermore, the specific operation of the feeding method is as follows: the dsRNA is added to 15% sucrose water to prepare artificial feed, and the third instar nymphs of the wheat aphid are fed with it. The total amount of dsRNA fed is 8µg.
[0020] Compared with existing technologies, the dsRNA of the CYP4C1 gene of the wheat aphid and its application provided by this invention have the following beneficial effects:
[0021] (1) This invention verifies that the CYP4C1 gene is a highly efficient candidate gene for RNAi control of wheat aphid. By interfering with the CYP4C1 gene of wheat aphid through RNAi, the survival rate and aphid production of wheat aphid on wheat seedlings treated with imidacloprid are significantly inhibited. This solves the problem of poor targeting of wheat aphid by traditional control technologies and provides a reliable genetic basis for the RNAi-mediated control strategy of wheat aphid.
[0022] (2) The dsRNA provided by the present invention can silence the CYP4C1 detoxification gene of wheat aphid. After feeding for 48 hours, the silencing efficiency reached 58%, which significantly improved the sensitivity of wheat aphid to imidacloprid seed treatment and overcame the problem of unstable control effect of imidacloprid seed treatment.
[0023] (3) The dsRNA provided by this invention is a biological preparation with no chemical pesticide residues. It will not pollute the agricultural ecological environment such as soil and water, and meets the development requirements of green agriculture and green prevention and control.
[0024] (4) The present invention introduces dsRNA by feeding, which does not require complicated equipment, and the artificial feed is easy to prepare. It can achieve large-scale control of wheat aphids in the field, and is not easy to induce wheat aphids to develop resistance. It can be used stably for a long time and is suitable for large-scale promotion. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this invention. For those skilled in the art, other drawings can be obtained based on these drawings.
[0026] Figure 1 This is an electrophoresis image of the full-length cds clone of the CYP4C1 gene of the wheat aphid provided in Embodiment 1 of the present invention;
[0027] Figure 2 This is an electrophoresis image of the dsRNA template clone of the wheat aphid CYP4C1 gene provided in Embodiment 2 of the present invention;
[0028] Figure 3 This is a diagram showing the interference efficiency of the dsRNA of the CYP4C1 gene of the wheat aphid provided in Embodiment 3 of the present invention.
[0029] Figure 4 This is a bioassay of wheat seed treated with imidacloprid after silencing the CYP4C1 gene with dsRNA, as provided in Example 3 of the present invention, against the wheat aphid. Detailed Implementation
[0030] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings.
[0031] Example 1:
[0032] Please see Figure 1 The cDNA cloning of the wheat aphid CYP4C1 gene was first performed by screening differentially expressed genes from the transcriptome of wheat aphids collected from wheat plants treated with imidacloprid seeds. Homologous sequence retrieval and functional annotation were then conducted using the NCBI Blast database to obtain the core sequence information of the wheat aphid CYP4C1 gene. Based on this, the full-length cDNA cloning of the gene was completed. The specific steps are as follows:
[0033] Rearing of test insects: A homozygous population of wheat aphids was selected as the experimental material and continuously bred and reared using fresh, sterile wheat seedlings as the sole food source. The rearing environment was set under controllable conditions in an artificial climate chamber: temperature 20±2℃, relative humidity 60%~80%, and photoperiod of 14h light: 10h darkness (L:D=14:10). Fresh wheat seedlings were regularly replaced during the rearing process to ensure that the aphids had sufficient food. The rearing was carried out for 3 generations or more. Healthy wheat aphids with consistent growth and no diseases were selected as the insects for subsequent experiments to avoid interference with the experimental results due to heterogeneity of insect sources.
[0034] Total RNA extraction: Healthy adult wheat aphids of consistent physiological condition were selected, with a sample size of no less than 20 individuals per batch. The TransZol UP (TransGen) total RNA extraction kit was used, and the procedure was strictly followed according to the kit instructions. The entire process was performed in a nuclease-free environment, using DEPC-treated centrifuge tubes and pipette tips to prevent RNA degradation. After extraction, the RNA precipitate was thoroughly dissolved in 50 μL of nuclease-free ddH2O. The concentration and purity of the RNA were then determined using a nucleic acid and protein analyzer. An A260 / A280 ratio between 1.8 and 2.1 and an A260 / A230 ratio greater than 2.0 were considered acceptable for RNA purity. The qualified total RNA solution was immediately stored at -80°C for later use, avoiding repeated freeze-thaw cycles.
[0035] cDNA synthesis: cDNA synthesis was performed using the EasyScript One-step gDNA Removal and cDNA Synthesis SuperMix (TransGen) reverse transcription kit. This kit can complete genomic DNA removal and first-strand cDNA synthesis in one step, effectively avoiding genomic DNA contamination. The reaction volume was 20 μL, with the following components precisely added: 1 µg of qualified total RNA, 4 μL of 5×TransScript All-in-one SuperMix for PCR, and 10 μL of RNase-free H2O. After thorough mixing, the components were briefly centrifuged to collect the liquid at the bottom of the centrifuge tube, which was then placed in a PCR instrument for reverse transcription. The reaction program was as follows: incubation at 42°C for 30 minutes to complete cDNA synthesis; followed by heating at 85°C for 5 seconds to rapidly inactivate the reverse transcriptase and terminate the reaction. The resulting cDNA solution was stored at -20°C for later use in subsequent PCR amplification experiments.
[0036] PCR amplification of the CYP4C1 gene: Based on the CYP4C1 gene sequence of the wheat aphid obtained from previous transcriptome screening and NCBI Blast annotation, specific amplification primers were designed using Primer Premier 5.0 software. The primer sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 4. The primers were synthesized by a professional biotechnology company and purified by PAGE to ensure amplification specificity.
[0037] SEQ ID NO.3:
[0038] CYP4C1-F:TGTGGTGTTGTGGTATTACTTCA;
[0039] SEQ ID NO.4:
[0040] CYP4C1-R:CCTTGCTGATTTTGATTCCGC;
[0041] PCR amplification was performed using 2×EasyTaq PCR SuperMix (+dye) (TransGen). This premixed solution contains dye and can be directly used for electrophoresis detection, simplifying the operation. The PCR reaction system consisted of 50 μL, with precise control of the following components: 2 μL cDNA template, 1 μL 10 μM forward primer, 1 μL 10 μM reverse primer, 25 μL 2×EasyTaq PCR SuperMix, and 21 μL nuclease-free water. After gently mixing all components, the mixture was briefly centrifuged and placed in a PCR instrument for amplification. The PCR reaction program was as follows: pre-denaturation at 94℃ for 3 min to ensure complete denaturation of the template DNA; followed by 35 cycles of amplification: denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, and extension at 72℃ for 45 s to ensure effective amplification of the target fragment; after the cycles, a final extension at 72℃ for 5 min was performed to ensure complete extension of the amplified fragment.
[0042] After amplification, 5 μL of PCR product was taken and electrophoresed on a 1% agarose gel (containing nucleic acid dye) at 120V for 25 min. The amplification results were observed under a gel imaging system. After confirming the appearance of the specific target band, the target gene fragment was extracted and recovered by cutting the gel using the pEASYPure-Quick Gel Extraction Kit (TransGen) strictly following the instructions. Impurities such as primer dimers and non-specific amplification fragments were removed to obtain the purified CYP4C1 gene PCR product.
[0043] Cloning and Sequencing: The target fragment purified by the gel was ligated into the pEASY-T3 cloning kit (TransGen) cloning vector. The ligation system consisted of 10 μL containing 5 μL of 2×pEASY-T3 Cloning Mix and 5 μL of purified target fragment. After gentle mixing, the mixture was incubated at 25°C for 10 min to complete the ligation reaction between the vector and the target fragment. All ligation products were transformed into E. coli Trans1-T1 Phage Resistant Chemically Competent Cells (TransGen). After incubation on ice for 30 min, the cells were heat-shocked at 42°C for 45 s, and then rapidly cooled on ice for 2 min. Subsequently, 800 μL of antibiotic-free LB liquid medium was added, and the cells were incubated at 37°C with shaking at 200 rpm for 1 h to allow the competent cells to recover growth.
[0044] Take 200 μL of the cultured bacterial solution and spread it evenly on LB agar containing ampicillin. Incubate overnight at 37°C. The next day, pick single colonies with regular morphology and uniform size from the LB agar and perform colony PCR identification. Using positive colonies as templates, perform PCR amplification and gel electrophoresis again to confirm the presence of the target gene fragment in the colonies. Send the colony PCR-positive cloned bacterial solutions to a professional biological sequencing company for Sanger sequencing. The sequencing results were assembled and analyzed using DNAMAN software, and the full-length cDNA sequence of the CYP4C1 gene of the wheat aphid was finally obtained. The full-length sequence is 1563 bp, and the nucleotide sequence is shown in SEQ ID NO.1.
[0045] Figure 1 The image shows the full-length clone of the CYP4C1 gene cds from the wheat aphid. M represents the DNA molecular weight standard, and the remaining bands are the full-length CYP4C1 gene cds fragments obtained by PCR amplification. The gel imaging results clearly show that the size of the fragment is consistent with the expected molecular weight of 1563 bp and completely matches the sequence length shown in SEQ ID NO.1, proving that the amplification of the target gene is highly specific and there are no non-specific bands.
[0046] SEQ ID NO.1:
[0047]
[0048] Plasmid extraction: Single colonies of positive clones with sequenced accuracy were inoculated into LB broth containing ampicillin and incubated at 37°C and 200 rpm for 12–16 h to allow for full cell proliferation. Plasmids were extracted using the FastPure EndoFree Plasmid Mini Kit (Vazyme) endotoxin removal plasmid mini-prep kit, strictly following the kit instructions. This kit effectively removes endotoxins from plasmids, yielding high-purity plasmid DNA. After extraction, plasmid concentration and purity were measured using a nucleic acid protein analyzer. Qualified plasmid solutions were stored at -20°C for later use as templates for dsRNA preparation.
[0049] Example 2:
[0050] Please see Figure 2 This embodiment provides a technical solution based on Embodiment 1: preparation of dsRNA of the CYP4C1 gene of the wheat aphid, including...
[0051] Primer design with T7 promoter:
[0052] Based on the full-length cDNA sequence of the CYP4C1 gene from *Aphidius oryzae* obtained in Example 1 (SEQ ID NO. 1), specific amplification primers containing the T7 RNA polymerase promoter sequence were designed using DNAMAN 8.0 software. Primer design followed the principles of high specificity of the amplified fragment, absence of hairpin structures, and moderate GC content, determining the amplified fragment size to be 434 bp. Simultaneously, primers for the green fluorescent protein (GFP) gene with the T7 promoter were designed as a control. The primer sequences for the CYP4C1 gene with the T7 promoter are shown in SEQ ID NO. 5 and SEQ ID NO. 6. All primers were synthesized by a professional biotechnology company and purified efficiently by PAGE to ensure the efficiency of subsequent PCR amplification and in vitro transcription.
[0053] SEQ ID NO.5:
[0054] dsCYP4C1-F:
[0055] TAATACGACTCACTATAGGGGGTTGTAACGATGATGGCTG;
[0056] SEQ ID NO.6:
[0057] dsCYP4C1-R:
[0058] TAATACGACTCACTATAGGGTTGGACCACCACTGAAAGC.
[0059] PCR amplification of the T7 promoter fragment: Using the plasmid of the positive clone of the wheat aphid CYP4C1 gene extracted and verified in Example 1 as a template, PCR amplification was performed using the synthesized T7 promoter-specific primers to obtain the target gene fragment with the T7 promoter sequence. The PCR reaction system was 50 μL, with each component precisely proportioned as follows: 2 μL plasmid template, 1 μL 10 μM forward primer, 1 μL 10 μM reverse primer, 25 μL 2×EasyTaq PCR SuperMix (+dye) (TransGen), and 21 μL nuclease-free water. The reaction program was set as follows: 94℃ pre-denaturation for 3 min; 35 cycles: 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s; 72℃ final extension for 5 min, adapted to the amplification efficiency of a 434 bp short fragment.
[0060] After amplification, 5 μL of PCR product was subjected to 1% agarose gel electrophoresis (120V, 20 min). The amplified bands were observed under a gel imaging system. After confirming the appearance of a single, bright, specific target band, the PCR product was purified using the WizardSV Gel and PCR Clean-Up System kit. The kit instructions were strictly followed to remove impurities such as primers, dNTPs, and enzyme fragments. After purification, the concentration and purity of the product were detected using a nucleic acid protein detector. The qualified target fragment with the T7 promoter was temporarily stored at -20℃ as a template for subsequent in vitro transcription.
[0061] In vitro transcription synthesis of dsRNA: The T7 RiboMAX Express RNAi System kit was used for in vitro transcription of dsRNA. This kit is specifically designed for transcription of the T7 promoter at both ends, enabling efficient synthesis of double-stranded RNA. The entire process was performed in a nuclease-free environment using DEPC-treated centrifuge tubes and consumables. The in vitro transcription reaction volume was 20 μL, with the following components added in the following proportions: 1 µg of purified target gene template with T7 promoter, 10 μL of RiboMAX∙Express T7 2×Buffer, 2 μL of L Enzyme Mix, and T7 Express. The volume was then brought to 20 μL with nuclease-free ddH2O. The components were gently pipetted to mix, and the mixture was briefly centrifuged to collect the liquid at the bottom of the centrifuge tube. The tube was then incubated at 37°C for 30 min to complete the in vitro transcription reaction.
[0062] After the transcription reaction was completed, in order to remove residual DNA template and single-stranded RNA (ssRNA) in the system, 2 µL of RNase A solution diluted 1:200 with RNase-free water and 2 µL of RQ1 RNase-free DNase were added to the reaction solution. After gently mixing, the solution was incubated again at 37°C for 30 min. RNase A was used to degrade the single-stranded RNA and RQ1 DNase was used to degrade the DNA template, ensuring that the final product was pure double-stranded RNA.
[0063] dsRNA purification: The reaction solution after in vitro transcription and enzyme digestion was purified for dsRNA purification. The specific procedure was as follows: 1 / 10 volume of 3M sodium acetate (pH=5.2, DEPC treated) and 2.5 volume of pre-chilled 95% anhydrous ethanol were added to the reaction solution. After gently inverting and mixing, the mixture was placed on ice for 5 min to allow the dsRNA to precipitate completely. Then, the centrifuge tube was placed in a high-speed refrigerated centrifuge and centrifuged at 12000 rpm and 4℃ for 10 min. The supernatant was discarded, and the dsRNA precipitate at the bottom of the tube was retained. 1 mL of pre-chilled 70% ethanol was added to the precipitate, and the precipitate was gently inverted and washed. The mixture was centrifuged again at 12000 rpm and 4℃ for 10 min. The ethanol supernatant was discarded to remove residual salt ions and impurities.
[0064] Centrifuge tubes were placed in a clean bench and air-dried at room temperature for 10 minutes to allow the precipitate to settle, avoiding excessive drying which would make the dsRNA difficult to dissolve. Then, an appropriate amount of RNase-free water (20–50 μL) was added to fully dissolve the precipitate, yielding a crude extract of dsRNA from the CYP4C1 gene of the wheat aphid. 5 μL of the crude extract was taken, and the concentration of dsRNA was determined using a spectrophotometer. An A260 / A280 ratio between 1.8 and 2.1 was considered acceptable. Simultaneously, 2 μL of dsRNA was subjected to 1% agarose gel electrophoresis at 100V for 30 minutes, and the bands were observed using a gel imaging system.
[0065] Figure 2 Electrophoresis image of the dsRNA template clone of the wheat aphid CYP4C1 gene; where M represents the DNA molecular weight standard, dsGFP is the dsRNA control band of the green fluorescent protein gene, and dsSaCYP4C1 is the dsRNA template band of the CYP4C1 gene. Gel imaging clearly shows that the dsSaCYP4C1 band is single and without tails, with a fragment size of 434 bp. The nucleotide sequence is shown in SEQ ID NO. 2, consistent with the expected amplification length, demonstrating high purity and specificity of the prepared dsRNA. The qualified dsRNA solution was aliquoted and stored at -80℃ to avoid repeated freeze-thaw cycles that could degrade the RNA, for later use.
[0066] SEQ ID NO.2:
[0067] GGTTGTAACGATGATGGCTGGGGGTTTTGAAACCAGCGCTATCACAGTATGTTTTTGTCTTTTGATGATAGCCATACATCAAGATATCCAAGATAAAGTATACAATGAAATTTACGAAATATTTGGCGAAAGTGACCAAACGATAACTATTGACGACACCTCTAGACTCGTGTACTTAGAACAAGTGATAAAAGAAACCCTTCGATTATACCCAATA GGACCAGTGCTACTTAGAGAAATTCAAGATGATATTAAAATAATTTCAAGTGATTACGTGCTGCCAAAAGGAACAATGTGTGCTATATTCCCAATGGCTACACACCATAGTCCTGATTTATACCCAAATCCTTGGTCTTTTAATCCTGAAAACTTCAGCCCTGAAAATAACGCTAAACGTCATAGATATAGCTTTGTTGCTTTCAGTGGTGGTCCAA.
[0068] Example 3:
[0069] Please see Figure 3 and Figure 4 Feeding and bioassay of dsRNA of the CYP4C1 gene in the wheat aphid: The prepared dsSaCYP4C1 was introduced into the third instar nymphs of the wheat aphid using an artificial feeding method. The interference efficiency of the target gene was detected by quantitative real-time PCR. Simultaneously, the fed wheat aphids were transferred to imidacloprid-treated wheat plants for bioassay, and the survival rate and aphid production of the aphids were statistically analyzed to verify the control effect of dsRNA on the wheat aphid in imidacloprid-treated wheat seedlings. Wheat aphids fed with dsGFP served as a blank control. The specific operation steps are as follows:
[0070] Artificial feeding with dsRNA: Third-instar nymphs of the wheat aphid with consistent growth, uniform size, and no disease were selected as experimental subjects. In vitro feeding was carried out using an artificial incubator, which was a sterile glass tube (5 cm long and 1.5 cm in diameter). The entire process was conducted in an artificial climate chamber, with environmental conditions consistent with the insect source rearing conditions: temperature 20±2℃, relative humidity 60%~80%, and photoperiod L:D=14:10.
[0071] Artificial feed preparation: A 15% sucrose aqueous solution was used as the base feed (sterilized at high temperature and cooled to room temperature). The prepared dsSaCYP4C1 was added to it, and the concentration was adjusted so that the total dsRNA content in the artificial feed was 8 μg. At the same time, a 15% sucrose aqueous solution containing an equal dose of dsGFP was prepared as a control feed. Both feeds were prepared and used immediately to avoid dsRNA degradation.
[0072] Feeding procedure: 100 test larvae were placed in each incubator. One end of the incubator was sealed with double-layered sterile gauze to ensure ventilation; the other end was sealed with a Parafilm membrane stretched to a thin, transparent state. 80 μL of prepared artificial feed was added between the Parafilm membrane and the glass tube, and then another layer of Parafilm membrane was used to cover it, sealing the feed between the two membranes to form a thin feed film, allowing the aphids to suck it in through their mouthparts. Each treatment was set up with 3 biological replicates. Fresh artificial feed was replaced every 48 hours during the feeding process, and the remains and feces in the incubator were cleaned up promptly to ensure a clean feeding environment for the test larvae.
[0073] Interference efficiency detection: At 24h, 48h, and 72h after feeding dsRNA, 10 surviving wheat aphids were randomly selected from the incubators of each treatment group and the control group, and rapidly frozen in liquid nitrogen for total RNA extraction. Total RNA was extracted from the test insects and cDNA was synthesized according to the total RNA extraction and cDNA synthesis methods described in Example 1, ensuring consistent operating conditions for each sample.
[0074] Specific primers for real-time PCR of the CYP4C1 gene of the wheat aphid were designed, and β-actin was selected as an internal reference gene to ensure the stability and accuracy of the quantification results. The primer sequences are as follows:
[0075] The CYP4C1 fluorescence quantitative primers have sequences shown in SEQ ID NO.7 and SEQ ID NO.8:
[0076] SEQ ID NO.7:
[0077] qCYP4C1-F:TGACTGGACAGCAAAGAATC;
[0078] SEQ ID NO.8:
[0079] qCYP4C1-R:CATCGTTACAACCTCATCCC;
[0080] β-actin was used as the internal reference gene, and the sequences of the internal reference primers are shown in SEQ ID NO.9 and SEQ ID NO.10:
[0081] SEQ ID NO.9:
[0082] β-actin forward primer: CCGAAAAGCTGTCATAATGAAGACC;
[0083] SEQ ID NO.10:
[0084] β-actin reverse primer: GGTGAAACCTTGTCTACTGTTACATCTTG;
[0085] qRT-PCR was performed using the SYBR Green Real-Time PCR Kit. The reaction mixture consisted of 20 μL: 10 μL 2×SYBR Green Premix, 0.4 μL 10 μM forward primer, 0.4 μL 10 μM reverse primer, 2 μL cDNA template, and 7.2 μL L Nase-Free water. The specificity of the amplified products was verified.
[0086] The relative expression level of the CYP4C1 gene was calculated using the 2^(-ΔΔCt) method, with the gene expression level of the control group (dsGFP) as 1, and the gene silencing efficiency of the treatment group (dsSaCYP4C1) at different time points was calculated. Figure 3 The graph shows the interference efficiency of dsRNA on the CYP4C1 gene of the wheat aphid. The horizontal axis represents feeding time, and the vertical axis represents the relative expression level of the CYP4C1 gene. The results show that the target gene begins to be silenced after 24 hours of feeding, with a silencing efficiency of 35%. The silencing efficiency reaches its peak after 48 hours of feeding, with a silencing efficiency of 58%. After 72 hours of feeding, the silencing efficiency decreases slightly but still remains at around 45%, demonstrating that dsRNA on the CYP4C1 gene of the wheat aphid has a significant silencing effect, and the interference efficiency is optimal at 48 hours of feeding.
[0087] Bioassay effect detection: Wheat aphids from the treatment and control groups, fed with dsRNA for 48 hours, were transferred to wheat plants treated with imidacloprid seeds and cultured at 20±2℃, photoperiod L:D=14:10, and relative humidity 60%–80%. Each treatment was replicated in triplicate. External interference was avoided during culture to ensure normal feeding and reproduction of the aphids. After 4 days, the survival rate and aphid production of the two groups were recorded. Figure 4The figure shows the bioassay effect of imidacloprid seed treatment on wheat aphids after silencing the CYP4C1 gene with dsRNA. The figure includes two indicators: survival rate and aphid production. dsGFP was used as the control group, and dsSaCYP4C1 was used as the treatment group. * indicates p < 0.05. The results showed that compared with the control group, the survival rate of wheat aphids fed with dsSaCYP4C1 was significantly reduced; at the same time, the aphid production in the treatment group was also significantly reduced. This demonstrates that the dsRNA of this invention can significantly inhibit the survival and reproductive capacity of wheat aphids and significantly improve their sensitivity to imidacloprid seed treatment in wheat, achieving efficient control of wheat aphids.
[0088] The foregoing has only described certain exemplary embodiments of the present invention by way of illustration. Undoubtedly, those skilled in the art can modify the described embodiments in various ways without departing from the spirit and scope of the present invention. Therefore, the foregoing drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.
Claims
1. A cDNA of the CYP4C1 gene of the wheat aphid, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.
1.
2. A dsRNA of the CYP4C1 gene of the wheat aphid, characterized in that, The dsRNA is obtained by transcription from the cDNA of claim 1 and is used to specifically silence the expression of the CYP4C1 gene of the wheat aphid. The nucleotide sequence of the dsRNA is shown in SEQ ID NO.
2.
3. A method for preparing dsRNA of the CYP4C1 gene of the wheat aphid, characterized in that, The preparation of dsRNA for the CYP4C1 gene of the wheat aphid as described in claim 2 specifically includes the following steps: S1. Total RNA was extracted from adult wheat aphids and used as a template for reverse transcription to obtain cDNA; S2. Design specific primers for the CYP4C1 gene of the wheat aphid. Using the cDNA obtained in S1 as a template, amplify the target fragment of the CYP4C1 gene by PCR technology. S3. After recovering and purifying the target fragment from S2, it was ligated into the pEASY-T3 cloning vector, transformed into E. coli Trans1-T1 competent cells, screened for positive clones containing the target fragment, and sequenced to verify them, and constructed a recombinant plasmid. S4. Using the recombinant plasmid constructed in S3 as a template, PCR amplification was performed using specific primers containing the T7 promoter sequence to obtain a transcription template containing the T7 promoter. S5. Using the transcription template obtained in S4, perform in vitro transcription and purification using an in vitro transcription kit to obtain dsRNA.
4. The method for preparing dsRNA of the CYP4C1 gene of the wheat aphid according to claim 3, characterized in that, The nucleotide sequences of the specific primers in S2 are shown in SEQ ID NO.3 and SEQ ID NO.
4.
5. The method for preparing dsRNA of the CYP4C1 gene of the wheat aphid according to claim 3, characterized in that, The nucleotide sequences of the specific primers containing the T7 promoter sequence in S4 are shown in SEQ ID NO.5 and SEQ ID NO.
6.
6. The application of the cDNA according to claim 1 in the control of wheat aphid.
7. The application of dsRNA according to claim 2 in the control of wheat aphid.
8. The application according to claim 7, characterized in that, The dsRNA described in claim 2 is introduced into the nymphs of the wheat aphid via a feeding method to achieve the control of the wheat aphid.
9. The application according to claim 8, characterized in that, The specific operation of the feeding method is as follows: the dsRNA described in claim 2 is added to 15% sucrose water to prepare artificial feed, and the third instar nymphs of wheat aphid are fed with it, with a total amount of dsRNA fed being 8µg.