Use of non-coding rnas to improve osmotic stress resistance in nitrogen-fixing microorganisms
By introducing specific non-coding RNA molecules, the synthesis of tetrahydropyrimidine in nitrogen-fixing microorganisms was promoted, which solved the problem of resistance of rhizosphere nitrogen-fixing bacteria under osmotic stress and improved their tolerance to drought stress and resistance to osmotic stress.
Patent Information
- Application Number
- CN202610686500.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-18
- Publication Date
- 2026-06-23
Smart Images

Figure CN122256398A_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the field of biotechnology, and more specifically, to the application of non-coding RNA in enhancing the osmotic stress resistance of nitrogen-fixing microorganisms. Background Technology
[0002] Bacterial non-coding RNA (ncRNA) is a class of functional RNA molecules that lack protein-coding capabilities but possess important regulatory functions. In Gram-negative bacteria, ncRNAs, primarily mediated by the RNA-binding protein Hfq, recognize target mRNAs through base pairing, regulating their translation efficiency or stability, thereby finely regulating gene expression at the post-transcriptional level. As crucial regulatory hubs in bacterial responses to environmental changes, ncRNAs play a key role in bacterial adaptive evolution by sensing environmental signals such as osmotic stress and oxidative stress.
[0003] Rhizosphere nitrogen-fixing bacteria face osmotic stress caused by abiotic stresses such as drought, high salinity, and low temperature in field applications. This osmotic stress is the main abiotic bottleneck restricting their colonization efficiency and nitrogen fixation performance. Studies have shown that osmotic stress not only disrupts the symbiotic interaction between rhizosphere nitrogen-fixing bacteria and host plants but also significantly inhibits nitrogen-fixing genes (…). nif The transcriptional expression and nitrogenase activity of rhizosphere nitrogen-fixing bacteria (ncRNAs) significantly reduce nitrogen fixation efficiency. Therefore, identifying and utilizing key ncRNA molecules that can enhance the resistance of rhizosphere nitrogen-fixing bacteria to osmotic stress, and improving strain resistance by regulating ncRNA expression or designing artificial ncRNA modules, is of significant scientific importance and practical value for overcoming the bottlenecks in the field application of rhizosphere nitrogen-fixing bacteria and constructing efficient stress-resistant nitrogen fixation systems. Summary of the Invention
[0004] The purpose of this disclosure is to provide the application of non-coding RNA in enhancing the resistance of nitrogen-fixing microorganisms to osmotic stress.
[0005] To achieve the above objectives, the first aspect of this disclosure provides the application of non-coding RNA in enhancing the osmotic stress resistance of nitrogen-fixing microorganisms, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0006] Optionally, the enhancement of osmotic stress resistance in nitrogen-fixing microorganisms includes promoting the synthesis of tetrahydropyrimidines in nitrogen-fixing microorganisms.
[0007] Optionally, the osmotic stress resistance is drought stress resistance.
[0008] Optionally, the nitrogen-fixing microorganisms include *Pseudomonas schlegelii* A1501 and *Rhizobium fischeri*.
[0009] A second aspect of this disclosure provides a method for improving the osmotic stress resistance of nitrogen-fixing microorganisms, the method comprising: introducing non-coding RNA into the nitrogen-fixing microorganisms; Alternatively, a recombinant expression vector containing the non-coding RNA may be introduced into the nitrogen-fixing microorganism; The nucleotide sequence of the non-coding RNA is shown in SEQ ID NO: 1.
[0010] Optionally, the osmotic stress resistance is drought stress resistance.
[0011] Optionally, the nitrogen-fixing microorganisms include *Pseudomonas schlegelii* A1501 and *Rhizobium fischeri*.
[0012] Optionally, in the recombinant expression vector, the vector is pBBR1MCS-2.
[0013] By introducing non-coding RNA into chassis microorganisms using the above technical solution, the osmotic stress resistance of chassis microorganisms can be significantly improved, especially their tolerance to drought stress. At the same time, the non-coding RNA molecule promotes the synthesis of tetrahydropyrimidine, an osmotically compatible substance in chassis microorganisms, thereby improving the osmotic stress resistance of nitrogen-fixing microorganisms.
[0014] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description
[0015] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings: Figure 1 This is a diagram of the construction of the recombinant expression vector.
[0016] Figure 2 This is a verification diagram of the recombinant expression vector.
[0017] Figure 3 This is a graph showing the results of the determination of the content of osmotic compatibility substances in recombinant engineered bacteria.
[0018] Figure 4 This is a graph showing the survival rate analysis results of chassis strains and recombinant engineered bacteria under 10 days of drought stress treatment. Detailed Implementation
[0019] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.
[0020] The first aspect of this disclosure provides the application of non-coding RNA in enhancing the osmotic stress resistance of nitrogen-fixing microorganisms, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0021] The inventors of this disclosure developed a nitrogen-fixing model strain, *Pseudomonas stearothermii* A1501, under hyperosmolar conditions (sorbitol) and normal conditions. Pseudomonas stutzeri Systematic analysis of the gene expression profile of A1501 yielded the DNA sequence shown in SEQ ID NO: 2. The RNA sequence transcribed from this DNA sequence is shown in SEQ ID NO: 1 (in SEQ ID NO: 1 of the sequence listing, t represents u). The inventors of this disclosure have discovered that introducing this non-coding RNA into chassis microorganisms can significantly improve the osmotic stress resistance of chassis microorganisms, especially their tolerance to drought stress conditions.
[0022] SEQ ID NO: 1: aggcgugagguuatccggagccuctagguuugcugcugugacguugucuacuugaugcgcagcggaauuggaaaaguagaacuaaugccuggaaggcaugauccggcagagcagucagcuaugaggaacgcauuaccaccgcagugcccacaugaatccaccagccucuuucugggagguggguuau gucugagaugauccuucuggacuucaaugcgguuagccgcaaagucggauugagucguaaaacuaucuacugccguauccgaggggugacuucccgagacaggugaagauaggccgagcaagccgcuggcuucagcacgaagucgacgacuggauagccagugcagcugcagcgagauaguaaagag.
[0023] In one embodiment, improving the osmotic stress resistance of nitrogen-fixing microorganisms includes promoting the synthesis of tetrahydropyrimidines in nitrogen-fixing microorganisms.
[0024] The inventors of this disclosure determined the content of osmotically compatible substances in chassis microorganisms with introduced non-coding RNA and found that non-coding RNA molecules promoted the synthesis of tetrahydropyrimidine, an osmotically compatible substance in chassis microorganisms, thereby improving the osmotic stress resistance of nitrogen-fixing microorganisms.
[0025] In one embodiment, the osmotic stress resistance is drought stress resistance.
[0026] In one embodiment, the nitrogen-fixing microorganism includes *Pseudomonas stearothermii* A1501 (… Pseudomonas stutzeri A1501) and Rhizobium fischeri ( Sinorhizobium fredii CCBAU 45436).
[0027] A second aspect of this disclosure provides a method for improving the osmotic stress resistance of nitrogen-fixing microorganisms, the method comprising: introducing non-coding RNA into the nitrogen-fixing microorganisms; Alternatively, a recombinant expression vector containing the non-coding RNA may be introduced into the nitrogen-fixing microorganism; The nucleotide sequence of the non-coding RNA is shown in SEQ ID NO: 1.
[0028] The osmotic stress resistance is drought stress resistance.
[0029] In one embodiment, the nitrogen-fixing microorganisms include *Pseudomonas schrenckii* A1501 and *Rhizobium fischeri*.
[0030] In one embodiment, the recombinant expression vector is pBBR1MCS-2.
[0031] The present invention will be further described in detail below through examples, but the present invention is not limited thereto.
[0032] All raw materials used in the following examples can be obtained through commercial purchase.
[0033] Example 1 Cloning of non-coding RNA nucleotide sequences: according to Pseudomonas stutzeri Based on the genome sequencing results of A1501, the following pair of PCR-specific primers were designed: Forward primer F: gttccaggaaagtcaagcat; Reverse primer R: ctctttactatctcgctgca.
[0034] from Pseudomonas stutzeri The complete nucleotide sequence containing its promoter, SEQ ID NO: 2, was amplified from the A1501 genomic DNA. In SEQ ID NO: 2, 1-55 bp is the promoter.
[0035] Example 2 This example illustrates the construction of a recombinant expression vector for non-coding RNA (SisR8) and recombinant engineered bacteria: like Figure 1 As shown, the DNA fragment of the cloned non-coding RNA from Example 1 and the expression vector pBBR1MCS-2 were subjected to... Bam HI and HindIII. The non-coding RNA nucleotide fragment recovered from the enzyme digestion was inserted into the multiple cloning site of pBBR1MCS-2 using T4 DNA ligase after double digestion. The ligation product was transformed into *E. coli* by electroporation. Positive clones were selected for PCR verification. The PCR product was detected by agarose gel electrophoresis, yielding a specific band of the expected size. Finally, sequencing confirmed the sequence was correct, resulting in the SisR8 recombinant expression vector pSisR8. The verification results of the recombinant expression vector are as follows: Figure 2 As shown in the figure. The results indicate that the recombinant expression vector and recombinant engineered bacteria for this non-coding RNA were successfully constructed. PCR sequencing confirmed the correctness of the recombinant expression vector, which was named pSisR8.
[0036] The recombinant expression vector was transformed into *Pseudomonas stearothermia* via triparental conjugation. Pseudomonas stutzeri , P. stutzeri A1501) A1501 and Rhizobium fischeri ( Sinorhizobium fredii , S. fredii Two recombinant engineered bacteria were obtained from CCBAU45436.
[0037] Two recombinant engineered bacteria containing the recombinant expression vector pSisR8 were named respectively. P. stutzeri (pSisR8) and S. fredii (pSisR8).
[0038] Example 3 This example illustrates how non-coding RNA expression vectors enhance the drought stress resistance of nitrogen-fixing bacteria's chassis. The chassis strain of Example 2 P. stutzeri A1501 S. fredii CCBAU45436 and recombinant engineered bacteria P. stutzeri (pSisR8) and S. fredii (pSisR8) was inoculated into LB liquid medium for activation and cultured overnight at 30°C. The overnight culture was then transferred at a 1% inoculum to 20 mL of fresh LB and TY media for further culture until OD500 was reached. 600 =0.6; take 1 mL of OD 600 After centrifuging the bacterial culture to 0.6 g / L at 5000 rpm for 10 minutes, wash the cells twice with PBS buffer, discard the supernatant, and collect the cells in 2 mL centrifuge tubes. Place each centrifuge tube open in a sterile desiccator for drying (using silica gel as a desiccant; the relative humidity in the desiccator should be <5%). Every 5 days, remove the treated cells, add liquid culture, and rehydrate on a shaker at the corresponding temperature for 15 minutes. Then perform serial dilutions to achieve a final bacterial concentration of 10 g / L. 0 10-1 10 -2 10 -3 10 -4 and 10 -5 Eight µL of bacterial culture was taken from each dilution and placed on solid plates of LB and TY media. After incubation at a constant temperature for 1-3 days, the growth status of the strains was observed. The results are as follows: Figure 4 As shown in Table 1.
[0039] Table 1. Comparison of the highest tolerance to desiccation stress between chassis strains and recombinant engineered strains.
[0040] Depend on Figure 4 As shown in Table 1, after 10 days of drying, the recombinant bacteria... P. stutzeri The survival rate of (pSisR8) was higher than that of the chassis strain. P. stutzeri A1501 improved by two orders of magnitude, with its maximum tolerance time increased to 18 days; recombinant bacteria S. fredii The survival rate of (pSisR8) was higher than that of the chassis strain. S. fredii CCBAU increased by one order of magnitude, with its maximum tolerance time increasing to 25 days, indicating that expression of non-coding RNA can significantly improve drought stress resistance in the rhizosphere nitrogen-fixing bacteria chassis.
[0041] Example 4 This example illustrates the determination of tetrahydropyrimidine content in recombinant engineered bacteria: chassis strain P. stutzeri A1501 S. fredii CCBAU45436 and recombinant engineered bacteria P. stutzeri (pSisR8) and S. fredii (pSisR8) was inoculated into LB liquid medium for activation and cultured overnight at 30°C. The overnight culture was then transferred at a 1% inoculum to 20 mL of fresh culture medium for further culture until OD reached [value missing]. 600 =0.6; take 10mL of OD 600 After centrifuging the bacterial culture at 0.6 rpm for 10 minutes at 5000 rpm, rinse the bacterial cells twice with PBS buffer, discard the supernatant, and place each centrifuge tube open in a desiccator for drying.
[0042] The bacterial suspension was then centrifuged at 12,000 rpm for 20 min to collect the precipitated bacterial cells. The precipitate was washed once with 20 mL of sterile ddH2O and centrifuged at 12,000 rpm at 4°C for 10 min, after which the supernatant was discarded. The precipitate was then resuspended in 10 mL of sterile ddH2O, and 10 mL of the suspension was placed in a homogenizer and homogenized using an ultrasonic homogenizer. The homogenized sample was filtered using a sterile syringe and a sterile filter membrane and collected in a 2 mL centrifuge tube. Finally, the sample was analyzed using an Agilent 1290-6495 LC-QQQ liquid chromatography-triple quadrupole mass spectrometry system.
[0043] The results are as follows Figure 3 As shown, compared with the chassis bacteria, the two recombinant engineered bacteria had significantly higher tetrahydropyrimidine content, and the tetrahydropyrimidine content of the recombinant engineered bacteria was higher than that of the chassis bacteria. P. stutzeri The tetrahydropyrimidine content of (pSisR8) is 4.2 times that of the sclerotium. S. fredii The tetrahydropyrimidine content of (pSisR8) is 2.7 times that of the sclerotium.
[0044] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.
[0045] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.
[0046] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.
Claims
1. The application of non-coding RNA in enhancing the osmotic stress resistance of nitrogen-fixing microorganisms, characterized in that, The nucleotide sequence of the non-coding RNA is shown in SEQ ID NO:
1.
2. The application according to claim 1, wherein, The improvement of osmotic stress resistance in nitrogen-fixing microorganisms includes promoting the synthesis of tetrahydropyrimidines in nitrogen-fixing microorganisms.
3. The application according to claim 1, wherein, The osmotic stress resistance is drought stress resistance.
4. The application according to claim 1, wherein, The nitrogen-fixing microorganisms include *Pseudomonas schrenckii* A1501 and *Rhizobium fischeri*.
5. A method for improving the osmotic stress resistance of nitrogen-fixing microorganisms, characterized in that, The method includes: introducing non-coding RNA into the nitrogen-fixing microorganism; Alternatively, a recombinant expression vector containing the non-coding RNA may be introduced into the nitrogen-fixing microorganism; The nucleotide sequence of the non-coding RNA is shown in SEQ ID NO:
1.
6. The method according to claim 5, wherein, The osmotic stress resistance is drought stress resistance.
7. The method according to claim 5, wherein, The nitrogen-fixing microorganisms include *Pseudomonas schlegelii* A1501 and *Rhizobium fischeri*.
8. The method according to claim 5, wherein, In the recombinant expression vector, the vector is pBBR1MCS-2.