Functional site of maize gene kw6 and use thereof
By knocking out or silencing the maize KW6 protein using gene editing technology and altering its amino acid sequence using the CRISPR/Cas9 system, the problem of improving maize kernel weight, which is difficult to improve through traditional breeding, has been solved, resulting in larger maize kernels and increased yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2025-06-16
- Publication Date
- 2026-06-23
AI Technical Summary
Traditional breeding techniques are difficult to effectively improve maize kernel weight, and existing gene editing technologies mainly result in smaller kernels, have low application value, and lack negative regulatory factors to increase maize yield.
By using gene editing technology, the expression or activity of the KW6 protein in maize can be knocked out or silenced. The CRISPR/Cas9 system can be used to edit the gene, altering the amino acid sequence of the KW6 protein or terminating its translation prematurely, thereby regulating maize kernel weight and yield.
It significantly improves the width, length, and thickness of corn kernels, increases the weight of 100 kernels, and enhances corn yield, achieving efficient improvement in kernel weight and yield.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to maize genes. KW6 Functional sites and their uses. Background Technology
[0002] As one of the world's three major food crops, maize is not only an important guarantee of food security but also a core pillar of livestock and industrial raw materials. Data from the Food and Agriculture Organization of the United Nations shows that in 2024, global maize production accounted for more than 40% of total cereal production. China, as the second largest producer, has an annual maize output exceeding 295 million tons, but domestic maize consumption demand is as high as 313 million tons. Given limited arable land resources and increasing domestic maize consumption year by year, improving maize yield per unit area has become a crucial agricultural issue that urgently needs to be addressed. Maize yield is mainly composed of three factors: the number of ears per acre, the number of kernels per ear, and kernel weight. Kernel weight has significant potential for genetic improvement. However, traditional breeding methods are not very efficient in improving kernel weight, mainly because the genetic regulatory network of kernel weight is complex, and kernel development is affected by various factors such as kernel filling rate and endosperm cell expansion. In recent years, the application of genomics technology has facilitated the analysis of the molecular network regulating kernel weight. By using forward genetics to clone genes that positively regulate grain development and elucidate the mechanisms of grain development, a theoretical basis for improving grain weight has been provided. However, most of these variations have negative effects, leading to smaller grains and limited application value. Therefore, screening for negative regulators of grain weight and precisely modifying grain weight genes through gene editing technology is beneficial for rapidly achieving breakthroughs in maize yield and providing scientific and technological support for the "storing grain through technology" strategy. Summary of the Invention
[0003] The technical problem solved by this invention is how to regulate plant grain weight.
[0004] To address the aforementioned technical problems, the first aspect of the present invention provides the application of protein KW6 or related biomaterials in any of the following: B1) Regulate plant grain weight; B2) Regulating plant yield; B3) Plant breeding; The protein KW6 is either A1), A2), or A3): A1) Proteins comprising the amino acid residues shown in SEQ ID No. 2; A2) A plant-derived protein with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in A1). Proteins that share 80% or more of the same amino acid sequence as those defined in A3 and A1, are derived from plants, and have the same biological function; A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins shown in A1)-A3).
[0005] In the application described above, the protein is derived from corn.
[0006] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0007] In the protein shown in A4) above, the tag is a protein tag, which refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, Myc tag, GST tag, and / or SUMO tag, etc.
[0008] The protein shown in A1) above may be a protein composed of the amino acid residues shown in SEQ ID No. 2; In the protein shown in A2) above, the substitution and / or deletion and / or addition of one or more amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues.
[0009] The coding gene of the protein shown in A2) above can be obtained by deleting one or more amino acid residues from the codons of the DNA sequence shown in SEQ ID No. 1 or SEQ ID No. 3, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag coding sequence to its 5′ end and / or 3′ end.
[0010] For the protein shown in A3) above, identity refers to the identity of the amino acid sequence. The identity of amino acid sequences can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.
[0011] In the above-mentioned proteins, the 80% or more identity can be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0012] In the above-described applications, the biological material is a substance that regulates the expression of the protein-coding gene or a substance that regulates the content of the protein.
[0013] In the above text, the indicators for plant breeding may include grain weight and yield.
[0014] In the applications described above, the protein KW6-related biomaterial is any one of C1) to C7): C1) The nucleic acid molecule encoding the protein KW6 described in the first aspect; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) A recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2); C6) Transgenic plant tissue containing the nucleic acid molecules described in C1), or transgenic plant tissue containing the expression cassette described in C2); C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2).
[0015] In the application described above, the nucleic acid molecule encoding protein KW6 is any one of the DNA molecules shown in D1)-D4): D1) The coding region (CDS) includes the DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:3; D2) The nucleotide sequence includes the DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:3; D3) has 75% or more identity with the nucleotide sequence defined by D1) or D2) and is derived from a plant and encodes a DNA molecule that encodes the protein KW6 described in the first aspect; D4) hybridizes under strict conditions with a nucleotide sequence defined by D1) or D2) of a DNA molecule derived from a plant and encoding the protein KW6 described in the first aspect.
[0016] In the nucleic acid molecules described above, D1) can be a DNA molecule with the coding region shown in SEQ ID NO:1 or SEQ ID NO:3.
[0017] In the nucleic acid molecules described above, D2) can be a DNA molecule with the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:3.
[0018] Specifically, in D1) above, SEQ ID NO:1 is genomic DNA; and in D1) above, SEQ ID NO:3 is cDNA.
[0019] As used in this invention, the terms "nucleic acid," "nucleic acid sequence," "nucleotide," "nucleic acid molecule," or "polynucleotide" mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutated, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. "Gene" or "gene sequence" is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as with isolated nucleic acid sequences, cDNA is preferred by default. Those skilled in the art can readily mutate the nucleotide sequence encoding the protein KW6 of this invention using known methods, such as gene editing methods. Any nucleotide that has been artificially modified and has 75% or higher identity with the nucleotide sequence of the protein KW6 isolated by the present invention, as long as it encodes the protein KW6, is derived from the nucleotide sequence of the present invention and is equivalent to the sequence of the present invention.
[0020] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences. Having 75% or more identity can mean at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity.
[0021] The above stringent conditions are: hybridization and washing twice at 68°C in a solution of 2×SSC and 0.1% SDS, each time for 5 min; followed by hybridization and washing twice at 68°C in a solution of 0.5×SSC and 0.1% SDS, each time for 15 min; or hybridization and washing at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.
[0022] In the foregoing, the expression cassette containing nucleic acid molecules refers to DNA capable of expressing the proteins described above in host cells. The expression cassette may also include single-stranded or double-stranded nucleic acid molecules containing all the regulatory sequences necessary for expressing any of the aforementioned proteins. The regulatory sequences, under compatible conditions, guide the coding sequence to express any of the aforementioned proteins in suitable host cells. The regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences must include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for linking the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein, a regulator-linked regulatory sequence may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and may be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to those of the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell and thus terminate transcription. The termination sequence is operatively attached to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively attached to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence attached to the amino terminus of a protein that guides the encoded protein into the cellular secretory pathway. Signal peptide coding regions that guide the expressed protein into the secretory pathway of the host cell can be used in this invention. Adding a regulatory sequence that can regulate protein expression according to the growth status of the host cell may also be necessary. Examples of regulatory sequences are those that respond to chemical or physical stimuli (including in the presence of regulatory compounds), thereby opening or closing gene expression. Other examples of regulatory sequences are those that can amplify genes. In these examples, the nucleic acid sequence encoding the protein should be operatively linked to the regulatory sequence.
[0023] Recombinant expression vectors containing the protein-coding gene expression cassettes can be constructed using existing plant expression vectors.
[0024] When preparing an expression vector, a nucleic acid molecule encoding any of the aforementioned proteins can be housed within the vector for operative linking to a suitable expression regulatory sequence. The recombinant expression vector can be any vector (e.g., plasmid or virus) that facilitates recombinant DNA manipulation and expression of the nucleic acid sequence. The choice of vector typically depends on its compatibility with the host cell to which it will be introduced. The vector can be a linear or closed circular plasmid. The vector can be a self-replicating vector (i.e., a complete structure existing outside the chromosome that can replicate independently of the chromosome), such as a plasmid, extrachromosomal element, microchromosome, or artificial chromosome. The vector can contain any mechanism that ensures self-replication. Alternatively, the vector is a vector that, when introduced into a host cell, will integrate into the genome and replicate along with the integrated chromosome. Furthermore, a single vector or plasmid, or two or more vectors or plasmids, or transposons, can be used, or the vector may contain the entire DNA to be introduced into the host cell genome. The vector contains one or more selection markers that facilitate the selection of transformed cells. A selection marker is a gene whose product confers resistance to biocides or viruses, resistance to heavy metals, or confers protrophic phenotypes, etc. Examples of bacterial selection markers include the dal gene of Bacillus subtilis or Bacillus licheniformis, or resistance markers for antibiotics such as ampicillin, kanamycin, chloramphenicol, or tetracycline. The vector contains elements that enable stable integration into the host cell genome or ensure autonomous replication of the vector independently of the cell genome. In the case of autonomous replication, the vector may also contain an origin of replication, enabling autonomous replication in the target host cell. The origin of replication may carry a mutation that makes it temperature-sensitive in the host cell. More than one copy of the nucleic acid molecule encoding any of the aforementioned proteins of the present invention can be inserted into the host cell to increase the yield of the gene product. This copy number increase can be achieved by inserting at least one additional copy of the nucleic acid molecule into the host cell genome, or by inserting an amplifiable selection marker along with the nucleic acid molecule, and by culturing cells in the presence of a suitable selection reagent to select cells containing the amplified copy of the selective marker gene, thereby containing the additional copy of the nucleic acid molecule. The operations used to connect the above-mentioned elements to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).
[0025] The term "operable link" is defined in this paper as a conformation in which a regulatory sequence is located at the appropriate position of the coding sequence relative to the DNA sequence so that the regulatory sequence guides the expression of the protein.
[0026] In the above-mentioned biological materials, the recombinant microorganisms may specifically be yeast, bacteria, algae, or fungi.
[0027] In a second aspect, the present invention provides the use of a substance that inhibits the activity of the KW6 protein in the first aspect or a substance that inhibits the expression of the nucleic acid encoding the KW6 protein in the first aspect in any of the following E1)-E5); E1) Increase plant grain weight; E2) Increase plant yield; E3) Cultivating high-grain-weight plants; E4) Cultivating high-yielding plants; E5) Plant breeding.
[0028] In the above-described applications, the substance is any one of the following: F1) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of the genes encoding the proteins described in the first aspect. F2) expresses the gene encoding the nucleic acid molecule described in F1). F3) contains the expression cassette of the gene described in F2). F4) a recombinant vector containing the gene described in F2), or a recombinant vector containing the expression cassette described in F3). F5) Recombinant microorganisms containing the gene described in F2), or recombinant microorganisms containing the expression cassette described in F3), or recombinant microorganisms containing the recombinant vector described in F4). F6) A transgenic plant cell line containing the gene described in F2), or a transgenic plant cell line containing the expression cassette described in E3), or a transgenic plant cell line containing the recombinant vector described in F4). F7) Transgenic plant tissue containing the gene described in F2), or transgenic plant tissue containing the expression cassette described in F3), or transgenic plant tissue containing the recombinant vector described in F4), F8) A transgenic plant organ containing the gene described in F2), or a transgenic plant organ containing the expression cassette described in F3), or a transgenic plant organ containing the recombinant vector described in F4).
[0029] In the applications described above, the inhibition of nucleic acid molecule expression can be achieved through gene knockout or gene silencing.
[0030] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.
[0031] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.
[0032] In the applications described above, the substance that inhibits the biological function (activity) of the protein described in the first aspect or the substance that inhibits the expression of the nucleic acid molecule can be a reagent that inhibits or reduces the expression of the nucleic acid molecule. The reagent that inhibits or reduces the expression of the nucleic acid molecule may be a reagent that knocks out the gene through homologous recombination or a reagent that knocks out the gene through CRISPR / Cas9. The reagent that inhibits or reduces the expression of the nucleic acid molecule may contain a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0033] Furthermore, the substance that inhibits the biological function (activity) of the protein described in the first aspect or the substance that inhibits the expression of the nucleic acid molecule may specifically be sgRNA or a vector expressing it.
[0034] Furthermore, the target site of the sgRNA may be positions 653-671 from the 5' end of SEQ ID No: 1. The vector expressing it may be pBUE411- KW6-KO .
[0035] In the applications described above, the nucleic acid molecule in F1) is a gRNA that targets the protein-coding gene described in the first aspect. In embodiments of the present invention, the nucleic acid molecule in F1) may be the nucleotide represented at positions 653-671 of SEQ ID No. 1.
[0036] In the above text, the indicators for plant breeding may include grain weight and yield.
[0037] Furthermore, in the aforementioned applications, E5) the plant breeding includes reducing or inhibiting or downregulating the expression of the gene encoding the protein in the recipient plant, and the purpose of the plant breeding includes increasing the grain weight and yield of the plant, and may also include producing high-grain-weight and high-yield plants (grain weight and yield higher than those of the recipient plant).
[0038] Thirdly, the present invention provides a method for increasing plant grain weight and / or yield, comprising the following steps: reducing the content or activity of the protein KW6 described in the first aspect in the recipient plant, thereby increasing plant grain weight and / or yield.
[0039] Fourthly, the present invention provides a method for increasing plant grain weight and / or yield, comprising the following steps: reducing the expression of nucleic acid molecules encoding protein KW6 as described in the first aspect in the recipient plant, thereby increasing plant grain weight and / or yield.
[0040] Fifthly, the present invention provides a method for increasing plant grain weight and / or yield, comprising the following steps: gene editing of the nucleic acid molecule encoding protein KW6 described in the first aspect in the recipient plant, causing it to change the encoded amino acid or terminate translation prematurely, thereby increasing plant grain weight and / or yield.
[0041] In a sixth aspect, the present invention provides a method for cultivating plants with high grain weight and / or high yield, comprising the following steps: reducing the content or activity of the protein KW6 described in the first aspect in the recipient plant to obtain a transgenic plant, which is the target plant.
[0042] In a seventh aspect, the present invention provides a method for cultivating plants with high grain weight and / or high yield, comprising the following steps: reducing the expression of the nucleic acid molecule encoding the protein KW6 described in the first aspect in the recipient plant to obtain a transgenic plant, which is the target plant.
[0043] Eighthly, the present invention provides a method for cultivating high-grain-weight and / or high-yield plants (grain-weight and / or yield higher than that of the recipient plant), comprising the following steps: gene editing of the nucleic acid molecule encoding protein KW6 in the recipient plant as described in the first aspect, causing it to change the encoded amino acid or terminate translation prematurely, thereby obtaining a transgenic plant, which is the target plant.
[0044] The grain weight and / or yield of the target plant are higher than those of the recipient plant.
[0045] The recipient plant mentioned above contains a nucleic acid molecule that encodes the protein KW6.
[0046] In the above text, the plant referred to is either N1, N2, or N3. N1) Monocotyledonous or dicotyledonous plants; N2) Gramineae plants; N3) Corn.
[0047] The aforementioned maize varieties can be LH244, B73, or other maize inbred lines and hybrids.
[0048] The aforementioned grain weight can be the weight per 100 grains. Furthermore, the aforementioned increase in grain weight can be achieved by increasing the weight per 100 grains, grain width, grain length, and / or grain thickness.
[0049] The above yield can be expressed as yield per mu (unit of land area).
[0050] Experiments have shown that the KW6 protein and its encoding gene regulate plant grain weight and / or yield; knocking out... KW6 Compared to the wild-type LH244, the knockout lines obtained from the gene showed a significant increase in grain weight and yield. This demonstrates that the KW6 protein and its encoding gene negatively regulate grain weight and yield in plants, and that gene editing technology can be used to further regulate these parameters. KW6 Editing has great potential for application in molecular breeding. Attached Figure Description
[0051] Figure 1 For 2 KW6 Homozygous edit line variant types ( KW6 -KO#1 and KW6 -KO#2).
[0052] Figure 2 for KW6 Phenotypic comparison between the knockout line and the wild-type LH244.
[0053] Figure 3 For LH244 and KW6 -KO#1 production plot test.
[0054] Figure 4 homozygous mutant wrky75 Compared with the control B73 phenotype. Detailed Implementation
[0055] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0057] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0058] The mutants in the following examples wrky75Materials: A mutant with premature translation termination (EMS4-091daa) was obtained from the B73 background EMS mutant library (http: / / maizeems.qlnu.edu.cn / ), and named... wrky75 .
[0059] In the examples below, Escherichia coli Trellef5α fast-transformation competent cells (Qingke Biotechnology) were used; the EHA105 strain was obtained from the maize functional genomics platform for Agrobacterium transformation.
[0060] The pBUE411 vector used for CRISPR (Cas9) knockout in the following examples is pBUE411 in Figure 1 of the following literature, also known as pBUE411 (Bar), A CRISPR / Cas9 toolkit for multiplexgenome editing in plants; Xing et al. BMC Plant Biology 2014, 14:327; obtained from the maize functional genomics platform.
[0061] Gene KW6 The genomic nucleotide sequence is SEQ ID No. 1, and the amino acid sequence of the protein KW6 it encodes is SEQ ID No. 2. KW6 The coding region CDS nucleotide sequence is SEQ ID No.3, with a sequence length of 1,227 bp, encoding a protein KW6 composed of 408 amino acid residues.
[0062] Example 1 KW6 Application of genes in regulating grain weight and yield one, KW6 Obtaining CRISPR / Cas9 knockout lines 1. Construction of CRISPR / Cas9 knockout vector 1) Design target Using the online design website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) KW6 Targets were designed from the CDS region of the gene. The obtained targets were screened, with priority given to targets near the start codon ATG. The targets were also sequence-specific and less likely to be off-target. The target sequence is (5'-3'): GGCCAAGGGAGACGCGCAA (SEQ ID No. 1, positions 653-671).
[0063] 2) Design primers for synthesizing target sites GGCG was added to the 5' end of the selected target sequence to obtain... KW6-The primers were obtained by adding AAAC to the 5' end of the reverse sequence of the Cas9-F2 primers. KW6 - The Cas9-R2 primer sequences used for synthesizing the target sites are shown in Table 1.
[0064] Table 1 shows the primer sequences used for CRISPR / Cas9 construction:
[0065] 3) Primer annealing: Add 5 μL of forward primer and 5 μL of reverse primer to a 200 μL centrifuge tube and anneal under the following reaction conditions to obtain the annealed target fragment. Reaction conditions: 95℃ for 5 min; allow to cool naturally to room temperature; store at 16℃.
[0066] 4) pBUE411 enzyme digestion The pBUE411 vector was digested with the enzyme digestion system shown in Table 2, and the digested vector was obtained by reacting in a water bath at 37°C for 6 h.
[0067] Table 2 shows the enzyme digestion system.
[0068] 5) Connection and Transformation The annealed target fragment obtained in 3) was ligated with the enzyme digestion vector obtained in 4), and the ligation was carried out at 16℃ for more than 12 hours to obtain the ligation product.
[0069] The connection system is shown in Table 3: Table 3 shows the connection system.
[0070] The ligation product was introduced into Trellef5α competent E. coli cells using a heat shock method to obtain positive recombinant bacteria. The recombinant plasmid was extracted and named pBUE411- KW6-KO, That is, genes KW6 CRISPR / Cas9 knockout vector.
[0071] 6) Agrobacterium-mediated transformation (1) Transformation: Take 50 μL of Agrobacterium tumefaciens EHA105 competent cells (avoid repeated freeze-thaw cycles), thaw at low temperature, and add 1 μg of plasmid pBUE411- KW6- Gently mix with KO and chill in an ice bath for 30 minutes. (2) Heat shock induction: After being rapidly frozen in liquid nitrogen for 5 min, it was immediately placed in a 37℃ water bath for 5 min of heat shock, and then placed in an ice bath for 2 min. (3) Recovery culture: Under aseptic conditions, add 600 μL of antibiotic-free YEB liquid culture medium and place it in a shaker at 200 rpm at 28°C for more than 3 hours in the dark for recovery. (4) Collection of bacterial cells: Centrifuge at 5,000 rpm for 2 min at room temperature, discard most of the supernatant, and gently resuspend the remaining bacterial solution; (5) Antibiotic screening: Spread evenly on YEB double antibody plates (50 mg / mL rifampin + 50 mg / mL Kan), incubate at 28℃ in the dark for 72 h, and screen for positive clones, which are those containing pBUE411- KW6- The KO vector of Agrobacterium tumefaciens EHA105 is named EHA105 / pBUE411- KW6- KO.
[0072] 2. KW6 Preparation and identification of CRISPR / Cas9 knockout lines Using pBUE411- KW6- Agrobacterium tumefaciens using the KO vector was used to infect the immature embryos of the LH244 maize inbred line to obtain transgenic seedlings containing the vector, designated as T0 generation transgenic plants. Herbicide resistance was screened on the T0 generation transgenic plants grown in the greenhouse, yielding five T0 herbicide resistance events. These five T0 events were amplified using the primer combination Cas9-39032-F3 + Cas9-39032-R3 and then sequenced. Two homozygous editing events from the T0 generation were selected for self-pollination, resulting in two homozygous editing events from the T1 generation, named... KW6 -KO#1 and KW6 -KO#2, which is KW6 CRISPR / Cas9 knockout line.
[0073] Extracting two events from T1 generation homozygous edited plants KW6 -KO#1 and KW6 Genomic DNA from the leaves of -KO#2 was amplified using the primer combination Cas9-39032-F3+Cas9-39032-R3 and then sequenced.
[0074] CRISPR / Cas9 knockout line identification primer sequences: Cas9-39032-F3AGAGGGAGCTTCTTGTGGAC Cas9-39032-R3GATGAAGAGGTGACGGGGAT The results are as follows Figure 1 As shown, A is KW6 Gene structure and location KW6CRISPR / Cas9 cleavage target sites in the gene coding region. The red box represents the gene coding region, the gray box represents the UTR, and the white box represents the gene intron region; B represents the homozygous editing event types generated by the cleavage target sites in the KW6 coding region, as well as the corresponding SANGER sequencing peak diagram of the PCR products and the mutation sites located in the gene coding region; T1 generation homozygous edited plants KW6 -KO#1 compared to corn LH244 KW6 The gene has mutated. The nucleotide sequence of the two homologous chromosomes is SEQ ID No. 1. KW6 The genomes of all samples underwent the following changes: An A base was added between positions 668 and 669 of SEQ ID No. 1, causing a frameshift, resulting in a change in the protein's amino acid sequence and premature termination of translation, thus leading to… KW6 Loss of gene function.
[0075] T1 generation homozygous edited plants KW6 -KO#2 compared to corn LH244 KW6 The gene has mutated. The nucleotide sequence of the two homologous chromosomes is SEQ ID No. 1. KW6 The genomes of all samples underwent the following changes: A single T base was added between positions 668 and 669 of SEQ ID No. 1, causing a frameshift, resulting in a change in the protein's amino acid sequence and premature termination of translation, thus leading to… KW6 Loss of gene function.
[0076] Then, the T1 generation homozygous edited plants KW6 -KO#1 and KW6 -KO#2 was self-pollinated to obtain the T2 generation. The grains harvested from the T2 generation plants were used for phenotypic statistics such as grain weight.
[0077] II. Obtaining homozygous mutant plants wrky75 The mutant material was obtained from the EMS mutant library with B73 background (http: / / maizeems.qlnu.edu.cn / ) (number: EMS4-091daa).
[0078] Will get wrky75 Seeds were planted in the field, samples were taken and DNA was extracted. Primers Mu-WRKY-F1 and Mu-WRKY-R1 were designed flanking the mutation site. The mutant material was amplified and sequenced using the Mu-WRKY-F1 + Mu-WRKY-R1 primer combination for identification. Primer sequences: Mu-WRKY-F1:CACACCTCTCCCTTTCCTCA Mu-WRKY-R1: GTCCACAAGAAGCTCCCTCT.
[0079] To eliminate the influence of mutant background on phenotype, pollen from maize B73 was used to pollinate homozygous mutants. wrky75 BC1F1 was obtained by self-pollination, and BC1F1 was then self-crossed to obtain BC1F2. BC1F2 was then identified using the primer combination Mu-WRKY-F1 + Mu-WRKY-R1. wrky75 Phenotypic statistics, such as grain weight, were performed on homozygous mutants and wild types.
[0080] three, KW6 CRISPR / Cas9 knockout line phenotypic analysis 1. Grain weight phenotypic identification of transgenic homozygous editing events The two independent T2 generation homozygous edited plants obtained above KW6 -KO#1 and KW6 -KO#2 and the control wild-type LH244 were planted at the Hainan transgenic experimental base and managed according to traditional field management methods. After flowering and open pollination until full kernel maturity, the ears were harvested, dried, and traits such as 100-kernel weight, kernel length, kernel width, and kernel thickness were measured. Phenotypic data were analyzed to verify... KW6 Gene function. KW6 -KO#1 、KW6 -KO#2 and LH244 require more than 25 plants for phenotypic identification.
[0081] The results are as follows Figure 2 As shown, A represents the morphology of corn kernels, with a scale bar of 5 cm; B and C represent... KW6 -KO#1 and KW6 - Phenotypic data of 100-seed weight (B), seed width (C), seed length (D), and seed thickness (E) of KO#2 and wild-type LH244; one point represents one plant; it can be seen that, compared with the control LH244, the homozygous edited lines KW6 -KO#1 and KW6 -KO#2 showed a significant increase in the weight of 100 grains, indicating a homozygous editing system. KW6 -KO#1 and KW6 -KO#2 showed a significant increase in kernel width, kernel length, and kernel thickness compared to LH244.
[0082] The above results indicate that KW6 Knocking out a gene increases the width, length, and thickness of the grain, which in turn increases the weight of 100 grains.
[0083] 2. Identification of yield plots in homozygous edited transgenic lines To verify KW6 Whether the knockout line has the potential to increase production was investigated using LH244 and homozygous edited lines. KW6- The yield plot trial of KO#1 used a completely randomized block design with 5 biological replicates and a planting density of 4,500 plants / acre. Open pollination was used, and the kernels were harvested at full maturity. After the maize ears were completely dried, the ear phenotype was analyzed.
[0084] The results are as follows Figure 3 As shown, A is a photograph of maize ears harvested from a field trial, with a scale bar of 5 cm; B is a photograph of LH244 and... KW6 - KO#1 yield per acre; results showed that compared to wild-type LH244, KW6- The yield per acre of KO#1 increased significantly, by ~29.6 kg.
[0085] Four, wrky75 Phenotypic identification of homozygous mutants Planting wrky75 The homozygous mutant and the control B73 were managed according to traditional field management practices. After flowering and open pollination until full kernel maturity, the ears were harvested, dried, and traits such as 100-kernel weight, kernel length, kernel width, and kernel thickness were measured. Phenotypic statistics, including kernel weight, were also performed to verify [the results]. KW6 Gene function. Used for statistical phenotypes. wrky75 There were more than 15 homozygous mutants compared to the control B73 plants.
[0086] The results are as follows Figure 4 As shown, A is a homozygous mutant. wrky75 Compared with the control B73 maize kernel morphology, the scale bar is 5cm; BE represents homozygous mutants. wrky75 The phenotypes of the control B73 (100-grain weight (B), grain width (C), grain length (D), and grain thickness (E) were compared; statistical data revealed that the homozygous mutant... wrky75 The 100-grain weight, grain width, and grain thickness of the product were significantly increased compared to the control B73, while the grain length showed no significant difference.
[0087] The results show that KW6 The loss of gene function increases the width and thickness of the grain, resulting in an increase in the weight of 100 grains.
[0088] Therefore, the above data shows KW6 It participates in the regulation of corn kernel weight and is a negative regulator of kernel weight.
[0089] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Protein KW6 or its related biomaterials are used in any of the following: B1) Regulate plant grain weight; B2) Regulating plant yield; B3) Plant breeding; The protein KW6 is either A1), A2), or A3): A1) Proteins comprising the amino acid residues shown in SEQ ID No. 2; A2) A plant-derived protein with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in A1). Proteins that share 80% or more of the same amino acid sequence as those defined in A3 and A1, are derived from plants, and have the same biological function; A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins shown in A1)-A3).
2. The application according to claim 1, characterized in that: The protein KW6-related biomaterial is any one of C1) to C7): C1) A nucleic acid molecule encoding the protein KW6 described in claim 1; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) A recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2); C6) Transgenic plant tissue containing the nucleic acid molecules described in C1), or transgenic plant tissue containing the expression cassette described in C2); C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2).
3. The application according to claim 2, characterized in that: The nucleic acid molecule encoding the protein KW6 is any one of the DNA molecules shown in D1)-D4): D1) The coding region includes the DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:3; D2) The nucleotide sequence includes the DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:3; D3) has 75% or more identity with the nucleotide sequence defined by D1) or D2), is derived from a plant and is a DNA molecule encoding the protein KW6 described in claim 1; D4) hybridizes under stringent conditions with the nucleotide sequence defined by D1) or D2) of a DNA molecule derived from a plant and encoding the protein KW6 of claim 1.
4. The use of a substance that inhibits the activity of the KW6 protein of claim 1 or a substance that inhibits the expression of the nucleic acid encoding the KW6 protein of claim 1 in any of the following E1)-E5); E1) Increase plant grain weight; E2) Increase plant yield; E3) Cultivating high-grain-weight plants; E4) Cultivating high-yielding plants; E5) Plant breeding.
5. A method for increasing plant grain weight and / or yield, comprising the steps of: reducing the content or activity of the protein KW6 as described in claim 1 in the recipient plant, thereby increasing plant grain weight and / or yield.
6. A method for increasing plant grain weight and / or yield, comprising the steps of: reducing the expression of the nucleic acid molecule encoding the protein KW6 as described in claim 2 in the recipient plant, thereby increasing plant grain weight and / or yield.
7. A method for increasing plant grain weight and / or yield, comprising the following steps: gene editing of the nucleic acid molecule encoding protein KW6 as described in claim 2 in the recipient plant, causing it to change the encoded amino acid or terminate translation prematurely, thereby increasing plant grain weight and / or yield.
8. A method for cultivating high-grain-weight and / or high-yield plants, comprising the following steps: reducing the content or activity of the protein KW6 described in claim 1 in a recipient plant to obtain a transgenic plant, namely the target plant.
9. A method for cultivating high-grain-weight and / or high-yield plants, comprising the following steps: reducing the expression of the nucleic acid molecule encoding the protein KW6 as described in claim 2 in a recipient plant to obtain a transgenic plant, namely the target plant.
10. A method for cultivating plants with high grain weight and / or high yield, comprising the following steps: gene editing of the nucleic acid molecule encoding protein KW6 as described in claim 2 in the recipient plant, causing it to change the encoded amino acid or terminate translation prematurely, thereby obtaining a transgenic plant, which is the target plant.
Citation Information
Patent Citations
Electrical connector
CA939032A