Small-molecule RNA for alleviating lignification of loquat fruit and application thereof

By interfering with or stabilizing miR164 through Eja-MIR164 and its target mimicry technology (STTM), the problem of lignification in loquat fruit was solved, and precise regulation of lignin production in loquat fruit and roots was achieved, thereby improving fruit texture and plant resistance.

CN122256553APending Publication Date: 2026-06-23ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610565936.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-27
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies cannot precisely regulate lignin synthesis in loquat fruit at the molecular level, making it difficult to effectively solve the problem of postharvest lignification of loquat fruit.

Method used

By using the small RNA Eja-MIR164 and its target mimicry technology (STTM), the content of miR164 was reduced through interference or stable transformation, thereby precisely regulating the lignin production of loquat fruit and roots.

Benefits of technology

It significantly reduces the lignin content of loquat fruit, improves fruit texture and quality, enhances plant resistance, and achieves precise regulation of lignin synthesis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256553A_ABST
    Figure CN122256553A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant molecular biology, specifically relating to a small RNA molecule that alleviates lignification of loquat fruit and its application. The small RNA molecule is from loquat. Eja-MIR164 Its nucleotide sequence is shown in SEQ ID NO. 6. After processing within the plant, it forms a functional mature form. This invention experimentally confirms that loquat fruit contains… Eja-MIR164 The expression level of Eja-miR164 was negatively correlated with lignin content; transient interference or stable transformation using STTM technology reduced Eja-miR164 content, targeting its genes NAC transcription factor and lignin polymerase gene. EjLAC7 Increased expression levels in all samples led to a significant increase in lignin content. This invention utilizes small RNA molecules. Eja- MIR164 It can be used to breed new loquat varieties with reduced lignification, improve fruit texture and quality, and enhance post-harvest storage performance, and has potential application value in loquat genetic improvement and molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology, specifically relating to a small molecule RNA that alleviates lignification of loquat fruit and its application. Background Technology

[0002] Loquat ( Eriobotrya japonica It belongs to the genus Eriobotrya in the family Rosaceae. Eriobotrya Loquat is an important specialty economic fruit tree in southern my country. However, while post-harvest low-temperature storage can delay senescence, it easily leads to lignification and deterioration of the fruit, manifested as hardening and coarsening of the flesh and reduced juice content, severely affecting its edible quality and commercial value. To address the lignification problem in loquat fruit, researchers have explored various regulatory methods, such as acetylsalicylic acid treatment, methyl jasmonate composite film coating, and programmed cooling. These methods can alleviate lignification by inhibiting the activity of lignin synthesis-related enzymes, achieving some effect, but all remain at the physiological regulation level and fail to achieve precise intervention in lignin synthesis at the molecular level.

[0003] With the continuous development of loquat cultivation and the expansion of the industry scale, economic benefits have been significantly improved, and the demand for basic research on loquat has become increasingly urgent.

[0004] Small RNAs (microRNAs, or miRNAs for short) are a class of endogenous non-coding small RNAs approximately 20-24 nucleotides in length. Their biosynthesis begins with RNA polymerase II activating the miRNA gene (…). MIR genes MIRs The transcription of miRNAs leads to the formation of mature miRNAs through a series of processing steps. These mature miRNAs precisely regulate gene expression at the post-transcriptional level by mediating the cleavage or translational repression of target gene mRNAs. miRNAs are key regulators of plant development and possess relatively conserved regulatory targets, typically targeting a class of genes with the same structural domains. They participate in processes such as plant growth and development, cell differentiation, and stress responses. For example, in peaches, ppe-miR393 has been reported to target and cleave... PpTIR1 This, in turn, regulates ethylene production and softening in the fruit. In apples, mdm-miR7125 is regulated by light exposure, targeting key genes involved in lignin synthesis. MdCCR miRNAs regulate the balance between anthocyanin and lignin synthesis. However, there are currently no reports on miRNA-mediated regulation of lignin synthesis in loquat fruit at low temperatures, and there is a lack of research on the application of miRNA technology to alleviate postharvest lignification of loquat fruit.

[0005] Target mimicry is a type of miRNA activity regulation mechanism. These molecules have structures similar to miRNA binding sites, but form mismatches or protrusions at key positions, enabling them to competitively bind to miRNAs and prevent their interaction with the real target, thereby weakening the miRNA silencing effect. Based on this principle, short-tandem target mimicry (STTM) technology has become an important tool for studying miRNA function. It is worth noting that during the normal growth and development of loquat... Eja-MIR164 The expression level is very high, so in order to study its function, STTM was used to interfere and obtain samples with low miR164 content.

[0006] Therefore, based on the screening and functional identification of miRNAs related to lignification in loquat fruit, and combined with the advantages of STTM technology, this invention provides a small molecule RNA and its application in alleviating lignification in loquat fruit. Through STTM-mediated reverse verification and molecular biology methods, it achieves precise regulation of lignin synthesis in loquat fruit, providing a new technical path for the genetic improvement of loquat quality, and also providing practical support for the application of miRNAs in postharvest preservation of loquat. Summary of the Invention

[0007] The purpose of this invention is to provide Eja-MIR164 Its application in reducing the lignification of loquat is used to improve fruit texture and quality or plant resistance.

[0008] To achieve the above objectives, the present invention provides the following technical solution: This invention provides Eja-MIR164 Application in screening loquat plants with reduced lignification, the aforementioned Eja-MIR164 The nucleotide sequence is shown in SEQ ID NO.6.

[0009] Preferably, the screening is performed by detecting the loquat plant... Eja-MIR164 The expression level is achieved by [the expression level], wherein the expression level is negatively correlated with the lignin content of loquat fruit.

[0010] The present invention also provides a method for detecting the above-described... Eja-MIR164 A real-time quantitative PCR primer pair for expression level, wherein the forward primer of the primer pair contains the nucleotide sequence shown in SEQ ID NO.3 and the reverse primer contains the nucleotide sequence shown in SEQ ID NO.4.

[0011] The present invention also provides a method for detecting the above-described... Eja-MIR164The real-time quantitative PCR primer pair encoding the expression level of mature Eja-miR164, wherein the forward primer of the primer pair contains the nucleotide sequence shown in SEQ ID NO.10 and the reverse primer contains the nucleotide sequence shown in SEQ ID NO.11.

[0012] The present invention also provides a recombinant expression vector, the recombinant expression vector comprising methods for inhibiting the above-described... Eja- MIR164 The nucleic acid sequence of the mature Eja-miR164 contains a GFP fluorescent label, and the recombinant expression vector is the STTM164-eGFP vector.

[0013] The present invention also provides a transformant comprising the form shown in SEQ ID NO. 6. Eja-MIR164 Nucleic acid molecules or the recombinant expression vectors described above.

[0014] Preferably, the transformant is Agrobacterium, transiently transformed loquat cells, or stably transformed loquat cells.

[0015] The present invention also provides a method for application described above. Eja-MIR164 The above-described recombinant expression vector or the above-described transformant may be used in any of the following: (a) Preparation of formulations for promoting or inhibiting lignin production in loquat roots or fruits; (b) as a target for screening candidate substances that promote or inhibit lignin production.

[0016] The present invention also provides a method for promoting lignin production in loquat roots or fruits, the method comprising reducing the content of Eja-miR164 in loquat.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention provides Eja-MIR164 The molecule has the ability to inhibit lignin production in loquat, and can be used as a candidate gene for genetic engineering and breeding of loquat to improve fruit texture quality or plant resistance.

[0018] The Eja-MIR164 Its nucleotide sequence is shown in SEQ ID NO. 6. This invention experimentally confirms that loquat fruit contains… Eja-MIR164 The expression level of miR164 was negatively correlated with lignin content; transient interference or stable transformation using STTM technology to reduce miR164 content both led to a significant increase in lignin content. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The changes in lignin content of loquat fruit at harvest and after treatment at 0℃ for 1 day.

[0021] Figure 2 Loquat fruit was treated at 0℃ for 1 day after harvesting. Eja-MIR164 Changes in expression levels.

[0022] Figure 3 This is a schematic diagram of the STTM164 structure in transient interference technology.

[0023] Figure 4 This image shows the changes in gene expression and lignin content in loquat fruits after transient injection of STTM164 to silence miR164. Four groups of loquat fruits were successfully silenced. The two images above, from left to right, show the relative expression levels of miR164, ... EjNAC3L Relative expression levels; the two figures below, from left to right respectively EjLAC7 Relative expression level, lignin content.

[0024] Figure 5 A schematic diagram illustrating the steps of infecting loquat seedlings with Agrobacterium rhizogenes.

[0025] Figure 6 Positive tests were performed on transgenic roots obtained after Agrobacterium rhizogenes infected loquat seedlings.

[0026] Figure 7 Figure 1 shows the gene expression and lignin content analysis of loquat root with STTM164 stably silenced miR164; the top two figures, from left to right, represent the relative expression level of miR164, ... EjNAC3L Relative expression levels; the two figures below, from left to right respectively EjLAC7 Relative expression level, lignin content. Detailed Implementation

[0027] This invention provides Eja-MIR164 The application of molecules in reducing the degree of lignification in loquat, the aforementioned Eja- MIR164The nucleotide sequence is TTTGTGAGAAGGGTAGCTCTATCTAGTAGCTGGCCAGCTCCTAGAGTCGTCCTCTCAGTTGAGTGTTGGGGAAATTCTGGAATATATGATTTAGGTGTGAGTTGAGCAAGATGGAGAAGCAGGGCACGTGCATTTCTAACTCATTCGCATATACTGAGATATATATACTCAATACTCTTATTTTTCTCTG AGCTGCTAAATTATTACAAGTTTTACAGATATATATCTCATATCCAGTAATGAGTTAGTTGTTCATGTGCCCCTCTTCCCCATCATGACCACCCCACCTTATTGCTTCTATGAAGATTGTCACCGTAGATCATAACCATGCGGACATTCCAATTCAGGTATTCAGAAAATGCTGAATAATTAGCTCCACTTCAG (SEQ ID NO.6); Its mature form's nucleic acid sequence is uggagaagcagggcacgugca (SEQ ID NO.5); In plants, RNA polymerase II transcribes its precursor from genomic DNA, which, after a series of processing steps, forms the mature form. The mature form then cleaves the target gene by complementary pairing with a specific region of the target gene transcript. This process allows for the identification of the target gene. EjNAC3L It is an NAC transcription factor that can activate EjLAC7 It promotes lignin production.

[0028] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0029] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0030] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0031] Example 1: Low-temperature storage of loquat Eja-MIR164 The expression level of lignin is negatively correlated with lignin content. 1.1 Experimental Materials The material used in the experiment was the red-fleshed variety 'Da Hong Pao' ( Eriobotrya japonica cv.'Dahongpao', DHP) loquat fruit, harvested from Lanxi City, Zhejiang Province, China.

[0032] Fruits of uniform size, color, shape, and maturity without mechanical damage were selected for subsequent 0℃ treatment.

[0033] Sampling points included the initial point (freshly picked and untreated fruit) and fruit treated at 0℃ for 1 day. Three biological replicates were set up at each time point, and each replicate consisted of a mixture of four single fruits. After peeling and pitting, the pulp was diced, quickly frozen in liquid nitrogen, and stored at -80℃ for subsequent analysis.

[0034] 1.2 Determination of Lignin Content Prepare a lignin washing solution as a 100 mM phosphate buffer, containing 0.5% Triton X-100 and 0.5% PVP, and adjust to pH 7.8.

[0035] Weigh approximately 1.5 g of the loquat pulp jelly sample from the initial point (freshly picked and untreated) and the sample treated at 0℃ for 1 day, record the exact weight, add 5 mL of lignin washing solution, sonicate at room temperature for 10 min, centrifuge at 3500 rpm for 10 min, remove the supernatant, and repeat twice. Then, wash twice with distilled water and four times with methanol as described above, until the sample is decolorized, and then dry overnight in a 65℃ oven. Add 2 mL of 2 M hydrochloric acid and 0.2 mL of thioglycolic acid (Aladdin, China) to the dried precipitate, incubate in a 98℃ water bath for 8 h, and then immediately cool on ice to terminate the reaction. Wash the precipitate twice with distilled water and dry again overnight in a 65℃ oven. Add 2 mL of 1 M sodium hydroxide solution to the dried precipitate, shake on a shaker for approximately 18 h until the precipitate is completely dissolved, and centrifuge at 3500 rpm for 20 min. Transfer 0.5 mL of the supernatant to a 1.5 mL centrifuge tube, add 100 μL of concentrated hydrochloric acid, and incubate at 4 °C for 4 h to allow precipitation. Then centrifuge at 4 °C and 12000 rpm for 20 min and discard the supernatant. Redissolve the precipitate in 1 mL of 1 M sodium hydroxide solution.

[0036] Pipette 200 μL of the supernatant into an ELISA plate (3635, Corning, USA), using 1 M sodium hydroxide solution as a blank control. Measure the absorbance at 280 nm using a SynergyH1 ELISA reader (BioTek, USA). The standard curve was prepared using lignin standards (Macklin, China), with concentrations of 0, 5, 10, 15, 20, 30, 40, and 50 mg for measurement. The lignin content in the sample was calculated based on the standard curve.

[0037] 1.3 RNA extraction, reverse transcription, and quantitative real-time PCR Total RNA was extracted from loquat using a modified CTAB method. The quality of the extracted RNA was detected by agarose gel electrophoresis, and the concentration was determined using a NanoDrop micro spectrophotometer (Thermo, USA).

[0038] cDNA was synthesized using the HiScript III RT SuperMix for qPCR with gDNA wiper kit (Vazyme, China). The real-time quantitative PCR (RT-qPCR) reaction system was prepared according to the ChamQ SYBR qPCR Master Mix (Vazyme, China) instruction manual. The reaction was performed on a CFX96 real-time quantitative PCR instrument (Bio-Rad, USA), with a reaction program of 95℃ pre-denaturation for 30 seconds, followed by 40 cycles (95℃ denaturation for 3 seconds, 60℃ annealing and extension for 10 seconds).

[0039] Loquat EjACT (GenBank no. JN004223) As an mRNA internal reference gene, its primer sequence is as follows: F: AATGGAACTGGAATGGTCAAGGC (SEQ ID NO. 1); R: TGCCAGATCTTCTCCATGTCATCCCA (SEQ ID NO. 2).

[0040] Detection Eja-MIR164 The primer sequences for expression are: F: GGCCAGCTCCTAGAGTCG (SEQ ID NO.3); R: AGAAGCAATAAGGTGGGGGTGG (SEQ ID NO. 4).

[0041] Use 2 –ΔCT The relative expression level of the target gene is calculated using this method.

[0042] 1.4 Experimental Results The results of the lignin content determination showed that ( Figure 1 Loquats stored at 0℃ for 1 day after harvest resulted in lignification of the pulp, with the lignin content increasing from 0.848 mg / g at the initial point to 1.775 mg / g, indicating that low-temperature treatment induced the lignification process of the pulp.

[0043] The results of real-time quantitative PCR detection showed that ( Figure 2 ), compared to the initial point, Eja-MIR164 The expression level was significantly inhibited by low temperature, with the expression level decreasing by more than 3 times.

[0044] A comparison of the changes in lignin content reveals that... Eja-MIR164 Expression levels showed a significant negative correlation with lignin accumulation.

[0045] The above results indicate that low temperature stress inhibits Eja-MIR164 The expression, and Eja-MIR164 The decrease was closely related to the increase in lignin content, suggesting that... Eja-MIR164 Negative regulation of lignin biosynthesis in loquat fruit.

[0046] Example 2: Increased lignin content in loquat fruit after transient interference with miR164. The miR164 mentioned in the following examples refers to the mature form Eja-miR164 (SEQ ID NO.5) formed by processing Eja-MIR164 (SEQ ID NO.6).

[0047] 2.1 Carrier construction and bacterial culture preparation The short tandem target simulant STTM164 was constructed according to existing literature methods. Figure 3 The sequence was designed to contain two miR164 binding regions with two 3-base protrusions and a 48-base stem-loop interspacer in the middle. After full gene synthesis, it was constructed into an expression vector and further amplified. The primers were F: CGCTCTAGAACTAGTGGATCCTGC (SEQ ID NO.7) and R: GTCGACGGTATCGATAAGCTTTG (SEQ ID NO.8).

[0048] The cloned product was ligated into the pGreenII 0029 62-SK vector using the ClonExpress II One Step Cloning Kit (Vazyme, China) to silence endogenous miR164. The recombinant plasmid was transformed into Agrobacterium GV3101 strain. The Agrobacterium was resuspended in infection buffer (10 mM MES, 10 mM MgCl2, 150 μM acetylsylcholine, pH 5.6) and the OD was adjusted. 600 It is 0.7.

[0049] 2.2 Transgenic Experiment of Loquat Fruit Fruit thinning was performed on fruiting branches of the 'Da Hong Pao' loquat during its green fruit stage. Two fruits of similar size and maturity were retained on each branch, serving as the control and overexpression treatment groups, respectively.

[0050] Agrobacterium bacterial suspensions containing the SK empty vector and the SK-STTM164 recombinant vector were injected separately into two fruits on the same fruiting branch, with a total of 5 biological replicates. Injection was performed using a disposable 1 mL syringe with a needle, slowly injecting the bacterial suspension 2-5 mm below the fruit stalk until liquid oozes from the entire fruit peel. After injection, the fruits were left on the tree to grow naturally. Samples were taken 7 days later, seeds and outer pericarp were removed, and the samples were immediately flash-frozen in liquid nitrogen and stored at -80°C for later use.

[0051] 2.3 Determination of Lignin Content 0.5g of ground loquat green fruit was weighed and used for lignin determination, using the same method as in Example 1.

[0052] 2.4 RNA extraction, reverse transcription, and quantitative real-time PCR The method is basically the same as that in Example 1.

[0053] The reverse transcription of small RNAs was performed using the miRNA 1st Strand cDNA Synthesis Kit (Vazyme, China) and miRNA-specific stem-loop primers: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGCACG (SEQ ID NO. 9).

[0054] The primers for real-time PCR are as follows: mature form of miR164 F: GCGTGGAGAAGCAGGGCA (SEQ ID NO.10), R: AGTGCAGGGTCCGAGGTATT (SEQ ID NO.11); target genes EjNAC3L , F: AATTTGTGTTCTGTGTTTGTTCACTG (SEQ ID NO.12), R:CACCCAGTTGGTCCTTTCACC (SEQ ID NO.13); Downstream structural genes EjLAC7 , F: TCTCCACGGCTTCGATTTCC (SEQ ID NO. 14), R: TAGATTCTGGCGTCCCTCCA (SEQ ID NO. 15).

[0055] 2.5 Experimental Results Instantaneous injection results showed that four pairs of samples successfully interfered: lines 6, 7, 8, and 9. Compared with the control group, the reduction of miR164 led to its downstream target... EjNAC3L The price was increased by 1.52 to 2.41 times. Meanwhile, EjLAC7 The expression level increased by 1.88 to 3.58 times, which further led to a significant increase in lignin content. Figure 4 ).

[0056] The results confirm that miR164 plays a negative regulatory role in lignin synthesis in loquat fruit.

[0057] Example 3: STTM164 interferes with miR164, thereby promoting the stable transformation of lignin in loquat roots. 3.1 Experimental Materials 'Da Hong Pao' 1-2 year old seedlings were planted in the artificial climate chamber of this laboratory.

[0058] 3.2 Carrier construction and bacterial culture preparation The STTM164 sequence was constructed into the pCambia1300-35S-eGFP vector using primer sequences F: GGGGGACGAGCTCGGTACCAGTGGATCCTGC (SEQ ID NO.16) and R: GCTCACCATGTCGACTCTAGAGATAAGCTTTG (SEQ ID NO.17). The plasmid carrying STTM164-eGFP was transformed into *Agrobacterium rhizogenes* (…). Agrobacterium rhizogenes The K599 strain (Angyu, China) was used, and the specific transformation procedure was followed according to the manufacturer's instructions. Agrobacterium was then resuspended in infection buffer (10 mM MES, 10 mM MgCl2, 150 μM acetylsylgenone, pH 5.6) and the OD was adjusted. 600 It is 0.75.

[0059] 3.3 Method for transforming loquat plants with Agrobacterium rhizogenes Thoroughly mix the above-mentioned bacterial solution with the substrate soil and fill it into transparent air-gel rooting bulbs for later use. Select potted loquat 'Da Hong Pao' seedlings with a stem diameter of 0.5-0.8 cm, and perform girdling treatment at 8-10 cm above the ground, completely removing the phloem and cambium. After the xylem is completely exposed, place the air-gel rooting bulb filled with the bacterial solution substrate onto the girdled area. Transfer the treated loquat seedlings to an artificial climate chamber for cultivation, maintaining an environment of 24-26℃. Water the air-gel rooting bulb every 2 days to keep the substrate moist. After one week of cultivation, add an appropriate amount of the above-mentioned Agrobacterium solution into the bulb. Figure 5 As shown.

[0060] 3.4 Determination of Lignin Content The method is the same as the determination method in Example 1.

[0061] 3.5 PCR positive detection The primers are F: AGCTTTCGCACCATGGACTAC (SEQ ID NO.18), R: ACATCAGGCCGTAGCCGAA (SEQ ID NO.19).

[0062] 3.6 RNA extraction, reverse transcription, and quantitative real-time PCR The method is the same as that in Example 1.

[0063] 3.7 Experimental Results Three to four weeks after transformation, some plants developed white hairy roots, and a large number of hairy roots were generated after six weeks. To verify the effectiveness of genetic transformation, a portable fluorescent protein excitation light source was used to observe the newly formed roots; the roots of some plants showed green fluorescence (…). Figure 6 PCR testing confirmed that the positive root system had two lines, namely line 1 and line 5. Figure 6 ).

[0064] Further gene expression and phenotypic analysis of the positive plants revealed that, compared to the control roots with similar growth status, the miR164 content in the two groups of roots overexpressing STTM164 was significantly reduced, indicating that the interference was successful. Figure 7 A). Downstream target genes EjNAC3L Expression levels were upregulated by 89% and 143% respectively compared to wild type. Figure 7 B) EjLAC7 The expression levels were upregulated by 42% and 28% respectively. Figure 7 C), while the lignin content increased by 27% and 74% respectively. Figure 7 D).

[0065] Since stable transgenic loquat fruit cannot be achieved for the time being, this homologous transformation hairy root system has, to some extent, verified the function of miR164 in negatively regulating lignin synthesis in loquat.

[0066] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Eja-MIR164 Its application in screening loquat plants with reduced lignification is characterized by, The Eja- MIR164 The nucleotide sequence is shown in SEQ ID NO.

6.

2. The application according to claim 1, characterized in that, Said screening is achieved by detecting the expression level of said Eja- MIR164 wherein said expression level is negatively correlated with the lignin content of the loquat fruit.

3. A method for detecting the presence of a target nucleic acid according to claim 1 Eja-MIR164 a real-time fluorescent quantitative PCR primer pair for detecting the expression level, characterized in that, The forward primer of the primer pair contains the nucleotide sequence shown in SEQ ID NO.3, and the reverse primer contains the nucleotide sequence shown in SEQ ID NO.

4.

4. A device for detecting the [device / object] as described in claim 1 Eja-MIR164 The real-time quantitative PCR primer pair encoding the expression level of mature Eja-miR164 is characterized by, The forward primer of the primer pair contains the nucleotide sequence shown in SEQ ID NO.10, and the reverse primer contains the nucleotide sequence shown in SEQ ID NO.

11.

5. A recombinant expression vector, characterized in that, The recombinant expression vector contains components for inhibiting the expression described in claim 1. Eja-MIR164 The nucleic acid sequence of the mature Eja-miR164 contains a GFP fluorescent label, and the recombinant expression vector is the STTM164-eGFP vector.

6. A transformant, characterized in that, The transformant comprises as shown in SEQ ID NO. 6 Eja-MIR164 Nucleic acid molecules or the recombinant expression vector as described in claim 5.

7. The transformant according to claim 6, characterized in that, The transformant is Agrobacterium, transiently transformed loquat cells, or stably transformed loquat cells.

8. The application described in claim 1 Eja-MIR164 The use of the recombinant expression vector of claim 5 or the transformant of claim 6 in any of the following: (a) Preparation of formulations for promoting or inhibiting lignin production in loquat roots or fruits; (b) as a target for screening candidate substances that promote or inhibit lignin production.

9. A method for promoting lignin production in loquat roots or fruits, characterized in that, The method includes reducing the content of Eja-miR164 in loquat.