Stem cells modified with hepatocyte growth factor, methods of making and using the same
By integrating expression cassettes into PSCs and iMSCs, efficient expression and secretion of HGF are achieved, solving the problems of insufficient efficacy and stability in iMSC therapy and significantly improving its therapeutic effect in diseases such as idiopathic pulmonary fibrosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ANHUI ZHONGSHENG TRACEABLE BIOTECHNOLOGY CO LTD
- Filing Date
- 2023-12-01
- Publication Date
- 2026-06-23
AI Technical Summary
Existing therapies based on mesenchymal stem cells (iMSCs) have limitations in terms of effectiveness and functional stability when treating diseases, especially iMSCs derived from PSCs, which have not yet achieved ideal therapeutic effects.
By integrating expression cassettes containing exogenous polynucleotides encoding hepatocyte growth factor (HGF) into the genomes of PSCs and iMSCs, and using homologous recombination technology to integrate them into target loci such as Rosa26, combined with anti-silencing panchromatin open elements (UCOEs) and promoters, efficient expression and extracellular secretion of HGF can be achieved. Furthermore, HGF secretion can be increased through multiple generations of amplification.
The genetically modified PSCs and iMSCs were able to express HGF at high levels, with secretion levels at least 16 times higher than wild-type HGF, enhancing their therapeutic efficacy in treating diseases such as idiopathic pulmonary fibrosis (IPF).
Smart Images

Figure CN122270472A_ABST
Abstract
Description
Technical Field
[0001] This disclosure pertains to the field of stem cell biology, specifically relating to genetically modified stem cells such as pluripotent stem cells (PSCs) and induced mesenchymal stem cells (iMSCs), their production methods, and their applications.
[0002] By referencing and incorporating into the sequence list The sequence list exists as an XML file named 42343WO_sequence list, with a size of 49,785 bytes, created on November 17, 2023, and incorporated into this article by reference. Background Technology
[0003] Mesenchymal stem cells (MSCs) are pluripotent stem cells with self-renewal capabilities. MSCs can differentiate into various cell types, including osteoblasts, chondrocytes, and adipocytes. Furthermore, MSCs possess paracrine functions and promote cell adhesion through their own produced factors. Based on these functions, MSCs exert therapeutic effects by repairing and regenerating target tissues and cells, as well as controlling immune responses, such as anti-inflammation.
[0004] Multiple studies have demonstrated the significant benefits of using MSCs that secrete various paracrine factors in therapeutic applications for diseases such as neurological disorders, inflammation, myocardial ischemia, diabetes, and bone and cartilage diseases. Of particular note are the promising PSC-derived MSCs (iMSCs), as PSCs represent a potentially limitless source of therapeutically active cells. However, further improvements in the efficacy and / or functional stability of iMSCs are needed before iMSC-based therapies become viable.
[0005] Overview According to this disclosure, engineered PSCs and iMSCs modified with HGF at a target locus are provided. Compared to wild-type stem cells, the engineered stem cells disclosed herein can highly express HGF, thereby exhibiting enhanced function. This disclosure also provides cell populations, cell lines, and / or clones of the engineered stem cells disclosed herein.
[0006] In a first aspect, this disclosure relates to a genetically modified pluripotent stem cell (PSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
[0007] In some implementations of this aspect, the target locus is Rosa26.
[0008] In some embodiments of this aspect, the expression box includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
[0009] In some embodiments of this aspect, the expression box further includes an anti-silencing ubiquitous chromatin open element (UCOE), such as the 1550F shown in SEQ ID NO: 1, and the UCOE is operatively connected to the promoter.
[0010] In some implementations of this aspect, the promoter is the EF1a promoter.
[0011] In some implementations of this aspect, the expression box includes a combination of the EF1a promoter and UCOE.
[0012] In some embodiments of this aspect, the expression box further includes a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
[0013] In some embodiments of this aspect, the signal peptide is as shown in SEQ ID NO:20.
[0014] In a second aspect, this disclosure relates to a method for producing genetically modified PSCs, the method comprising: introducing a first construct and a second construct into a PSC, the first construct comprising a site-specific endonuclease capable of introducing a double-strand break at a target locus in the PSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the PSC genome via homologous recombination, thereby obtaining a genetically modified PSC.
[0015] In some implementations of this aspect, the target locus is Rosa26.
[0016] In some embodiments of this aspect, the expression box includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
[0017] In some embodiments of this aspect, the expression box further includes an anti-silencing ubiquitous chromatin open element (UCOE), such as the 1550F shown in SEQ ID NO: 1, and the UCOE is operatively connected to the promoter.
[0018] In some implementations of this aspect, the promoter is the EF1a promoter.
[0019] In some implementations of this aspect, the expression box includes a combination of the EF1a promoter and UCOE.
[0020] In some embodiments of this aspect, the expression box further includes a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
[0021] In some embodiments of this aspect, the signal peptide is as shown in SEQ ID NO:20.
[0022] In some embodiments of this method, the method further includes continuously amplifying the genetically modified PSC for multiple generations, such as at least 4 or 9 generations.
[0023] In a third aspect, this disclosure relates to a genetically modified induced mesenchymal stem cell (iMSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
[0024] In some implementations of this aspect, the target locus is Rosa26.
[0025] In some embodiments of this aspect, the expression box includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
[0026] In some embodiments of this aspect, the expression box further includes an anti-silencing ubiquitous chromatin open element (UCOE), such as the 1550F shown in SEQ ID NO: 1, and the UCOE is operatively connected to the promoter.
[0027] In some implementations of this aspect, the promoter is the EF1a promoter.
[0028] In some implementations of this aspect, the expression box includes a combination of the EF1a promoter and UCOE.
[0029] In some embodiments of this aspect, the expression box further includes a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
[0030] In some embodiments of this aspect, the signal peptide is as shown in SEQ ID NO:20.
[0031] In some embodiments of this aspect, the genetically modified iMSCs secrete HGF at levels up to at least 16 times higher than wild-type iMSCs.
[0032] In a fourth aspect, this disclosure relates to a method for producing genetically modified iMSCs, the method comprising: providing genetically modified PSCs as described in this disclosure; and differentiating the genetically modified PSCs into iMSCs to produce the genetically modified iMSCs.
[0033] In some embodiments of this method, the method further includes continuously amplifying the genetically modified iMSCs for multiple generations, such as at least 4 or 7 generations.
[0034] In a fifth aspect, this disclosure relates to a method for producing genetically modified iMSCs, the method comprising: introducing a first construct and a second construct into iMSCs, the first construct comprising a site-specific endonuclease capable of introducing a double-strand break at a target locus in the iMSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the iMSC genome via homologous recombination, thereby obtaining genetically modified iMSCs.
[0035] In some implementations of this aspect, the target locus is Rosa26.
[0036] In some embodiments of this aspect, the expression box includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
[0037] In some embodiments of this aspect, the expression box further includes an anti-silencing ubiquitous chromatin open element (UCOE), such as the 1550F shown in SEQ ID NO: 1, and the UCOE is operatively connected to the promoter.
[0038] In some implementations of this aspect, the promoter is the EF1a promoter.
[0039] In some implementations of this aspect, the expression box includes a combination of the EF1a promoter and UCOE.
[0040] In some embodiments of this aspect, the expression box further includes a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
[0041] In some embodiments of this aspect, the signal peptide is as shown in SEQ ID NO:20.
[0042] In some embodiments of this method, the method further includes continuously amplifying the genetically modified iMSCs for multiple generations, such as at least 4 or 7 generations.
[0043] In a sixth aspect, this disclosure relates to a pharmaceutical composition comprising a genetically modified iMSC as disclosed herein and a pharmaceutically acceptable vector.
[0044] In a seventh aspect, this disclosure relates to the use of the genetically modified iMSCs disclosed herein in the manufacture of medicaments for the treatment or prevention of idiopathic pulmonary fibrosis (IPF). Attached Figure Description
[0045] Figures 1A-1D. A. Schematic diagram of Antares2 knock-in at the AAVS1 and Rosa26 loci in iPSCs. The upper line shows the target loci, and the lower line shows the donor vector, where the expression cassette for insertion contains the EF1a promoter, Antares2, and Neo (neomycin resistance gene, linked by P2A), with 5' and 3' homologous arms on either side. B. Plasmid map of the Cas template vector used to knock-in Antares2 in iPSCs. C. Plasmid map of the donor vector pKI-Antares2 used to knock-in Antares2 in iPSCs. D. Flow cytometry analysis of Antares2 expression in iPSCs knocked into the AAVS1 and Rosa26 loci. Wild-type iPSCs (WT-iPSCs) were used as controls.
[0046] Figures 2A-2E. A. Plasmid map of the EGFP expression vector pPBml-PNE-EGFP for random integration of iPSCs and iMSCs, which carries the EF1a promoter, which can be replaced by other promoters from the plasmid used in B. B. Plasmid map of the PBase expression vector for random integration of iPSCs and iMSCs, which carries EGFP expression vectors driven by different promoters. C. Representative fluorescence microscopy images of EGFP expression in iMSCs and iPSCs at different days after transfection with piggy-bac vectors containing different promoters. D. Flow cytometry analysis of EGFP expression in iMSCs at different days after transfection with piggy-bac vectors containing different promoters. E. Flow cytometry analysis of EGFP expression in iPSCs at different days after transfection with piggy-bac vectors containing different promoters. In the diagram, E represents the EF1a promoter; UE represents the UCOE-EF1a promoter; C represents the CMV promoter; and UC represents the UCOE-CMV promoter.
[0047] Figures 3A-3C. A. Schematic diagram of Antares2 knock-in at the Rosa26 locus in iPSCs driven by E and UC promoters. The upper line shows the target locus, and the lower line shows the donor vector, where the expression cassette for insertion contains the EF1a promoter or UCOE-CMV promoter, Antares2, and Neo (neomycin resistance gene, linked by P2A), with 5' and 3' homologous arms flanking it. B. Expression levels of Antares2 in engineered iPSCs at different generations (P1, P5, and P10) with E or UC promoters integrated at the Rosa26 locus. Wild-type iPSCs (WT-iPSCs) are used as controls. C. Expression levels of Antares2 in iMSCs derived from engineered iPSCs at different generations (P0 and P4). WT-iPSC, UC-iPSC (iPSC-Rosa26-UC-Antares2) and E-iPSC (iPSC-Rosa26-E-Antares2) were used as controls.
[0048] Figures 4A-4C A. Comparison of the effects of exogenous TPA signal peptide and endogenous signal peptide on HGF protein secretion in transiently transfected iMSCs. B. Schematic diagram of EF1a promoter-HGF gene knock-in at the Rosa26 locus in iPSCs. C. Flow cytometry analysis of HGF expression in WT-iPSCs and engineered E-HGF-iPSCs.
[0049] Figures 5A-5E. A. Representative cell morphology on day 1 (iPSC), day 0 (EB formation), P0, and P2 during the derivatization of iMSCs from engineered E-HGF-iPSCs. B. Flow cytometry analysis of typical MSC surface markers on engineered E-HGF-iMSCs at P2. WT-iPSCs were used as controls. C. Flow cytometry analysis of HGF expression in WT-iPSCs, WT-iMSCs, and engineered E-HGF-iMSCs. D. HGF secretion in iMSCs derived from WT-iPSCs and engineered E-HGF-iPSCs at P1 and P10. E. HGF secretion in WT-iMSCs at P2 and P4, and in engineered E-HGF-iMSCs at P2, P4, and P7.
[0050] Figures 6A-6EA. Timeline of WT-iMSC, E-HGF-iMSC, or saline injection in C57BL / 6N mice after bleomycin administration. B. Lung index analysis of mice in four different groups (n≥6). Error bars represent the standard deviation of different mice undergoing the same process. C. HYP content in the lungs of four different groups (n≥6). Error bars represent the standard deviation of different mice undergoing the same process. D. H&E staining of lung sections from four different groups (n≥6). Scale bar: 200 μm. E. Fibrosis scores of mice in four different groups (n≥6) analyzed based on Masson staining. Error bars represent the standard deviation of different mice undergoing the same process.
[0051] Detailed description This document describes some embodiments only by way of example, in conjunction with the accompanying drawings, so that the various purposes and advantages of the reagents, compositions and methods provided herein will become apparent.
[0052] It should be understood that certain aspects, patterns, implementations, variations and features of this disclosure are described below with varying degrees of detail in order to provide a substantive understanding of the technology.
[0053] The terms “first,” “second,” “third,” “fourth,” “fifth,” “sixth,” “seventh,” “eighth,” or “ninth” used in this specification do not indicate the order or sequence of features, structures (e.g., culture media or compositions) or properties described in connection with the reference, but are used solely for distinguishing purposes.
[0054] The terms "first aspect," "second aspect," "third aspect," "fourth aspect," "fifth aspect," "sixth aspect," "seventh aspect," "eighth aspect," or "ninth aspect" used in this specification refer to a description of a specific feature, structure, or characteristic associated with that aspect that is included in at least one or more aspects of this disclosure. Furthermore, a specific feature, structure, characteristic, or embodiment of one aspect may be combined with specific features, structures, characteristics, or embodiments of one or more other aspects in any suitable manner.
[0055] The terms "an embodiment," "some embodiments," "preferred embodiments," or "certain embodiments" used in this specification refer to specific features, structures, or characteristics described in connection with that embodiment, which are included in at least one or more embodiments of this disclosure. Furthermore, a specific feature, structure, or characteristic of one embodiment may be combined with features, structures, or characteristics of one or more other embodiments in any suitable manner.
[0056] It should be understood that this disclosure is not limited to specific uses, methods, reagents, compounds, compositions, or biological systems, which are of course subject to variation. It should also be understood that the terminology used in this disclosure is for describing particular embodiments only and is not intended to be limiting.
[0057] definition Unless otherwise defined, all technical and scientific terms used herein shall have the meanings commonly understood by one of ordinary skill in the art to which this disclosure pertains. The following references provide general definitions for many of the terms used herein: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd edition, 1994); The Cambridge Dictionary of Science and Technology (Walker, ed., 1988); The Glossary of Genetics, 5th edition, R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, unless otherwise stated, the following terms shall have the meanings assigned to them hereinafter. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of this disclosure.
[0058] Unless otherwise stated, "a" or "a kind" means "one / a kind or a plurality of kinds".
[0059] As used in this article, “about” means plus or minus 10%, or plus or minus 5%, or plus or minus 4%, or plus or minus 3%, or plus or minus 2%, or plus or minus 1%, and a specified number.
[0060] As used herein, the term "comprising / including" is intended to indicate that a composition and method comprises the listed elements, but does not exclude other elements. When used to define a composition and method, "consistently made of" should mean excluding other elements that are of any substantial significance to the composition or method. "Constituted of" should mean excluding other components beyond trace amounts in the claimed composition and substantial method steps. Embodiments defined by these transitional terms are all within the scope of this disclosure. Therefore, methods and compositions may include additional steps and components (comprising / including), or include insignificant steps and compositions (consistently made of), or include only the method steps or compositions (consistently made of). Furthermore, in each embodiment herein, any one of the terms "comprising / including," "consistently made of," and "consistently made of" may be replaced by any of the other two terms.
[0061] As used herein, the term "pluripotent stem cell" (PSC) refers to a cell capable of self-renewing in an undifferentiated state and differentiating into virtually any cell type in the body. Pluripotent stem cells may be pluripotent and, during development, can differentiate into all derivatives of the three primary germ layers (ectoderm, endoderm, and mesoderm). Pluripotent stem cells may be derived from humans (e.g., human PSCs or hPSCs). Pluripotent stem cells may be induced pluripotent stem cells (iPSCs) or embryonic stem cells (ESCs). Pluripotent stem cells may also comprise naive PSCs (NPSCs) and extended pluripotent stem cells (EPSCs). In some embodiments, the pluripotent stem cell is a human induced pluripotent stem cell (hiPSC). ESCs (e.g., hESCs) and iPSCs (e.g., hiPSCs) are known in the art and can be readily obtained using conventional methods, such as those described in the prior art, or commercially available products.
[0062] As used herein, the term "embryonic stem cell" or "ESC" refers to naturally occurring pluripotent stem cells in the inner cell mass of the embryonic blastocyst. Embryonic stem cells are pluripotent, capable of differentiating into all derivatives of the three primary germ layers (ectoderm, endoderm, and mesoderm) during development. They do not participate in the formation of the extraembryonic membranes or placenta, i.e., they are not totipotent. When used in this disclosure, embryonic stem cells or ESCs are derived from commercially available human embryonic stem cell lines or from human embryonic stem cells isolated or obtained from early embryos that have developed in vitro no more than 14 days after fertilization.
[0063] As used herein, the term "induced pluripotent stem cell" or "iPSC" refers to stem cells derived from differentiated adult, neonatal, or fetal cells that have been induced or altered, i.e., reprogrammed to differentiate into tissues of all three germ layers or the dermis (mesoderm, endoderm, and ectoderm). The generated iPSCs do not refer to cells that exist naturally. Suitable methods for generating iPSCs from somatic cells or pluripotent stem cells are well known to those skilled in the art. For example, iPSCs can be reliably generated from somatic cells using conventional reprogramming techniques. For instance, CN108373998B, which describes in detail a method for reprogramming erythrocyte progenitor cells to generate hiPSCs, is the property of the applicant and its disclosure is incorporated herein by reference in its entirety.
[0064] As used herein, the term "pluripotency" or "pluripotency" refers to the developmental potential of a cell to differentiate into cells of all three germ layers (ectoderm, mesoderm, and endoderm). Pluripotency can be at least partially determined by assessing the pluripotency characteristics of a cell. Pluripotency characteristics include, but are not limited to: (i) pluripotent stem cell morphology; (ii) unlimited self-renewal potential; (iii) expression of pluripotent stem cell markers, including but not limited to SSEA1 (mouse only), SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133 / prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30 and / or CD50; (iv) ability to differentiate into all three somatic cell lineages (ectoderm, mesoderm and endoderm); (v) teratoma formation composed of the three somatic cell lineages; and (vi) embryomorphic body formation composed of cells from the three somatic cell lineages.
[0065] As used in this article, the term "pluripotent stem cell morphology" refers to the typical morphological characteristics of embryonic stem cells. Normal embryonic stem cell morphology can be characterized by: small and round size, high nucleoplasm-to-cytoplasm ratio, prominent nucleoli, and / or typical intercellular spaces.
[0066] As used in this article, the term "reprogramming" refers to methods that enhance cell potential or dedifferentiate cells to a less differentiated state. For example, compared to the same cells in an unreprogrammed state, cells with enhanced cell potential can have improved developmental plasticity (i.e., they can differentiate into more cell types). In other words, reprogrammed cells are less differentiated than the same cells in an unreprogrammed state. "Reprogramming" can also refer to dedifferentiating somatic cells or pluripotent stem cells into pluripotent stem cells, also known as induced pluripotent stem cells (iPSCs).
[0067] As used herein, the term “differentiation” refers to the process by which undifferentiated (“undifferentiated”) or poorly differentiated cells acquire the characteristics of specialized cells (e.g., blood cells or immune cells). In some embodiments, differentiated cells or differentiation-inducing cells are cells that occupy a more specialized (“differentiated”) position in a cell lineage. For example, after treatment with appropriate differentiation factors in cell culture, human pluripotent stem cells (hPSCs) can differentiate into a variety of more differentiated cell types, such as neural progenitor cells (e.g., midbrain dopaminergic progenitor cells), mesenchymal stem cells (MSCs), hematopoietic progenitor cells, lymphocytes, cardiomyocytes, immune cells, and other cell types. In some embodiments, the term “directed” is applied to the differentiation process to indicate that a cell has progressed through the differentiation pathway to the point that, under normal circumstances, the cell would differentiate into a specific cell type or subpopulation of cell type and, under normal circumstances, cannot differentiate into other cell types (other than the specific cell type or subpopulation of cell type) nor revert to a less differentiated cell type. The term “differentiation” as used herein is also referred to as “directed differentiation.”
[0068] As used herein, the term “genetically modified” or “genetically modified” means that a cell has been modified to include at least one foreign gene in its genome. In the context of this disclosure, “genetically modified” or “genetically modified” may be used interchangeably with “genetic engineering,” “genetically engineered,” “gene-edited,” or “gene editing.”
[0069] As used herein, the term “genetically modified pluripotent stem cell” or “genetically modified PSC” refers to a pluripotent stem cell that has been modified to include at least one foreign gene in its genome.
[0070] As used herein, the term "mesenchymal stem cell" or "MSC" refers to a self-renewing stem cell capable of differentiating into adipocytes, osteocytes, and chondrocytes. MSCs include primary MSCs and induced MSCs (also known as iMSCs). Examples of primary MSCs include, for instance, bone marrow-derived mesenchymal stem cells (BM-MSCs), placental-derived mesenchymal stem cells (P-MSCs), umbilical cord-derived mesenchymal stem cells (UC-MSCs), adipose-derived mesenchymal stem cells (A-MSCs), peripheral blood-derived mesenchymal stem cells (PB-MSCs), and dental pulp-derived mesenchymal stem cells (DP-MSCs).
[0071] As used herein, the term "induced mesenchymal stem cell" (iMSC) refers to mesenchymal stem cells derived from pluripotent stem cells. iMSCs possess similar morphological, structural (e.g., biomarker) and functional characteristics to primary MSCs. For example, iMSCs have the potential to develop into adipocytes, osteocytes, and chondrocytes and express typical biomarkers such as CD73, CD90, and CD105. iMSCs can be derived from PSCs of any origin. In some embodiments, iMSCs are ESC-derived MSCs. In some embodiments, iMSCs are iPSC-derived MSCs. In some embodiments, iMSCs are NPSC-derived MSCs. In some embodiments, iMSCs are EPSC-derived MSCs. In some embodiments, iPSCs are human iPSCs (hiPSCs). Various methods for preparing iMSCs from iPSCs are known in the art. For example, iMSCs can be prepared from iPSCs according to the method disclosed in CN110592007B, the entire text of which is incorporated herein by reference. In short, the method involves forming embryoid bodies from human pluripotent stem cells; differentiating the embryoid bodies into mesodermal cells; and differentiating the mesodermal cells into mesenchymal stem cells.
[0072] As used herein, the terms “genetically modified induced mesenchymal stem cells” or “genetically modified iMSCs” refer to induced mesenchymal stem cells that have been modified to include at least one exogenous gene in their genome.
[0073] As used in this article, the terms "wild-type iPSC" or "WT iPSC" refer to unmodified iPSCs.
[0074] As used in this article, the term "wild-type iMSC" or "WT iMSC" refers to unmodified iMSCs.
[0075] As used in this article, the term “expression cassette” refers to the complete elements required to express a gene, including an operable promoter and a gene coding sequence.
[0076] As used herein, the term "coding sequence" refers to the portion of a nucleic acid sequence that directly determines the amino acid sequence of its protein product. The boundaries of a coding sequence are typically determined by the ribosome binding site (for prokaryotic cells) immediately upstream of the 5' open reading frame of the mRNA and the transcription termination sequence immediately downstream of the 3' open reading frame of the mRNA.
[0077] As used herein, the term "target gene" or "target polynucleotide" refers to a DNA sequence that, under the control of appropriate regulatory sequences, is transcribed into RNA in vivo and, in some cases, translated into a polypeptide. Target genes or polynucleotides can include, but are not limited to, prokaryotic sequences, cDNA of eukaryotic mRNA, genomic DNA sequences of eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, a target gene can encode mRNA, shRNA, a natural polypeptide (i.e., a polypeptide found in nature) or a fragment thereof; a variant polypeptide (i.e., a mutant of a natural polypeptide with less than 100% sequence identity to the natural polypeptide) or a fragment thereof; engineered polypeptides or peptide fragments, therapeutic peptides or polypeptides, imaging markers, selection markers, etc.
[0078] As used herein, the term "polynucleotide" refers to a polymer of nucleotides of any length, which may be deoxyribonucleotides, ribonucleotides, or analogues thereof. Polynucleotides may include genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides can also refer to both double-stranded and single-stranded molecules.
[0079] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably to refer to a molecule consisting of amino acid residues covalently linked by peptide bonds. A polypeptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids in a polypeptide. As used herein, the term refers to both short chains (also commonly referred to in the art as peptides, oligopeptides, and oligomers) and longer chains (also commonly referred to in the art as polypeptides or proteins). “Polypeptide” includes, for example, especially biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, and fusion proteins. Polypeptides include natural polypeptides, recombinant polypeptides, synthetic polypeptides, or combinations thereof. In the disclosure herein, when the term is used to refer to a sequence, it includes any sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with the sequence referred to.
[0080] As used in this article, the term "hepatocyte growth factor" or "HGF," also known as paracrine factor (SF), refers to a paracrine cell growth, motility, and morphogenesis factor. It is secreted by mesenchymal cells and primarily targets and acts on epithelial and endothelial cells, but also on hematopoietic progenitor cells and T cells.
[0081] As used herein, the term "signal peptide" or "signal sequence" refers to a short peptide chain, typically about 5 to 30 amino acids in length, located at the N-terminus of a protein, that guides the transport of synthesized proteins (e.g., HGF) to the secretory pathway.
[0082] As used herein, the term "exogenous" means the introduction of the molecule or substance or the activity into a host cell. This introduction can be, for example, by introducing the encoding nucleic acid into the host genetic material, such as by integration into the host chromosome, or by introducing it as non-chromosomal genetic material (e.g., a plasmid). Therefore, when the term is used to refer to the expression of the encoding nucleic acid, it means the introduction of the encoding nucleic acid into the cell in an expressible form.
[0083] As used herein, the term "endogenous" refers to molecules, substances, or activities present in the host cell. Similarly, when the term is used to refer to the expression of nucleic acid-coding molecules, it refers to the expression of intracellular, non-exogenously introduced nucleic acid-coding molecules.
[0084] As used herein, the terms "operably linked" or "operatively linked" refer to the binding of nucleic acid sequences to a single nucleic acid fragment such that the function of one nucleic acid sequence is influenced by the function of another. For example, when a promoter can influence the expression of a coding sequence or functional DNA (i.e., the coding sequence or functional DNA is under the transcriptional regulation of the promoter), then the promoter is operatively linked to that coding sequence or functional DNA. The coding sequence can be operatively linked to the regulatory sequence in either a forward or reverse manner.
[0085] "Site-directed integration" or "integration at a target locus" refers to the insertion of exogenous nucleotides of a construct into a predetermined site or integration site in cellular chromosomes or mitochondrial DNA. As used herein, the term "integration" also refers to the process of inserting one or more exogenous sequences or nucleotides into the construct, with or without deletion of endogenous sequences or nucleotides at the integration site. If a deletion exists at the insertion site, "integration" may also include replacing the missing endogenous sequence or nucleotide with one or more inserted nucleotides.
[0086] "Random integration" refers to the insertion of exogenous nucleotides of a construct into any site or integration site in the cell's chromosome or mitochondrial DNA.
[0087] "Stable transfection" refers to the introduction of foreign DNA into the genome of transfected cells.
[0088] "Transient transfection" refers to the introduction of foreign DNA into cells, but the foreign DNA fails to integrate into the genome of the transfected cells. The expression time of unintegrated transgenes is shorter than the time it takes for the gene to be integrated into the genome.
[0089] As used herein, the term “overexpression” refers to an expression level of an expression product (e.g., a peptide or protein) that is higher than the expression level of the same expression product in a comparable host that was not genetically modified before the host cell was genetically modified or under specific conditions.
[0090] As used herein, the term “co-expression” refers to the simultaneous or concurrent expression of at least two or more polynucleotides (nucleic acid molecules, such as genes) in a host cell, cell line, or cell culture in approximately the same or different amounts or ratios.
[0091] As used herein, the term "construct" refers to a macromolecule or molecular complex containing polynucleotides to be delivered to a host cell (in vitro or in vivo). The term "vector" as used herein refers to any nucleic acid construct capable of guiding the delivery or transfer of foreign genetic material to a target cell and its replication and / or expression within that cell. The term "vector" as used herein includes the construct to be delivered. Vectors can be linear or circular molecules. Major types of vectors include, but are not limited to, plasmids, augmentative vectors, viral vectors, granules, and artificial chromosomes. Viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, Sendai virus vectors, etc.
[0092] As used herein, the terms "continuous expansion" or "continuously expanding" refer to the long-term expansion of cells, in which cells undergo multiple passages. In the context of this disclosure, "continuous expansion" may be used interchangeably with "persistent expansion."
[0093] As used in this article, the term “embryomorph” (EB) refers to a three-dimensional cluster that has been shown to mimic embryonic development because it generates numerous lineages within its three-dimensional region.
[0094] As used herein, the term "culture medium" refers to a medium capable of supporting cell survival, growth, proliferation, maintenance, and / or differentiation in an in vitro environment. A culture medium may contain a basal medium and one or more supplements.
[0095] As used in this article, the term "differentiation medium" refers to a culture medium that can support cell differentiation in an in vitro environment.
[0096] As used in this article, the term "in vitro" generally refers to activities that take place outside of an organism.
[0097] As used in this article, the term "in vivo" generally refers to activities that occur inside an organism.
[0098] As used herein, the term "ex vivo" generally refers to activities performed outside of an organism, such as experiments or measurements of living tissue in an artificial environment outside of an organism, preferably with minimal alteration to natural conditions. In specific embodiments, an "ex vivo" process involves removing living cells or tissue from an organism and culturing them in laboratory equipment, typically under sterile conditions, for a period typically of several hours or up to about 24 hours, but may also include up to 48 hours or 72 hours or longer, depending on the specific circumstances. In some embodiments, such tissues or cells may be collected and frozen, and then thawed for ex vivo processing. Tissue culture experiments or processes using living cells or tissues for more than several days are generally considered "in vitro," but in some embodiments, the term may be used interchangeably with "ex vivo."
[0099] As used herein, the term "cell population" or "cell group" refers to a group of at least two cells expressing similar or different phenotypes. In non-limiting examples, a cell population may contain at least about 10, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 10,000, at least about 100,000, or at least about 1 × 10⁻⁶ cells. 6 Cells, at least about 1 × 10 7 Cells, at least about 1 × 10 8 Cells, at least about 1 × 10 9 Cells, at least about 1 × 10 10 Cells, at least about 1 × 10 11 Cells, at least about 1 × 10 12 Cells, or more cells expressing similar or different phenotypes.
[0100] As used herein, the term "effective dose" refers to a dose of medicine sufficient to achieve a beneficial or intended effect after administration. The amount of medicine administered to a subject may depend on individual characteristics such as general health status, age, sex, weight, effective concentration of the cells administered (e.g., iMSCs), and tolerance to the drug. Those skilled in the art can determine an appropriate dose based on these and other factors. Effective doses may be administered in a single or multiple-dose manner.
[0101] As used herein, the term "administration" to give a drug to a subject includes any route by which a drug is introduced into or delivered to a subject to exert its intended effect. Administration can be performed via any suitable route, including but not limited to intravenous, intramuscular, intraperitoneal, subcutaneous, and other suitable routes described herein. Administration includes self-administration and administration by another person.
[0102] As used herein, the terms “subject,” “individual,” or “patient” are used interchangeably to refer to an individual organism, vertebrate, or mammal, which may include humans, non-human primates, rodents, etc. (e.g., a recipient of a specific medical intervention, or a cell collector). In some implementations, the individual, patient, or subject is a human.
[0103] As used herein, the term "treatment" refers to a clinical intervention aimed at reversing, alleviating, delaying the onset or progression of a disease, condition, and / or symptom, or one or more symptoms thereof, improving its severity, preventing or delaying its recurrence, and / or improving one or more symptoms of the disease, condition, and / or symptom described herein. Treatment, for example, in the form of iMSCs or iMSCs clusters described herein, may be given to a subject after the onset of one or more symptoms and / or after a diagnosis of the disease. Treatment may be given in the absence of symptoms, for example, to prevent or delay the onset of symptoms, or to inhibit the onset or progression of the disease. For example, treatment may be given to a susceptible individual before the onset of symptoms (e.g., taking into account genetic or other susceptibility factors). Treatment may also continue after symptom relief, for example, to prevent or delay recurrence. Treatment may improve and / or alleviate one or more symptoms of a disease, condition, and / or symptom.
[0104] As used in this article, the terms “prevention” and “avoidance” refer to reducing the likelihood that a subject who does not have but is at risk of developing or being susceptible to a disease, condition, or symptom will develop a disease, condition, or symptom.
[0105] Genetically modified cells On one hand, this disclosure provides a genetically modified pluripotent stem cell (PSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF). Compared to WT stem cells, the resulting engineered stem cells are able to overexpress HGF, thereby exhibiting enhanced function. Furthermore, this gene-editing strategy overcomes current obstacles to the engineering of primary MSCs from peripheral blood, umbilical cord blood, or any other donor tissue, as the supply of such cells is limited and difficult to engineer, and the engineering of such cells typically lacks reproducibility and uniformity.
[0106] On the other hand, a genetically modified induced mesenchymal stem cell (iMSC) is provided, comprising an expression cassette integrated into its genome at a target locus, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
[0107] Genome editing, also known as genome editing or gene editing (these terms are used interchangeably), is a genetic engineering technique that inserts, deletes, and / or replaces DNA in the genome of a target cell. Site-specific genome editing (which can be used interchangeably with "site-specific genome editing" or "site-specific gene modification") allows for the insertion, deletion, and / or replacement of DNA at predetermined sites in the genome. During site-specific editing, when an endogenous sequence is inserted, deleted, and / or replaced at a predetermined site, the endogenous gene containing the affected sequence (e.g., Rosa26) can be knocked out or knocked down. Therefore, site-specific editing can also be used to disrupt the expression of endogenous genes.
[0108] The term "site-directed integration," used similarly in this article, refers to the insertion of one or more exogenous sequences at the insertion site, with or without the deletion of endogenous sequences. In contrast, random integration or gene editing (e.g., using transposon systems) is susceptible to positional effects and silencing, leading to unreliable and unpredictable expression. Furthermore, random integration may activate proto-oncogenes, raising safety concerns.
[0109] locus Non-limiting examples of loci for site-specific HGF integration in this disclosure include Rosa26, AAVS1, and housekeeping loci such as GAPDH. In some embodiments, the target locus includes Rosa26, AAVS1, and / or the housekeeping locus. In some embodiments, the target locus includes Rosa26, AAVS1, and / or GAPDH. In some embodiments, the target locus is Rosa26 and / or AAVS1. In some embodiments, the target locus is Rosa26.
[0110] ROSA26 is a constitutive, ubiquitous gene locus in mice. It was initially isolated in gene trap mutagenesis screening of embryonic stem cells (ESCs) (e.g., see Friedrich, G; Soriano, P (1991). “Promoter traps in embryonic stem cells: a gene screening method for identifying and mutating developmental genes in mice” Genes & Development. 5(9): 1513–23). The human ROSA26 locus has been identified (Irion, Stefan; Luche, Hervé; Gadue, Paul; Fehling, Hans Joerg; Kennedy, Marion; Keller, Gordon (2007). “Identification and targeting of the ROSA26 locus in human embryonic stem cells”. Nature Biotechnology. 25(12): 1477–82). ROSA stands for inverse splice acceptor and is named after lentiviral gene capture vectors. More detailed information about ROSA26 can be found in the NCBI database, the full text of which is incorporated herein by reference. Target sequences for the Rosa26 locus can be selected from Chr3:9432781.. 9440914.
[0111] Adeno-associated virus integration site 1 (AAVS1) is a viral integration site encoded in humans by the AAVS1 gene located on chromosome 19 (see, for example, Ward et al., Virology. Nov 25, 2012; 433(2): 356-66. doi: 10.1016 / j. virol. 2012.08.015. Epub Sep 13, 2012; and Kotin et al., EMBO J. Dec 1992; 11(13): 5071-8. doi: 10.1002 / j. 1460-2075.1992.tb05614.x.). Further details about the AAVS1 locus are available in the NCBI database, which is incorporated herein by reference in its entirety. The target sequence for the AAVS1 locus can be selected from GenBank: AC010327.8 (7774..11429).
[0112] According to this disclosure, gene-edited loci can affect the expression levels of transgenes such as HGF. This disclosure uniquely finds that site-specific integration of the HGF gene at the Rosa 26 locus produces engineered PSC and iMSC cells with significantly higher HGF (SEQ ID NO: 21) expression levels compared to integration at other loci (e.g., AAVS1). The Rosa 26 locus is believed to be more readily transcribed and less susceptible to epigenetic silencing in stem cells. As described herein, gene modification at the Rosa 26 locus has no significant effect on HGF expression levels in either PSC cells or ultimately differentiated cells (e.g., iMSCs).
[0113] In some implementations, the expression cassette in the engineered PSCs and iMSCs contains a promoter operatively linked to a foreign polynucleotide encoding HGF. This promoter is part of a gene, typically located upstream of the 5' end of a structural gene, and is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription. Any suitable promoter can be used in the genetically modified PSCs and iMSCs described herein. Suitable promoters include, but are not limited to, cytomegalovirus (CMV) promoters. This is a strongly constitutive promoter capable of driving high levels of expression of any polynucleotide sequence operatively linked to it. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other promoters may also be used, including, but not limited to, ubiquitin C (UBC) promoters, phosphoglycerate kinase (PGK) promoters, CMV early enhancer / chicken β-actin (CAG) promoters, and CpG-free promoters (CLP) promoters. Furthermore, the use of any promoter or variants derived from the above promoters is contemplated. This disclosure includes modified nucleotide sequences obtained by replacing, deleting, and / or adding one or more bases compared to the promoter sequences described above, wherein the modification still preserves the biological function of the promoter for efficient expression in engineered cells. In some embodiments, this disclosure includes sequences having at least 95%, at least 97%, or at least 99% sequence identity with any of the promoter sequences described above, and having the biological function for expression in engineered cells. In some embodiments, the promoter is selected from EF1a, PGK, CAG, CMV, CLP, and UBC. In some embodiments, the promoter is selected from the EF1a promoter, the CMV promoter, or the CLP promoter.
[0114] Transgenes in engineered cells are susceptible to epigenetic silencing during persistent cell expansion. Among all factors influencing epigenetic silencing, the specific promoter used is crucial. In some embodiments, the promoter is selected from the EF1a promoter. Of all the promoters tested, the EF1a promoter achieved the highest and most stable HGF expression during persistent expansion of engineered cells. Therefore, engineered stem cells can stably maintain high HGF expression during their persistent expansion (e.g., expansion to at least 2, 4, 6, 8, or 10 generations), enabling the continuous large-scale production of homogeneous engineered stem cells suitable for clinical applications.
[0115] In some embodiments, transgene silencing in engineered stem cells during persistent expansion can be rescued by introducing a panchromatin open element (UCOE) upstream of the promoter. Therefore, in some embodiments, the expression cassette of this disclosure also includes a panchromatin open element (UCOE) operatively linked to the promoter. In some embodiments, the expression cassette includes a combination of the EF1a promoter and a UCOE.
[0116] In some embodiments, examples of UCOE include, but are not limited to, 1550F (SEQ ID NO: 1), 1550R (SEQ ID NO: 14), 1194F (SEQ ID NO: 15), 1194R (SEQ ID NO: 16), and SRF6-3F (SEQ ID NO: 17). In some embodiments, UCOE comprises 1550F, 1550R, and SRF6-3F. In some embodiments, UCOE comprises 1550F.
[0117] In some embodiments, the expression cassette includes an optional marker gene. In some embodiments, the expression cassette does not include an optional marker gene. Available optional marker genes include, for example, antibiotic resistance genes, such as kanamycin (Kan), neomycin (Neo), tetracycline (Ter), chloramphenicol (Cam), etc.
[0118] When an expression cassette contains a selectable marker gene, it can be linked to an exogenous polynucleotide via an adapter. Adapters include, but are not limited to, IRES, F2A, E2A, P2A, and T2A.
[0119] The engineered stem cells disclosed herein may also contain one or more other genetic modifications, depending on the application or purpose of the cells. In addition to HGF, the engineered stem cells disclosed herein may also express one or more other exogenous proteins or peptides. In some embodiments, other genetic modifications include knocking out or knocking down additional endogenous genes. In some embodiments, other genetic modifications include knocking in additional exogenous genes. Examples of knock-in additional exogenous genes include the ACE2, IL21, GLP, IL22, and CTLA4 genes.
[0120] In some embodiments, the engineered stem cells disclosed herein further comprise one or more additional exogenous target polynucleotides integrated into a target locus. These additional exogenous target polynucleotides may be integrated into the same target locus as HGF site-directed integration, or they may be different. In some embodiments, the engineered stem cells disclosed herein further comprise one or more additional exogenous target polynucleotides integrated into the Rosa26 locus. In some embodiments, the engineered stem cells disclosed herein further comprise one or more additional exogenous target polynucleotides integrated into one or more loci other than Rosa26. Examples of loci other than Rosa26 include AAVS1 and housekeeping gene loci, such as GAPDH.
[0121] One or more exogenous target polynucleotides can be co-expressed. For example, the expression cassette described herein may contain an exogenous polynucleotide encoding HGF and one or more additional exogenous target polynucleotides. These exogenous target polynucleotides can be interconnected via adapters. In some embodiments, the adapter encodes a self-cleaving peptide. Examples of adapters include, but are not limited to, internal ribosome entry sequences (IRES) or 2A self-cleaving peptides. Examples of 2A self-cleaving peptides include, but are not limited to, F2A, E2A, P2A, and T2A.
[0122] When an expression cassette contains two or more exogenous polynucleotides, all exogenous polynucleotides can be driven by a common promoter or by different promoters. When an expression cassette contains different promoters, different or identical UCOE elements can be operatively linked to these promoters respectively.
[0123] In some implementations, the expression cassette also includes other regulatory sequences for gene expression. Examples of regulatory sequences include, but are not limited to, enhancers, poly(A) tail signal sequences, etc.
[0124] An enhancer is a DNA sequence that increases the transcription frequency of the gene it is linked to. Enhancers increase the transcription of downstream genes through promoters. Effective enhancers can be located at the 5' end or 3' end of a gene, and some can even be located within introns. Examples of enhancers include, but are not limited to, CMV enhancers, SV40 enhancers, HPV16 LCR enhancers, immunoglobulin heavy chain enhancers, HACNS1 enhancers, GADD45G enhancers, hormone response elements (HREs), and metal-regulated enhancer elements (MREs).
[0125] In some embodiments, the expression cassette further comprises a polynucleotide encoding a signal peptide (SP) for guiding the extracellular secretion of HGF. This signal peptide can be endogenous or exogenous. In some embodiments, the endogenous signal peptide is as shown in SEQ ID NO:20. In some embodiments, the exogenous signal peptide is selected from SIRP, C2, TPA, IFNG, or TNF signal peptides. Engineered stem cells using endogenous signal peptides can exhibit higher HGF secretion levels compared to stem cells using exogenous signal peptides.
[0126] In some embodiments, the genetically modified iMSCs secrete HGF at levels up to at least 16 times (e.g., 16, 18, 20, or 22 times) higher than wild-type iMSCs. In some embodiments, the genetically modified iMSCs secrete HGF at levels up to at least 24 times (e.g., 24, 26, 28, or 30 times) higher than wild-type iMSCs.
[0127] Methods for producing genetically modified cells This disclosure also relates to methods and compositions for producing the genetically modified PSCs and iMSCs described herein.
[0128] In another aspect, this disclosure provides a method for producing genetically modified PSCs, the method comprising: introducing a first construct and a second construct into a PSC, the first construct comprising a site-specific endonuclease capable of introducing a double-strand break at a target locus in the PSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located flanking the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the PSC genome via homologous recombination, thereby obtaining a genetically modified PSC.
[0129] In another aspect, this disclosure provides a method for producing genetically modified iMSCs, the method comprising: providing genetically modified PSCs as described herein; and differentiating the genetically modified PSCs into iMSCs, thereby producing genetically modified iMSCs.
[0130] In another aspect, this disclosure provides a method for producing genetically modified iMSCs, the method comprising: introducing a first construct and a second construct into iMSCs, the first construct comprising a site-specific endonuclease capable of introducing double-strand breaks at a target locus in the iMSC genome, the second construct comprising an expression cassette containing an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located on either side of the expression cassette, such that the expression cassette in the second construct is integrated into the target locus in the iMSC genome via homologous recombination, thereby obtaining genetically modified iMSCs.
[0131] In some implementations, the target locus is Rosa26 and / or AAVS1. In some implementations, the target locus is Rosa26.
[0132] Any PSC can be used in this method. PSCs include embryonic stem cells (ESCs) and / or induced pluripotent stem cells (iPSCs). iPSCs are preferred because they represent an unlimited source of cells for cell therapy. ESCs (e.g., hESCs) and iPSCs (e.g., hiPSCs) are known in the art and can be readily obtained using conventional methods (e.g., methods described in the prior art or commercially available products). For example, the CytoTune iPS 2.0 Sendai Virus Reprogramming Kit (Thermo Fisher Scientific) can be used to reliably generate induced pluripotent stem cells (iPSCs) from somatic cells, including PBMCs and T cells. In some embodiments, hiPSCs are prepared according to the protocol described in CN108373998B, the entire contents of which are incorporated herein by reference.
[0133] In genetic engineering, vectors are commonly used to deliver target genes into cells. In this method, a first construct is introduced using a tool vector containing a site-specific endonuclease capable of introducing double-strand breaks (DSBs), and a second construct is introduced using a donor vector containing an expression cassette encoding an exogenous polynucleotide encoding HGF. In some embodiments, the construct is a vector. Vectors used herein generally include, but are not limited to, plasmids, bacteriophages, animal viruses, and granules. Vectors can be expression vectors, including eukaryotic expression vectors and viral expression vectors. Eukaryotic expression vectors are preferred. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. In this disclosure, any suitable vector (including well-known vectors) can be used to deliver the first and second constructs. Techniques for constructing recombinant vectors are common to those skilled in the art of genetic engineering.
[0134] In the donor vector, the expression cassette includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from EF1a, PGK, CAG, CMV, CLP, and UBC. In some embodiments, the expression cassette further includes an anti-silencing panchromatin open element (UCOE), such as 1550F as shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter. In some embodiments, the promoter is an EF1a promoter. In some embodiments, the expression cassette includes a combination of an EF1a promoter and a UCOE. In some embodiments, the expression cassette further includes a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF. In some embodiments, the signal peptide is as shown in SEQ ID NO: 20. Other elements in the expression cassette of the donor vector have been described elsewhere, and their description is omitted herein for simplicity.
[0135] As tools for site-directed integration as described in this article, available endonucleases capable of introducing DSB include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-Cas nucleases.
[0136] In some embodiments, endonucleases capable of introducing double-strand breaks include zinc finger nucleases (ZFNs). Those skilled in the art know that ZFNs are targeted endonucleases whose nucleases are fused to a zinc finger DNA-binding domain. A zinc finger is a domain of approximately 30 amino acids within the zinc finger binding domain, its structure stabilized by coordination with zinc ions. Examples of zinc fingers include, but are not limited to, C2H2 zinc fingers, C3H zinc fingers, and C4 zinc fingers. An example of a ZFN is a fusion polypeptide of the FokI nuclease domain and the zinc finger DNA-binding domain.
[0137] In some implementations, endonucleases capable of introducing double-strand breaks include TALENs. TALENs are targeted endonucleases that have a nuclease fused to a TAL effector DNA-binding domain. TAL effector proteins are secreted by plant pathogens of the genus *Xanthomonas* during infection. These proteins enter the plant cell nucleus, bind effector-specific DNA sequences through their DNA-binding domains, and activate gene transcription of these sequences through their transactivation domains. The specificity of the TAL effector DNA-binding domain depends on a variable number of incomplete 34-amino acid repeat sequences of the effector, which contain polymorphisms at selected repeat positions, known as variable double residue repeats (RVDs). An example of a TALEN is a fusion polypeptide of the FokI nuclease domain and the TAL effector DNA-binding domain.
[0138] In some implementations, endonucleases capable of introducing double-strand breaks include CRISPR-Cas nucleases. The CRISPR / Cas system is a powerful gene-editing tool that can selectively modify DNA sequences at any specific location in the cellular genome. CRISPR-Cas systems are divided into two main classes and six main types. One example of a CRISPR / Cas system is the CRISPR / Cas9 system. The CRISPR-Cas9 system is based on the nucleolytic activity of the endonuclease protein Cas9, which reaches the desired site in the genome under the guidance of specific determinant RNAs called guide RNAs (gRNAs). In addition, the CRISPR / Cas9 system recognizes another sequence located near the target locus, called the protospacer adjacent motif (PAM), which is crucial for Cas9 function. The Cas9 protein binds to the target locus with high precision in the presence of gRNA and causes a double-strand break at the cleavage site. Using a pre-designed repair template, the desired gene knock-in is achieved through homology-directed repair (HDR).
[0139] Transfection vectors, such as donor vectors or tool vectors, are common techniques to those skilled in the art. Examples of transfection methods include electroporation, calcium phosphate coprecipitation, liposome transfection, and gene gun bombardment.
[0140] In some embodiments, according to this disclosure, the method for producing genetically modified PSCs further includes amplifying the genetically modified PSCs. In some embodiments, the method further includes continuously amplifying the genetically modified PSCs for multiple generations. This allows for the continuous, large-scale production of consistent engineered PSC cells with stable, high HGF expression.
[0141] In some embodiments, the sustained amplification of genetically modified PSCs includes amplifying the genetically modified PSCs for at least 2, 3, or 4 generations. In some embodiments, the sustained amplification of genetically modified PSCs includes amplifying the genetically modified PSCs for at least 5, 6, or 7 generations. In some embodiments, the sustained amplification of genetically modified PSCs includes amplifying the genetically modified PSC1 for at least 8, 9, or 10 generations. Techniques for amplifying or sustaining the amplification of PSCs are conventional in the art. For example, engineered PSCs can be cultured and amplified in commonly used amplification media for wild-type PSCs. Any other suitable amplification media may also be used herein. Examples of the amplification media mentioned above include E8 medium and ncEpic medium.
[0142] In some embodiments, according to this disclosure, the method for producing genetically modified iMSCs further includes amplifying the genetically modified iMSCs. In some embodiments, the method further includes continuously amplifying the genetically modified iMSCs for multiple generations. This allows for the continuous, large-scale production of consistent engineered iMSCs with stable high HGF expression.
[0143] In some embodiments, the sustained amplification of genetically modified iMSCs includes amplifying the genetically modified iMSCs for at least 2, 3, or 4 generations. In some embodiments, the sustained amplification of genetically modified iMSCs includes amplifying the genetically modified iMSCs for at least 5, 6, or 7 generations. Techniques for amplifying or sustaining the amplification of iMSCs are conventional in the art. For example, engineered iMSCs can be cultured and amplified in commonly used amplification media for wild-type iMSCs or primary MSCs. Any other suitable amplification media may also be used herein. Examples of amplification media include Mesencult-XF medium (Stem cell), StemPro MSCSFM Xeno-Free medium (Invirogen), MSCGM-CD medium (Lonza), and M5 medium (Anhui ZhongSheng Suyuan Biotechnology Co., Ltd.).
[0144] Composition This disclosure also provides cell populations or compositions comprising the genetically modified PSCs or iMSCs disclosed herein.
[0145] This document also provides a pharmaceutical composition comprising the genetically modified iMSCs described herein and a pharmaceutically acceptable carrier. The effective amount of cells in a pharmaceutical composition for treating a specific disease or condition depends on the nature of the disease or condition and can be determined using standard clinical techniques. The pharmaceutical compositions, cell compositions, or cell populations disclosed herein can be administered before, during, and / or after the onset of a disease, disorder, and / or condition.
[0146] Pharmaceutically acceptable carriers are well known in the art. Exemplary pharmaceutically acceptable carriers are sterile aqueous solutions that contain no substances other than the active ingredient and water, or buffers containing physiological pH values such as sodium phosphate, physiological saline, or a combination of both, such as phosphate-buffered saline. Furthermore, aqueous carriers may contain more than one buffer salt, as well as salts such as sodium chloride and potassium chloride, glucose, and other solutes. Non-limiting examples of such pharmaceutically acceptable carriers include multi-electrolyte injections and dextran injections.
[0147] application This article also provides the use of the genetically modified PSCs or iMSCs disclosed herein in the preparation of drugs for the treatment or prevention of diseases such as neurological disorders, ischemic heart disease, bone and cartilage diseases, idiopathic pulmonary fibrosis (IPF), inflammation such as endometrial damage or vascular diseases, diabetes or autoimmune diseases.
[0148] Specifically, the genetically modified iMSCs disclosed herein offer improved efficacy against idiopathic pulmonary fibrosis (IPF). Therefore, this disclosure also provides the use of the genetically modified iMSCs disclosed herein in the preparation of medicaments for the treatment or prevention of IPF. This disclosure also provides a method for treating or preventing IPF, comprising administering any of the genetically modified iMSCs described herein, or a cell population or pharmaceutical composition thereof, to a subject in need.
[0149] General Method In practicing the contents of this disclosure, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology, and recombinant DNA were used. See, for example, Sambrook and Russell (eds.), Molecular Cloning: A Laboratory Manual, 3rd Edition; Ausubel et al. (eds.), Experimental Methods in Molecular Biology, 2007; Enzyme Methods Series (Academic Press, Inc., NY); MacPherson et al. (eds.), PCR 1: A Practical Approach (Oxford University Press, IRL); MacPherson et al. (eds.), PCR 2: A Practical Approach (1995); Harlow and Lane (eds.), Antibodies, A Laboratory Manual (1999); Freshney (2005), Animal Cell Culture: A Basic Technique Manual, 5th Edition; Gait (ed.), Oligonucleotide Synthesis (1984); US Patent No. 4,683,195; Hames and Higgins (eds.), Nucleic Acid Hybridization (1984); Anderson (1999), Nucleic Acid Hybridization; Hames and Higgins (eds.), Transcription and Translation; Immobilized Cells and Enzymes (IRL). Press (1986); Perbal (1984) Practical Guide to Molecular Cloning; Miller and Calos (eds.) (1987) Gene Transfer Vectors in Mammalian Cells (Cold Spring Harbor Laboratory); Makrides (ed.) (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker (eds.) (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. (eds.) (1996) Weir Handbook of Experimental Immunology. Example
[0150] Material All reagents and instruments used in all embodiments of this disclosure are commercially available.
[0151] Example 1: Optimal selection of loci for iPSC engineering through site-specific integration.
[0152] Experimental procedure: Human iPSCs (hiPSC cells) were prepared according to the protocols described in Examples 3 and 4 of CN108373998B. The hiPSCs were cultured and amplified for 4 days on a glass-coated culture surface in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.). Then, the hiPSCs were engineered to express Antares2 at the AAVS1 and Rosa26 loci, respectively. All procedures were identical except for the target loci. The following steps describe in detail the specific details of knocking in Antares2 (SEQ ID NO: 3) at the Rosa26 and AAVS1 loci. Figure 1A ).
[0153] The U6 promoter-gRNA-Rosa26-gRNA chimeric fragment (SEQ ID NO: 4) and the U6 promoter-gRNA-AAVS1-gRNA chimeric fragment (SEQ ID NO: 5) were synthesized by Genscript Biotech Inc. (China). The synthesized U6 promoter-gRNA-Rosa26-gRNA chimeric fragment or U6 promoter-gRNA-AAVS1-gRNA chimeric fragment was inserted into the Cas-Template vector after double digestion at 37°C for 1-2 hours. Figure 1B The KpnI / EcoRI site of the DNA gel was extracted using a DNA gel extraction kit (TIANGEN, DP209) according to the manufacturer's instructions, and the product was ligated using T4 ligase (NEB, M0202) according to the manufacturer's instructions to construct the Cas / gRNA vector. The Cas / gRNA vector and gRNA sequences used are shown in Table 1 below.
[0154] Table 1 Cas / gRNA vector Construct chromosome Exons Target sequence PAM pCas-gRNA-Rosa26 gRNA-Rosa26 3 N / A GGCGATGACGAGATCACCGCG (SEQ ID NO: 18) AGG pCas-gRNA-AAVS1 gRNA-AAVS1 19 N / A GTCCCTAGTGGCCCCACTGT (SEQ ID NO: 19) GGG
[0155] The 5'- and 3'-homologous arms were synthesized by Genscript Biotech Inc. (China). After double digestion at 37°C for 1-2 hours, the synthesized homologous arms were inserted into the pKI-Antares2 vector. Figure 1CThe NheI / ClaI and EcoRI / BamHI loci of Anhui ZhongSheng Suyuan Biotechnology Co., Ltd. were extracted using a DNA gel extraction kit (TIANGEN, DP209) according to the manufacturer's instructions, and the products were ligated using T4 ligase (NEB, M0202) according to the manufacturer's instructions to construct donor vectors. The homologous arms of each locus and the donor vectors are shown in Table 2 below.
[0156] Table 2 donor carrier 5'-Homologous Arm 3'-Homologous Arm Target locus pKI-Antares2-Rosa26 SEQ ID NO: 6 SEQ ID NO: 7 Rosa26 pKI-Antares2-AAVS1 SEQ ID NO: 8 SEQ ID NO: 9 AAVS1
[0157] To knock Antares2 into iPSCs, 2 × 10⁶ cells were transfected with Nucleofector 2b (Lonza Inc.) using 2 μg donor vector and 2 μg Cas / gRNA vector. 6 2 × 10hiPSC cells. The transfected hiPSC cells were then cultured at a rate of 2 × 10-. 4 HiPSCs were seeded at a density of [number] cells / cm² in six-well plates and selected with 100 ng / mL genimycin for 1-2 days. After 5-7 days of culture, hiPSC single clones were picked and transferred to 48-well plates for further culture, followed by further amplification in six-well plates using ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.) to obtain a sufficient number of cells for further selection. HiPSCs from single clones were collected, dissociated into individual cells, and Antares2 expression was analyzed by flow cytometry.
[0158] The Antares2 sequence was correctly inserted into the positive clone at the selected locus. Further confirmation was made using nested PCR assays with Platinum® Pfx DNA polymerase (Thermo Fisher Scientific) according to the manual instructions, and sequencing was performed by Beijing Qingke Biotechnology Co., Ltd. (China).
[0159] Positive clones with correct insertion were subjected to karyotype analysis by KingMed Diagnostics (China) to rule out chromosomal abnormalities. Flow cytometry was used to analyze the expression of Antares2 in representative double-knockin hiPSCs. Figure 1D ).
[0160] In the above assays, wild-type iPSCs (hereinafter referred to as WT-iPSCs) were used as controls. As shown in Figure 1D, the expression level of Antares2 in engineered iPSCs integrated with the Rosa26 or AAVS1 locus was significantly higher than that in WT-iPSCs. Furthermore, the expression level of Antares2 integrated with the Rosa26 locus was significantly better than that with the AAVS1 locus, indicating that the Rosa26 locus is more readily transcribed in iPSC cells. These examples demonstrate that site-specific integration into iPSCs can achieve high levels of HGF expression, and that the Rosa26 locus is superior to the AAVS1 locus in both iPSC engineering and subsequent iMSC engineering.
[0161] Example 2: Random integration of pre-selected promoters for iPSC and iMSC engineering.
[0162] Experimental procedure: Using the pPBml-PNE-EGFP vector ( Figure 2A Anhui ZhongSheng Suyuan Biotechnology Co., Ltd. was used as the EGFP expression vector. This vector carries the EF1a promoter (SEQ ID NO: 13). A 1550F UCOE element (SEQ ID NO: 1) and a CMV promoter (SEQ ID NO: 2) were synthesized by Genscript Biotech Co., Ltd. (China). Following the manufacturer's instructions, the 1550F UCOE element was inserted into the NotI / ClaI site of the pPBml-PNE-EGFP vector using T4 ligase (NEB M0202). The CMV promoter was then ligated to the ClaI / XbaI site of the pPBml-PNE-EGFP vector.
[0163] hiPSCs were prepared according to the protocols described in Examples 3 and 4 of CN108373998B. The hiPSCs were cultured and amplified for 4 days on a glass-coated surface in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.). For hiPSC transfection, hiPSCs were isolated using TrypLE treatment, and 2 × 10⁻⁶ nuclear transfections (Nucleofector 2b, Lonza Inc.) were used for each transfection. 6 1 hiPSCs and 2 μg of PBase expression vector ( Figure 2B The cells were transfected with 2 μg of EGFP expression vector (from Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.). On day 1 post-transfection, cells with stable vector integration were screened using genimycin (100 μg / mL).
[0164] Following the methods described in Examples 1, 3, and 4 of patent CN110592007B, iMSCs were differentiated from hiPSCs. The iMSCs were cultured and expanded in amplification medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5). iMSC transfection: iMSC cells were isolated using TrypLE treatment, with 1×10⁻⁶ cells used for each nuclear transfection. 6 One iMSC was transfected with 2 μg of PBase expression vector and 2 μg of EGFP expression vector. On day 1 post-transfection, cells with stable vector integration were screened using genimycin (100 μg / mL). EGFP expression in hiPSCs and iMSCs was observed by fluorescence microscopy at different post-transfection days (Figure 2C), and EGFP expression in hiPSCs and iMSCs was measured by flow cytometry at different post-transfection days. Figure 2D and 2E ).
[0165] To identify the optimal promoter for achieving high-level transgene expression during long-term iMSC culture, the EF1α(E) promoter, the CMV(C) promoter, and their combinations with anti-silencing panchromatin open elements (UCOE) (UCOE-EF1a(UE) and UCOE-CMV(UC)) were tested as described above. Figure 2C-2E The results showed that during long-term culture, EGFP expression in iMSCs using the E promoter was more uniform and at higher levels than that using the UE promoter. Conversely, during long-term culture, EGFP expression in iMSCs using the UC promoter was more uniform and stable than that using the C promoter. Unlike iMSCs, iPSCs showed higher EGFP expression during long-term culture using both the E and UE promoters, and although iPSCs exhibited good EGFP expression on day 1 using both the C and UC promoters, EGFP was efficiently silenced during long-term culture. As potential effective drivers of transgene expression in iMSCs during long-term culture, the E and UC promoters were selected for further testing in the engineering of iPSCs and iMSCs at the Rosa26 locus.
[0166] Example 3: Comparison of E and UC promoter activities in engineered iPSC and iMSC cells with site-directed integration at the Rosa26 locus during persistent expansion.
[0167] Experimental procedure: hiPSCs were prepared according to the protocols described in Examples 3 and 4 of CN108373998B. The hiPSCs were cultured and amplified in ncEpic medium (Anhui Zhong Sheng Suyuan Biotechnology Co., Ltd.) for 4 days. Similar to the method described in Example 1, Antares2, driven by the EF1a and UCOE-CMV promoters, was knocked into the Rosa26 locus in the hiPSCs. Except for the promoter, the rest of the process was the same. Figure 3A HiPSCs engineered using the EF1a and UCOE-CMV promoters were named iPSC-Rosa26-E-Antares2 and iPSC-Rosa26-UC-Antares2, respectively. The confirmed first-generation engineered iPSCs were designated "P1" (Passage 1). P1 iPSC-Rosa26-E-Antares2 cells were expanded and passaged 9 times in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.), and P1 iPSC-Rosa26-UC-Antares2 cells were expanded and passaged 4 times in ncEpic medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.). The expression of Antares2 in the engineered iPSCs was analyzed by flow cytometry. Figure 3B ).
[0168] In the above measurements, WT iPSC was used as a control. For example... Figure 3B As shown, the expression of Antares2 in iPSC-Rosa26-E-Antares2 cells is very high and can be maintained stably even after hiPSCs have been expanded and passaged for 9 generations. In contrast, although iPSC-Rosa26-UC-Antares2 cells show good Antares2 expression, the expression of Antares2 decreases during sustained expansion.
[0169] iPSC-Rosa26-E-Antares2 cells and iPSC-Rosa26-UC-Antares2 cells from P1 were differentiated according to the protocols described in Examples 1, 3, and 4 of patent CN110592007B to obtain iMSCs. The iMSCs were then cultured and expanded for four generations in expansion medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5). At P0 and P4, the expression of Antares2 in the iMSCs was analyzed by flow cytometry. Figure 3C ).
[0170] like Figure 3CAs shown, iMSC-Rosa26-E-Antares2 cells exhibited high Antares2 expression at P0, and the expression increased at P4, while iMSC-Rosa26-UC-Antares2 cells showed lower Antares2 expression at P0 than iMSC-Rosa26-E-Antares2 cells, and the expression was even weaker at P4.
[0171] The results of this study indicate that transgenes driven by the EF1a promoter integrated into the Rosa26 locus can produce stable and high-level transgene expression in iPSCs during persistent amplification, as well as stable and high-level transgene expression in iMSCs during differentiation and persistent amplification. While the UC promoter can drive high-level transgene expression when directly introduced into iMSCs, it cannot be reactivated to its full activity during persistent amplification of iPSCs and / or iMSCs, resulting in transgene silencing.
[0172] Examples 4-5: Engineered E-HGF-iPSC cells were generated by targeted integration at Rosa26.
[0173] Example 4 Experimental procedure: hiPSCs were prepared according to the methods in Examples 3 and 4 of CN108373998B, and hiPSCs were induced to differentiate into iMSCs according to the methods in Examples 1, 3, and 4 of CN110592007B. The nucleic acid sequences of HGF (with endogenous SP) (SEQ ID NO: 10) and HGF-TPA (SEQ ID NO: 11) were synthesized by Genscript Biotech Inc. (China). The above HGF and HGF-TPA sequences were inserted into the NotI / BamHI site of the pKPBml-PNUC-EGFP vector (SEQ ID NO: 12) (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd.) using T4 ligase (NEB M0202) according to the manual instructions to construct the pKPBml-PNUC-HGF and pKPBml-PNUC-HGF-TFA vectors, respectively. iMSCs cells were then transfected with these two constructs. The transfected iMSCs were cultured in amplification medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5) for 4 days, and then the culture supernatant was collected to determine the HGF protein concentration by ELISA.
[0174] Enzyme-linked immunosorbent assay (ELISA): To analyze the amount of HGF expressed in iMSCs, culture medium was collected after 4 days of culture and analyzed by ELISA. HGF levels were quantified using a Human HGF ELISA kit (Multisciences) according to the manufacturer's instructions. Absorbance was measured at 450 nm after application of STOP solution (Multisciences) for reaction assay.
[0175] As a preliminary experiment, as described above, the effect of the TPA signal peptide on HGF secretion in transiently transfected iMSCs was tested. Figure 4A As shown, compared with endogenous signal peptides, exogenous TPA signal peptides led to a decrease in HGF protein secretion after introduction into iMSCs. Therefore, exogenous TPA signal peptides were not given priority in subsequent site-directed integration genetic engineering.
[0176] Example 5 Experimental procedure: hiPSCs were prepared according to the protocols described in Examples 3 and 4 of CN108373998B. The hiPSCs were cultured and amplified in ncEpic medium (Anhui ZhongSheng Suyuan Biotechnology Co., Ltd.) for 4 days. HGF (SEQ ID NO: 10) driven by the EF1aα promoter was knocked into the Rosa26 locus in the hiPSCs using a method similar to that in Example 1. Figure 4B The engineered iPSCs were named E-HGF-iPSC cells. Confirmed E-HGF-iPSCs and WT iPSCs were stained with an anti-HGF antibody (SinoBiological, 10463-T26), and the percentage of HGF+ iPSCs was detected by flow cytometry. Figure 4CThe HGF staining procedure is as follows: Cultured iPSCs were treated with TrypLE. Collected cells were washed with 1 ml PBS and then centrifuged at 300 × g for 15 seconds. After removing the supernatant, approximately 200 μl of 4% PFA was added and mixed with the cells, and the cells were fixed at room temperature for 10 minutes. Then, the cells were centrifuged at 350 × g for 5 minutes. The cells were then washed with 1 ml FACS buffer and centrifuged at 350 × g for 5 minutes. After removing the supernatant, 200 μl / tube of FACS buffer / 0.1% Triton X was added and mixed with the cells, and the mixture was incubated at room temperature for 10 minutes. The cells were washed again with 1 ml FACS buffer and centrifuged at 350 × g for 5 minutes. After removing the supernatant, 200 μl / tube of anti-HGF antibody (rabbit polyclonal antibody, Sino Biological, #10463-T6) diluted in FACS buffer was added and gently mixed with the cells, and the mixture was incubated at room temperature for 30 minutes. Wash cells again with 1 ml of FACS buffer and centrifuge at 350 × g for 5 minutes. After removing the supernatant, add 200 μl of goat anti-rabbit IgG H&L (APC) diluted in FACS buffer and gently mix with the cells. Incubate the mixture at room temperature for 30 minutes. Wash cells again with 1 ml of FACS buffer and centrifuge at 350 × g for 5 minutes. After removing the supernatant, add 200 μl of FACS buffer and run the sample on a flow cytometer.
[0177] As shown in Figure 4C, almost all iPSCs express HGF. These results indicate that high-purity engineered iPSCs can be prepared by site-specific integration of HGF at the Rosa26 locus in iPSCs via the EF1a promoter.
[0178] Examples 6-7: Generating engineered E-HGF-iMSCs through point-to-point integration at Rosa26 Example 6 Experimental procedure: The engineered iPSCs (E-HGF-iPSCs) prepared in Example 5 were differentiated for 10 days according to the scheme described in Examples 1, 3 and 4 of Patent CN110592007B to obtain engineered iMSCs (hereinafter referred to as E-HGF-iMSCs). Then, the E-HGF-iMSCs were amplified and passaged in amplification medium (Anhui Zhong Sheng Su Yuan Biotechnology Co., Ltd., product name: M5). Figure 5A Representative cell morphologies from engineered HGF-iPSCs to iMSCs are shown. Typical MSC surface markers CD73, CD90, and CD105 in WT-iPSCs and E-HGF-iMSCs (P2) were analyzed by flow cytometry. Figure 5B The expression of HGF in WT-iPSCs, WT-iMSCs, and E-HGF-iMSCs (P2) was analyzed by flow cytometry. Figure 5C The details of CD73 / CD90 / CD105 staining are as follows: Cells were isolated and collected using TrypLE treatment. Cells were washed with 1 ml of PBS and centrifuged at 300 × g for 15–20 seconds. The supernatant was removed, and 50 μl / tube of anti-CD73-APC antibody (BDPharmingen, #559869), anti-CD90-APC antibody (BD Pharmingen, #560847), or anti-CD105-APC antibody (BioLegend, #800508) diluted in FACS buffer was added. The mixture was gently mixed and incubated at 4 °C for 30 minutes. Cells were washed again with 1 ml of FACS buffer and centrifuged at 300 × g for 15–20 seconds. The supernatant was removed, and 200 μl of FACS buffer was added. The samples were then analyzed using flow cytometry.
[0179] like Figure 5A and 5B As shown, the E-HGF-iMSCs of P2 still possess the typical phenotype of MSCs, suggesting that E-HGF-iMSCs can stably maintain the stem cell characteristics of MSCs during persistent expansion. Figure 5C As shown, the expression level of HGF in E-HGF-iMSC is much higher than that in WT-iMSC.
[0180] Example 7 Experimental procedure: The WT-iPSCs and E-HGF-iPSCs prepared in Example 5 were cultured and expanded for 9 generations in ncEpic medium (Anhui ZhongSheng Suyuan Biotechnology Co., Ltd.). The WT-iPSCs and E-HGF-iPSCs from P1 and P10 were differentiated into iMSCs (hereinafter referred to as WT-iPSC-P1-iMSC-P0 cells, WT-iPSC-P10-iMSC-P0 cells, E-HGF-iPSC-P1-iMSC-P0 cells, and E-HGF-iPSC-P10-iMSC-P0 cells, respectively) according to the protocols described in Examples 1, 3, and 4 of patent CN110592007B. Subsequently, the differentiated iMSCs were cultured and expanded for 4 or 7 generations in expansion medium (Anhui ZhongSheng Suyuan Biotechnology Co., Ltd., product name: M5). HGF expression in WT-iPSC-P1-iMSC-P2, WT-iPSC-P10-iMSC-P2, E-HGF-iPSC-P1-iMSC-P2, and E-HGF-iPSC-P10-iMSC-P2 cells was analyzed using an ELISA similar to that in Example 4 (Figure 5D). Furthermore, HGF expression in WT-iPSC-P1-iMSC-P2, WT-iPSC-P1-iMSC-P4, E-HGF-iPSC-P1-iMSC-P2, E-HGF-iPSC-P1-iMSC-P4, and E-HGF-iPSC-P1-iMSC-P7 cells was analyzed using an ELISA similar to that in Example 4. Figure 5E ).
[0181] As measured by ELISA, the level of HGF secreted by E-HGF-iPSC-P1-iMSC-P2 cells was approximately 1627 ng / mL / 10. 6 The concentration of the virus in E-HGF-iPSC-P1-iMSC-P4 cells was approximately 1694 ng / mL / 10. 6 Each cell. Additionally... Figure 5D The results showed that E-HGF-iPSC-P1-iMSC-P2 cells secreted HGF at a level approximately 16.6 times higher than that of WT-iPSC-P1-iMSC-P2 cells, and E-HGF-iPSC-P10-iMSC-P2 cells secreted HGF at a level approximately 24.4 times higher than that of WT-iPSC-P10-iMSC-P2 cells. Figure 5EThe results showed that E-HGF-iPSC-P1-iMSC-P2 cells secreted HGF at a level approximately 16.6 times higher than that of WT-iPSC-P1-iMSC-P2 cells, and E-HGF-iPSC-P1-iMSC-P4 cells secreted HGF at a level approximately 17.5 times higher than that of WT-iPSC-P1-iMSC-P4 cells. Furthermore, E-HGF-iPSC-P1-iMSC-P7 cells secreted HGF at a level approximately 1.54 times higher than that of E-HGF-iPSC-P1-iMSC-P2 cells. These results suggest that E-HGF-iMSCs exhibit high levels of HGF secretion, and that E-HGF-iPSCs used for iMSC differentiation can stably maintain high levels of HGF secretion even after persistent expansion to P10. In addition, E-HGF-iMSCs can stably expand for at least 7 generations while maintaining high levels of HGF secretion.
[0182] Examples 8-11: Improvement of the therapeutic effect of engineered E-HGF-iMSCs on IPF mice.
[0183] Example 8 Experimental procedure: To induce idiopathic pulmonary fibrosis (IPF), C57BL / 6N mice (Charles River) were anesthetized with 1% sodium pentobarbital (100 mg / mL). Then, 70 μg of bleomycin dissolved in 50 μL of physiological saline was administered intratracheally to the mice. At 6 h, 5 days, and 10 days post-bleomycin administration, 1×10⁻⁶ mg / mL of bleomycin dissolved in 100 μL of physiological saline was administered. 6 P4 WT-iMSCs and P4 E-HGF-iMSCs (Example 7) were injected into the tail veins of mice, respectively. Figure 6A Mice injected with an equal volume of saline were designated the model group, and normal C57BL / 6N mice served as a blank control. All mice were sacrificed on day 21. Body weight and lung weight were measured, and the lung index was calculated as the lung weight / body weight ratio. Figure 6B ).
[0184] like Figure 6B As shown, the lung indices of both the E-HGF-iMSC group and the WT-iMSC group were significantly lower than those of the model group, and the E-HGF-iMSC group was superior to the WT-iMSC group and closer to the normal control group.
[0185] Example 9 Experimental procedure: Hydroxyproline (HYP) levels in lung tissue were determined to assess collagen deposition using a hydroxyproline (HYP) assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. Specifically, lung tissue homogenates were hydrolyzed in 6M hydrochloric acid at 95°C for 5 hours, followed by the addition of chloramine-T and pH adjustment. Subsequently, a chromogenic agent (dimethylaminobenzaldehyde) was added, and the samples were incubated at 60°C for 15 minutes. Absorbance was measured at 550 nm using a microplate reader (Bio-Rad, USA). HYP levels were determined by plotting a standard curve, and results were expressed as μg / mg in lung tissue. Figure 6C ).
[0186] like Figure 6C As shown, the HYP content in both the E-HGF-iMSC group and the WT-iMSC group was significantly lower than that in the model group, and the E-HGF-iMSC group was superior to the WT-iMSC group and closer to the normal group used as a control.
[0187] Example 10 Experimental procedure: Lungs from each mouse were fixed in 4% paraformaldehyde and embedded in paraffin. Sections were cut to a thickness of 4 μm and stained with hematoxylin and eosin (H&E). Experimental details are as follows: Sections were dewaxed by two consecutive xylene baths, 10 minutes each. Lung sections were hydrated by passing them through a series of alcohol baths of decreasing concentrations: two baths of anhydrous ethanol, 5 minutes each, followed by 2 minutes of 95% ethanol and 2 minutes of 70% ethanol. The sections were then briefly rinsed in distilled water. The sections were collected on positively charged microscope slides. The slides were incubated in a staining jar with hematoxylin solution (Sigma) for 10 minutes to stain the cell nuclei. The slides were then transferred to a staining jar containing tap water until the water ran clear. The slides were then transferred to a staining jar containing eosin solution (Sigma) for 3 minutes. Transfer the slides sequentially to staining jars, treating with 70% ethanol for 20 seconds, 90% ethanol for 20 seconds, 100% ethanol for 1 minute, and xylene for 3 minutes. Remove the slides from the xylene and place them in a fume hood until dry. Mount the slides with xylene-based mounting media and cover with coverslips. Press the slides firmly with clips to remove air bubbles. Store the slides at room temperature. Image at least five random fields of view for each group using a digital microscope camera.
[0188] The results are as follows Figure 6D As shown, the results indicate that collagen deposition in both the E-HGF-iMSC group and the WT-iMSC group was significantly reduced compared to the model group, and the E-HGF-iMSC group was superior to the WT-iMSC group and closer to the normal group used as a control.
[0189] Example 11 Experimental procedure: Lungs from each mouse were fixed with 4% paraformaldehyde and embedded in paraffin. Sections were cut to a thickness of 4 μm and stained using the Masson staining kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. Experimental details are as follows. Lung sections were dewaxed and rehydrated as described in Example 10. Lung sections were washed with distilled water. The lung sections were mordanted in preheated Bouin solution at 56-60°C for 1 hour or overnight at room temperature. The sections were then stained in Weigert iron hematoxylin solution for 10 minutes. The sections were then washed with running tap water for 10 minutes and rinsed in distilled water. The sections were stained in Biebrich scarlet-acid fuchsin solution for 10-15 minutes and then rinsed in distilled water. The sections were then differentiated in phosphomolybdic acid-phosphotungstic acid solution for 10-15 minutes. The slide sections were observed visually, and once the collagen-rich areas faded and became transparent, the next step could be performed. The slides were directly transferred to aniline blue solution and stained for 5-10 minutes. The slides were then rinsed in distilled water and differentiated in 1% acetic acid solution for 2–5 minutes. The slides were then rinsed again in distilled water. The slides were quickly passed through 95% ethanol to dehydrate the tissue, then wiped with anhydrous ethanol to remove Biebrich scarlet-acid fuchsin stain, and cleared in xylene. The slides were mounted with xylene-based mounting medium and covered with coverslips. All air bubbles were removed, and the slides were stored at room temperature. At least five random fields of view were imaged in each group using a digital microscope camera. The severity of mesenchymal fibrosis was individually assessed in each consecutive field of view, and a score from 0 to 8 was assigned using a predetermined severity rating scale (Table 3). Results are as follows: Figure 6E As shown.
[0190] Table 3. Grading Criteria for Pulmonary Fibrosis Fiber grading Histological features 0 normal lung 1 Mild thickening of the alveolar or bronchial walls 2 The lung wall is moderately thickened, but there is no damage to the lung tissue structure. 3 The wall thickness is significantly increased, accompanied by obvious structural disorder. 4 Severe thickening of the lung wall, accompanied by significant damage to the lung structure. 5 Increased fibrosis, accompanied by clear destruction of lung structure, and the formation of fibrous bands or small fibrous foci. 6 Severe structural damage and large fiber regions 7 "Honeycomb lung" is classified into this category. 8 Full-view fibrotic lesions
[0191] like Figure 6E As shown, the fibrosis scores of both the E-HGF-iMSC group and the WT-iMSC group were significantly lower than those of the model group, and the fibrosis score of the E-HGF-iMSC group was lower than that of the WT-iMSC group and closer to that of the normal control group. In summary... Figure 6B-6E The results showed that E-HGF-iMSCs demonstrated efficacy in improving idiopathic pulmonary fibrosis (IPF) compared to WT-iMSCs.
[0192] Those skilled in the art will understand that the methods, compositions, and products described herein are merely representative of exemplary embodiments and are not intended to limit the scope of this disclosure. Those skilled in the art will understand that various substitutions and modifications can be made to the content disclosed herein without departing from the scope and spirit of this disclosure.
[0193] All patents and publications mentioned in this specification demonstrate the skill of a person skilled in the art to which this disclosure pertains. All patents and publications are incorporated herein by reference in the same manner as each publication is expressly and individually designated as incorporated by reference.
[0194] This disclosure is not limited to the specific embodiments described herein, which are intended as separate illustrations of various aspects of this disclosure. Not all various embodiments of this disclosure are described herein, and the terminology and expressions used are descriptive rather than limiting, and their use is not intended to exclude any equivalents of the shown and described features or portions thereof. However, it should be understood that various modifications can be made within the scope of the claims of this disclosure. Therefore, it should be understood that although this disclosure has been specifically disclosed through preferred embodiments and optional features, modifications and variations can be made to the concepts disclosed herein by those skilled in the art, and such modifications and variations are considered to be within the scope of this disclosure as defined by the appended claims.
Claims
1. A genetically modified pluripotent stem cell (PSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
2. The gene-modified PSC according to claim 1, wherein the target locus is Rosa26.
3. The gene-modified PSC according to claim 1 or 2, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP and UBC.
4. The gene-modified PSC of claim 3, wherein the expression cassette further comprises an anti-silencing ubiquitous chromatin open element (UCOE), such as 1550F shown in SEQ ID NO: 1, and the UCOE is operatively linked to the promoter.
5. The gene-modified PSC according to claim 3, wherein the promoter is the EF1a promoter.
6. The gene-modified PSC according to claim 4, wherein the expression cassette comprises a combination of the EF1a promoter and UCOE.
7. The genetically modified PSC of any one of claims 1-6, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding the extracellular secretion of HGF.
8. The genetically modified PSC of claim 7, wherein the signal peptide is as shown in SEQ ID NO:
20.
9. A method for producing genetically modified PSCs, the method comprising: A first construct and a second construct are introduced into a PSC. The first construct contains a site-specific endonuclease capable of introducing double-strand breaks at a target locus in the PSC genome. The second construct contains an expression cassette encoding an exogenous polynucleotide encoding hepatocyte growth factor (HGF) and a pair of homologous arms specific to the target locus and located on either side of the expression cassette. The expression cassette in the second construct is integrated into the target locus in the PSC genome via homologous recombination, thereby obtaining a genetically modified PSC.
10. The method of claim 9, wherein the target locus is Rosa26.
11. The method of claim 9 or 10, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
12. The method of claim 11, wherein the expression box further comprises an anti-silencing universal chromatin open element (UCOE), such as the 1550F shown in SEQ ID NO: 1, and the UCOE is operatively connected to the promoter.
13. The method of claim 11, wherein the promoter is the EF1a promoter.
14. The method of claim 12, wherein the expression box comprises a combination of the EF1a promoter and UCOE.
15. The method according to any one of claims 9-14, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding HGF extracellular secretion.
16. The method of claim 15, wherein the signal peptide is as shown in SEQ ID NO:
20.
17. The method according to any one of claims 9-16, further comprising continuously amplifying the genetically modified PSC for multiple generations, for example at least 4 or 9 generations.
18. A genetically modified induced mesenchymal stem cell (iMSC) comprising an expression cassette of a target locus integrated into its genome, wherein the expression cassette contains an exogenous polynucleotide encoding hepatocyte growth factor (HGF).
19. The gene-modified iMSC according to claim 18, wherein the target locus is Rosa26.
20. The genetically modified iMSC according to claim 18 or 19, wherein, The expression cassette includes a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
21. The gene-modified iMSC of claim 20, wherein the expression cassette further comprises an anti-silencing panchromatin open element (UCOE), such as 1550F shown in SEQ ID NO:1, and the UCOE is operatively linked to the promoter.
22. The gene-modified iMSC of claim 20, wherein the promoter is the EF1a promoter.
23. The gene-modified iMSC of claim 21, wherein the expression cassette comprises a combination of the EF1a promoter and UCOE.
24. The gene-modified iMSC according to any one of claims 18-23, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding HGF extracellular secretion.
25. The genetically modified iMSC according to claim 24, wherein the signal peptide is as shown in SEQ ID NO:
20.
26. The genetically modified iMSC according to claim 24 or 25, wherein the genetically modified iMSC secretes HGF at a level up to at least 16 times that of wild-type iMSC.
27. A method for producing genetically modified iMSCs, the method comprising: Provide a genetically modified PSC according to any one of claims 1-8; as well as The genetically modified PSCs are differentiated into iMSCs, thereby producing the genetically modified iMSCs.
28. The method of claim 27, further comprising continuously amplifying the genetically modified iMSC for multiple generations, for example at least 4 or 7 generations.
29. A method for producing genetically modified iMSCs, the method comprising: A first construct and a second construct are introduced into iMSCs. The first construct contains a site-specific endonuclease capable of introducing double-strand breaks at a target locus in the iMSC genome. The second construct contains an expression cassette encoding a foreign polynucleotide (HGF) and a pair of homologous arms specific to the target locus and located on either side of the expression cassette. The expression cassette in the second construct is integrated into the target locus in the iMSC genome via homologous recombination, thereby obtaining a genetically modified iMSC.
30. The method of claim 29, wherein the target locus is Rosa26.
31. The method of claim 29 or 30, wherein the expression cassette comprises a promoter operatively linked to a polynucleotide encoding HGF, wherein the promoter is selected from the group consisting of EF1a, PGK, CAG, CMV, CLP, and UBC.
32. The method of claim 31, wherein the expression box further comprises an anti-silencing universal chromatin open element (UCOE), such as the 1550F shown in SEQ ID NO:1, and the UCOE is operatively connected to the promoter.
33. The method of claim 31, wherein the promoter is the EF1a promoter.
34. The method of claim 32, wherein the expression box comprises a combination of the EF1a promoter and UCOE.
35. The method according to any one of claims 29-34, wherein the expression cassette further comprises a polynucleotide encoding a signal peptide for guiding HGF extracellular secretion.
36. The method of claim 35, wherein the signal peptide is as shown in SEQ ID NO:
20.
37. The method according to any one of claims 29-36, further comprising continuously amplifying the genetically modified iMSC for multiple generations, for example at least 4 or 7 generations.
38. A pharmaceutical composition comprising the genetically modified iMSC of any one of claims 18-26 and a pharmaceutically acceptable vector.
39. Use of the genetically modified iMSC according to any one of claims 18-26 in the preparation of a medicament for the treatment or prevention of idiopathic pulmonary fibrosis (IPF).
Citation Information
Patent Citations
A method for reprogramming human blood cells into iPSCs using newt Oct4.
CN108373998B
A mesenchymal stem cell, its preparation method and application
CN110592007B
Process for amplifying, detecting, and / or-cloning nucleic acid sequences
US4683195A