Preparation and genetic transformation method of xanthomonas campestris protoplast

By employing an enzymatic hydrolysis system of collapse enzyme, snail enzyme, and osmotic pressure stabilizer, along with an optimized genetic transformation method, the problems of low efficiency in the preparation of *Fructus fructus* protoplasts and genetic transformation were solved, achieving highly efficient preparation of *Fructus fructus* transformants and providing key technical support for its molecular biology research.

CN122278634APending Publication Date: 2026-06-26XINJIANG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
XINJIANG AGRI UNIV
Filing Date
2026-05-13
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing methods for preparing and genetically transforming *Ceratophyllum demersum* protoplasts are inefficient, resulting in low genetic transformation efficiency, poor protoplast activity, and difficulty in obtaining stable mutant strains. This hinders research on the function of pathogenic genes and infection mechanisms of the pathogen.

Method used

An enzymatic digestion system combining a breakdown enzyme, a snail enzyme, and an osmotic stabilizer was used, along with an optimized ratio of plasmid DNA to protoplasts and a double-layer screening medium, to establish a method for protoplast preparation and genetic transformation of *Cyclophorus fragrans*. The method includes mycelial culture, enzymatic digestion, purification, DNA integration, regeneration culture, and double-layer screening culture.

Benefits of technology

The method enables efficient preparation and genetic transformation of *Ceratophyllum demersum* protoplasts, with a yield of up to 3.84 × 10⁶ protoplasts/mL and a transformation efficiency of 32 transformants/μg DNA. The method is simple, the conditions are mild, and the reproducibility is high, supporting subsequent molecular biology research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122278634A_ABST
    Figure CN122278634A_ABST
Patent Text Reader

Abstract

This invention discloses a method for preparing and genetically transforming *Cyclophorus fragrans* protoplasts. The genetic transformation method includes the following steps: A1. Adding STC buffer to *Cyclophorus fragrans* protoplasts and adjusting the concentration to obtain a protoplast solution; A2. Mixing exogenous plasmid DNA containing the target gene with the protoplast solution, adding PTC buffer, and allowing it to stand at room temperature to allow the plasmid DNA to integrate into the *Cyclophorus fragrans* genome; A3. Adding TB3 liquid medium for regeneration culture; A4. Adding first transformant selection medium and second transformant selection medium to the regeneration culture mixture, respectively, and culturing under dark conditions to obtain *Cyclophorus fragrans* transformants. This invention, by optimizing the enzymatic digestion system and transformation and screening conditions, achieves a protoplast yield of 3.84 × 10⁻⁶. 6 With a transformation efficiency of 32 transformants / μg DNA, and being simple to operate and highly reproducible, this method provides key technical support for molecular biological research on *Ceratophyllum demersum*.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular plant pathology and microbial genetic biology, and specifically relates to a method for preparing and genetically transforming protoplasts of *Scutellaria fuciformis*. Background Technology

[0002] Fruit-loving sclerotium ( Wilsonomyces carpophilus *Sclerotium affine* is a major pathogen causing leaf spot disease in stone fruit trees (such as apricots, peaches, and cherries). Its infection leads to fruit scabs and leaf perforation, severely impacting fruit yield and quality, causing significant economic losses to the fruit industry. Currently, control of this disease mainly relies on chemical agents, which presents problems such as environmental pollution and increased pathogen resistance. Therefore, elucidating its pathogenic mechanism at the molecular level is crucial for developing green and efficient control technologies.

[0003] Genetic transformation systems are a core technological support for studying the gene function of pathogens. However, the cell wall structure of *Cyclophorus fragrans* is unique, making existing methods for protoplast preparation and genetic transformation of filamentous fungi (such as *Pseudomonas aeruginosa* and *Phytophthora chestnutensis*) directly inapplicable. This results in low genetic transformation efficiency, poor protoplast activity, and difficulty in obtaining stable mutant strains, severely restricting research on the function of pathogenic genes, infection mechanisms, and pathogen-host interaction mechanisms of this pathogen. Therefore, establishing an efficient and stable genetic transformation system for *Cyclophorus fragrans* is of significant practical importance for promoting related basic research and innovation in disease control technologies. Summary of the Invention

[0004] Currently, there are no mature methods for protoplast preparation and genetic transformation of *Cyclophorus flavus*, either domestically or internationally. Furthermore, existing general fungal systems suffer from low protoplast preparation efficiency and low genetic transformation success rates when used for *Cyclophorus flavus*. Therefore, this study aims to establish a protoplast preparation and genetic transformation technology system suitable for *Cyclophorus flavus*.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of the present invention provides a method for preparing protoplasts of *Cyclophorus fragrans*, comprising the following steps: S1. Mycelial culture and collection: Fruit-loving sparganum ( Wilsonomyces carpophilus Inoculate the mycelium into YEPD liquid medium, culture, filter, and collect the hyphae; S2. Preparation of protoplast enzymatic hydrolysate: Add driselase enzyme and snailase to the osmotic pressure stabilizer and stir evenly to obtain protoplast enzymatic hydrolysate; S3. Enzymatic hydrolysis: The collected hyphae are added to the protoplast enzymatic hydrolysis solution for enzymatic hydrolysis to dissolve the cell walls of the hyphae. After the enzymatic hydrolysis is completed, the protoplasts of *Scutellaria fuciformis* are obtained.

[0006] Preferably, in step S1, the culture conditions are: cultured at 25~30℃ and 120~180rpm for 1~3 days.

[0007] Preferably, in step S1, the YEPD liquid culture medium consists of: 3 g / L yeast extract, 10 g / L bacterial peptone, 20 g / L D-glucose, and ultrapure water as the solvent.

[0008] Preferably, in step S2, the concentration of the protoplast hydrolysate is 20-25 g / L for the collapse enzyme and 25-30 g / L for the snail enzyme.

[0009] Preferably, in step S2, the osmotic pressure stabilizer is a NaCl solution, which is prepared by adding NaCl to distilled water and stirring until the NaCl concentration is 1~1.5M.

[0010] Preferably, in step S3, the ratio of the collected mycelium to the protoplast enzymatic hydrolysate is 1g:15-20mL.

[0011] Preferably, in step S3, the enzymatic hydrolysis conditions are: 28~30℃, 70~90rpm for 4~7 h.

[0012] Preferably, in step S3, the purification step is as follows: the enzymatic hydrolysis mixture is filtered to collect the filtrate; the filtrate is centrifuged and the supernatant is discarded to obtain the centrifuged precipitate, which is the protoplast of *Cyclophorus flavus*.

[0013] A second aspect of the present invention provides a method for genetic transformation of *Cyclophorus flavus* protoplasts, comprising the following steps: A1. Preparation of *Fructus fructus* protoplast solution: Add STC buffer to the *Fructus fructus* protoplasts prepared by the above method, mix well, count using a hemocytometer, adjust the protoplast concentration, and obtain the *Fructus fructus* protoplast solution. A2, DNA Integration: The exogenous plasmid DNA containing the target gene was added to the protoplast solution of *Cyclophorus fragrans* and mixed well. Then, PTC buffer was added, mixed well, and allowed to stand at room temperature to allow the plasmid DNA to integrate into the *Cyclophorus fragrans* genome, thus obtaining a protoplast-exogenous plasmid DNA mixture. A3. Protoplast regeneration culture: Add TB3 liquid medium to the protoplast-exogenous DNA mixture and perform regeneration culture to obtain a regeneration culture mixture; A4. Transformant screening and culture: Add the first transformant selection medium to the regeneration culture mixture, mix well, pour into a petri dish and incubate in the dark. After mycelia grow in the first transformant selection medium, add the second transformant selection medium to the petri dish to cover the surface of the first transformant selection medium, continue incubation in the dark, and screen to obtain the transformants of *Cyclocarya fruticosa*.

[0014] Preferably, in step A1, the protoplast concentration is adjusted to 10 using a hemocytometer. 7 -10 8 The STC buffer solution is prepared by adding 200g sucrose, 50mL 1M Tris-HCl (pH 8.0), and 5.549g calcium chloride to ultrapure water and bringing the volume to 1L, then autoclaving.

[0015] Preferably, in step A2, the ratio of the amount of plasmid DNA added to the amount of protoplast solution is 1-3 μg: 100 μL; the preparation steps of the PTC buffer are as follows: add 4 g PEG 4000 to 6 ml STC buffer, mix well, and filter to remove bacteria.

[0016] Preferably, in step A2, the time for standing at room temperature is 20-40 minutes.

[0017] Preferably, in step A3, the TB3 liquid culture medium consists of: 3 g / L yeast extract, 3 g / L acid-hydrolyzed casein, 200 g / L sucrose, and ultrapure water as the solvent.

[0018] Preferably, in step A3, the regeneration culture conditions are: cultured at 25~30℃ and 80~100rpm for 10~20h.

[0019] Preferably, in step A4, the first transformant screening medium is specifically TB3 solid medium containing hygromycin, and its preparation steps are as follows: add hygromycin and agar to TB3 solid medium to make the final concentration of hygromycin 15~25μg / mL.

[0020] Preferably, in step A4, the conditions for dark culture are: 25~30℃, dark culture for 4~6 days.

[0021] Preferably, in step A4, the second transformant screening medium is a PDA solid medium containing hygromycin, and its preparation steps are as follows: add hygromycin to the PDA solid medium and make the final concentration of hygromycin 15-25 μg / mL.

[0022] Preferably, in step A4, the conditions for continued dark culture are: 25~30℃, dark culture for 3-5 days.

[0023] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention provides a highly efficient method for preparing protoplasts of *Cyclophorus fragrans*, using an enzymatic hydrolysis system combining a breakdown enzyme, a snail enzyme, and an osmotic pressure stabilizer, resulting in a protoplast yield as high as 3.84 × 10⁻⁶. 6 The concentration of cells / mL is high and the activity is stable, laying a high-quality foundation for subsequent genetic transformation. (2) This invention establishes for the first time an efficient genetic transformation method for protoplasts of *Cyclophorus flavus*. By optimizing the ratio of plasmid DNA to protoplasts, transformation reaction conditions, and a double-layer screening medium (the first transformant screening medium is TB3 solid medium containing hygromycin + the second transformant screening medium is PDA solid medium), the transformation efficiency reaches 32 transformants / μg DNA. (3) The genetic transformation method of *Fructus fructus* protoplasts provided by this invention has a simple operation process and mild conditions (static incubation at room temperature and culture at 25~30℃). It does not require complex instruments and equipment, has strong repeatability, and can quickly obtain stable *Fructus fructus* transformants. It provides key technical support for molecular biological research of this bacterium (such as gene function verification, metabolic pathway analysis, etc.) and fills the gap in the genetic transformation system of *Fructus fructus*. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 Microscopic image of the protoplast of *Cyprinus fruticosa* (1); Figure 2 The second image shows a microscopic examination of the protoplasts of *Cyprinus fruticosa*. Figure 3 The results of fluorescence detection of protoplast transformants of *Cyclophorus flavus*; Figure 4 The image shows the electrophoretic pattern of PCR amplification; where W is the negative control using wild-type *Cyclophorus fragrans* as a template, CK is the blank control using water as a template, and 1-7 are the PCR amplification bands using the extracted transformant DNA 1-7 as a template. Detailed Implementation

[0026] In the following description, specific details such as particular system architectures and techniques are set forth for illustrative purposes and not for limitation, in order to provide a thorough understanding of the embodiments of the invention. However, those skilled in the art will understand that the invention may be implemented in other embodiments without these specific details.

[0027] Example 1 (a) Preparation of protoplasts of *Scutellaria fruticosa*, the steps are as follows: 1. Mycelial culture and collection (1) Prepare YEPD liquid culture medium: Add 3g of yeast extract, 10g of bacterial peptone and 20g of D-glucose to ultrapure water to a final volume of 1L, and autoclave at 120℃ for 30 min. (2) The purified and cultured *Sclerotium falciparum* (2 days) Wilsonomyces carpophilus Young mycelia at the edge of a single colony were inoculated into 100 mL of YEPD liquid medium and placed on a shaker. The culture was carried out at 25°C and 150 rpm for 1-3 days to obtain mycelial culture solution. (3) Use a single-layer Miracloth filter cloth to filter the mycelial culture medium, collect the mycelia on the filter cloth, wash them 5 times with an osmotic pressure stabilizer, and then use ultrapure filter paper to absorb the moisture on the surface of the mycelia to obtain clean and tender mycelia.

[0028] 2. Preparation of enzymatic hydrolysate (1) Preparation of osmotic pressure stabilizer: Add NaCl to distilled water and stir to dissolve until the NaCl concentration is 1.2M; (2) Preparation of enzymatic hydrolysate: Add driselase enzyme and snailase to the osmotic pressure stabilizer and stir to dissolve evenly. The concentration of driselase enzyme is 20-25 g / L and the concentration of snailase is 25-30 g / L.

[0029] 3. Enzymatic hydrolysis to prepare protoplasts (1) Add mycelium to protoplast enzymatic hydrolysate at a ratio of 15-20 mL / g mycelium, place on a shaker, and shake for 4-7 hours at 28-30℃ and 70 rpm to dissolve the mycelial cell wall.

[0030] (2) The enzyme digest mixture was filtered using a double-layer Miracloth filter cloth. The filtrate was collected in a centrifuge tube, washed five times with 5 ml of buffer, and the liquid was collected. The tube was centrifuged at 3000 rpm for 10 minutes at 4°C. The supernatant was discarded to obtain *Cyclophorus flavus* protoplasts (yield 3.84 × 10⁻⁶). 6 (Cells / mL, cells / mL). Microscopic examination and morphological observation of the protoplasts of *Cyclophorus fragrans* were performed, and the results are as follows: Figure 1 ,2 As shown. Then adjust the concentration to 10. 7 -10 8 The sample size is 1 / mL, which will be used in the next experiment.

[0031] (II) Genetic transformation 1. Preparation of *Scutellaria fuciformis* protoplast solution: (1) Preparation of STC buffer: Add 200g of sucrose, 50mL of 1M Tris-HCl (pH 8.0) and 5.549g of calcium chloride to ultrapure water to a final volume of 1L, and autoclave at 120℃ for 30 min. (2) Add STC buffer to the purified *Cyclophorus fragrans* protoplasts, gently aspirate and mix, count using a hemocytometer, and adjust the protoplast concentration to 10. 7 -10 8 Prepare a protoplast solution of *Cytosporum flavum* at a concentration of 1 / mL; 2. DNA Integration (1) Take 250 μL of *Cyclocarya fructus* protoplast solution and place it in a centrifuge tube. Add exogenous plasmid DNA containing the target gene, mix well, and let stand at room temperature for 20 min to obtain a mixture. The amount of plasmid DNA added to the protoplast solution is 1-3 μg / 100 μL. (2) Preparation of PTC buffer: Add 4 g PEG4000 to 6 ml STC buffer, filter through a 0.22 micrometer microporous membrane for sterilization, and set aside for later use; (3) Add 1200 μL of PTC buffer to the above mixture, mix gently, and let stand at room temperature for 20 min to allow the plasmid DNA to integrate into the genome of *Ceratophyllum demersum*, thus obtaining a protoplast-exogenous DNA mixture.

[0032] 3. Protoplast regeneration culture and transformant screening culture (1) The regeneration culture medium is TB3 liquid culture medium: add 3g of yeast extract, 3g of acid hydrolyzed casein and 200g of sucrose to ultrapure water to make up to 1L, and autoclave at 120℃ for 30 min. (2) Add 8 mL of TB3 liquid culture medium to the protoplast-exogenous plasmid DNA mixture, mix well and let stand at room temperature for 2 minutes, then transfer to a shaker and shake at 25℃ and 90 rpm for 10-20 h to carry out protoplast regeneration culture and obtain regeneration culture mixture.

[0033] (3) Prepare the first transformant screening medium, specifically TB3 solid medium containing hygromycin: add hygromycin (as a screening reagent) to TB3 solid medium to make the final concentration of hygromycin 15-25 μg / mL; the TB3 solid medium formula is the same as TB3 liquid medium, with 0.65%-0.75% agar added.

[0034] Prepare the second transformant screening medium, which is a PDA solid medium containing hygromycin: add hygromycin to the PDA solid medium to make the final concentration of hygromycin 15-25 μg / mL; (4) Take the regeneration culture mixture and add 50 mL of the first transformant selection medium that has been heated to melt and then cooled to 40-50℃. Mix well and pour into a petri dish. Incubate in the dark at 25℃ for 3-6 days. After the first selection culture has grown hyphae, add 15 mL of the second transformant selection medium that has been heated to melt and then cooled to 40-50℃ to the petri dish. Shake well and cover the surface of the first transformant selection medium.

[0035] (5) Incubate in the dark at 25℃ for 3-5 days, and select the single colony hyphae that grow out as transformants of *Scutellaria fuciformis*. Then, perform fluorescence detection under a fluorescence microscope. The results are as follows: Figure 3 As shown.

[0036] Depend on Figure 3 The results showed that, on average, 4 out of every 10 *Cytosporum flavum* protoplast transformants emitted green fluorescence, and the transformation success rate reached 40%.

[0037] (III) PCR detection of *Cyclophorus fragrans* transformants 1. Transformant mycelial culture (1) Pick the observed green fluorescent transformants and transfer them to a PDA solid medium plate containing 25 μg / mL hygromycin. Incubate in a 25℃ incubator for 3-5 days until GFP transformants grow on the plate.

[0038] (2) Transfer the GFP transformants to PDA solid medium plates containing 25 μg / mL hygromycin and cellophane on the surface, and incubate them in an incubator at 25°C for 3-5 days. After the cellophane grows on the surface of the cellophane, scrape and collect the mycelium to obtain the mycelium of the GFP transformant of *Cytosporum flavum*.

[0039] 2. DNA extraction from transformants and wild-type strains (1) Extract transformant DNA by cryo-grinding with liquid nitrogen and CTAB method: Take the collected transformant hyphae and wild-type (original fruit-eating sclerotium) hyphae and place them in a mortar, add liquid nitrogen and grind them thoroughly; transfer the powder obtained from grinding to 1.5 mL centrifuge tubes, add 1 mL of CTAB (hexadecyltrimethylammonium bromide) solution preheated at 60 °C and 100 μL of 10% SDS solution to each tube.

[0040] (2) Place the above 1.5 mL centrifuge tubes in a 60℃ water bath for 1 h, and then centrifuge at 13000 rpm for 10 min; transfer the supernatant to a new 2 mL centrifuge tube, add an equal volume of chloroform and mix thoroughly, and centrifuge again at 13000 rpm for 10 min.

[0041] (3) Transfer the supernatant to a new 2mL centrifuge tube, add an equal volume of chloroform and mix well. Centrifuge at 13000rpm for 10min. Transfer the supernatant to a new 1.5mL centrifuge tube, add an equal volume of isopropanol and mix well. Incubate at 4℃ for 20min, then centrifuge at 13000rpm for 10min and discard the supernatant. Wash the centrifuge tube twice with 75% ethanol, centrifuging at 13000rpm for 5min each time. Allow the tube to air dry. Finally, dissolve the transformed DNA and wild-type strain DNA in 50μL ddH2O to obtain the DNA for use. All the above operations were performed at room temperature.

[0042] 3. PCR amplification of transformants Based on the sequence of the green fluorescent protein gene integrated into the DNA fragment of *Scutellaria floscens* strain, specific primers were designed for PCR verification of the transformant DNA (M13-7F: ggcggtgctacagagttctt, M13-7R: gcgtcagaccccgtagaaaa). Wild-type strain DNA was used as a negative control, eGFP plasmid as a positive control, and sterile water as a blank control. The PCR detection results are shown in Figure 4.

[0043] Figure 4 The results showed that all seven *Ceratophyllum demersum* GFP transformants (1-7) successfully integrated the eGFP plasmid.

[0044] This invention is not limited to the specific embodiments described above. Any modifications made by those skilled in the art based on the above concept without creative effort are within the scope of protection of this invention.

Claims

1. A method for preparing protoplasts of *Scutellaria fuciformis*, characterized in that, Includes the following steps: S1. Mycelial culture and collection: Fruit-loving sparganum ( Wilsonomyces carpophilus Inoculate the mycelium into YEPD liquid medium, culture, filter, and collect the hyphae; S2. Preparation of protoplast enzymatic hydrolysate: Add driselase enzyme and snailase to the osmotic pressure stabilizer and stir evenly to obtain protoplast enzymatic hydrolysate; S3. Enzymatic hydrolysis: The collected hyphae are added to the protoplast enzymatic hydrolysis solution for enzymatic hydrolysis to dissolve the cell walls of the hyphae. After the enzymatic hydrolysis is completed, the protoplasts of *Scutellaria fuciformis* are obtained.

2. The method for preparing *Scutellaria fuciformis* protoplasts according to claim 1, characterized in that, In step S1, the YEPD liquid culture medium consists of: 3 g / L yeast extract, 10 g / L bacterial peptone, and 20 g / L D-glucose, with ultrapure water as the solvent; the culture conditions are: 25-30℃ and 120-180 rpm for 1-3 days.

3. The method for preparing *Scutellaria fusca* protoplasts according to claim 1, characterized in that, In step S2, the concentration of the protoplast hydrolysate is 20-25 g / L for the collapse enzyme and 25-30 g / L for the snail enzyme; the osmotic pressure stabilizer is a NaCl solution, which is prepared by adding NaCl to distilled water and stirring until the NaCl solution concentration is 1-1.5M.

4. The method for preparing *Scutellaria fuciformis* protoplasts according to claim 1, characterized in that, In step S3, the ratio of the collected mycelium to the protoplast enzymatic hydrolysate is 1g:15-25mL; the enzymatic hydrolysis conditions are: 28-30℃, 70-90rpm for 4-7 h.

5. The method for preparing *Scutellaria fuciformis* protoplasts according to claim 1, characterized in that, In step S3, the purification step is as follows: the enzymatic hydrolysis mixture is filtered and the filtrate is collected; the filtrate is centrifuged and the supernatant is discarded, and the centrifuged precipitate is the protoplast of *Cyclophorus flavus*.

6. A method for genetic transformation of *Cyclophorus fragrans* protoplasts prepared by the method according to any one of claims 1-5, characterized in that, Includes the following steps: A1. Preparation of *Fructus fructus* protoplast solution: Add STC buffer to *Fructus fructus* protoplasts, mix well, count using a hemocytometer, and adjust the protoplast concentration to 10. 7 -10 8 The number of cells / mL was used to obtain a protoplast solution of *Cytosporium flavum*. A2, DNA Integration: The exogenous plasmid DNA containing the target gene was added to the protoplast solution of *Ceratophyllum demersum* and mixed well. Then, PTC buffer was added, mixed well, and allowed to stand at room temperature to allow the plasmid DNA to integrate into the *Ceratophyllum demersum* genome, thus obtaining a protoplast-exogenous plasmid DNA mixture. A3. Protoplast regeneration culture: Add TB3 liquid medium to the protoplast-exogenous DNA mixture and perform regeneration culture to obtain a regeneration culture mixture; A4. Transformant screening and culture: Add the first transformant selection medium to the regeneration culture mixture, mix well, pour into a petri dish and incubate in the dark. After mycelia grow in the first transformant selection medium, add the second transformant selection medium to the petri dish to cover the surface of the first transformant selection medium, and continue incubation in the dark. The single colony that grows is the transformant of *Sclerotium flavum*.

7. The genetic transformation method for *Cyclophorus fragrans* protoplasts according to claim 6, characterized in that, In step A1, a hemocytometer is used to count protoplasts, and the protoplast concentration is adjusted to 10. 7 -10 8 The STC buffer solution was prepared by adding 200g sucrose, 50mL 1M Tris-HCl, and 5.549g calcium chloride to ultrapure water and bringing the volume to 1L, then autoclaving.

8. The genetic transformation method for *Cyclophorus fragrans* protoplasts according to claim 6, characterized in that, In step A2, the ratio of the amount of plasmid DNA added to the amount of protoplast solution is 1-3 μg: 100 μL; the incubation time at room temperature is 20-40 min.

9. The genetic transformation method for *Cyclophorus fragrans* protoplasts according to claim 6, characterized in that, In step A3, the composition of the TB3 liquid culture medium is: 3 g / L yeast extract, 3 g / L acid-hydrolyzed casein, 200 g / L sucrose, and ultrapure water as the solvent; the regeneration culture conditions are: culture at 25~30℃ and 80~100 rpm for 10~20 h.

10. The method for genetic transformation of *Cyclophorus fragrans* protoplasts according to claim 6, characterized in that, In step A4, the first transformant screening medium is specifically TB3 solid medium containing hygromycin, and its preparation steps are as follows: add hygromycin and agar to TB3 solid medium to make the final concentration of hygromycin 15~25μg / mL; the conditions for dark culture are: 25~30℃, dark culture for 4~6 days; The second transformant screening medium is specifically a PDA solid medium containing hygromycin, and its preparation steps are as follows: add hygromycin to the PDA solid medium and make the final concentration of hygromycin 15-25 μg / mL; the conditions for continued dark culture are: 25~30℃, dark culture for 3-5 days.