Pyo-P2, an oligoandrogenic Pythium strain with broad-spectrum growth-promoting and disease-resistant functions, and its applications.

The application of the Pythium oligomangum strain Pyo-P2 and its preparations has solved the problem of the single function of Pythium oligomangum strains, and has achieved growth promotion and broad-spectrum disease control for a variety of crops, significantly improving crop growth and disease control effects, and reducing the use of chemical pesticides.

CN122278645APending Publication Date: 2026-06-26SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY
Filing Date
2026-06-01
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing strains of Pythium oligomanii have limited functionality and insignificant effects in controlling various crop diseases and promoting crop growth, especially in their insufficient control over a variety of important crops and different types of pathogens.

Method used

This invention provides an oligomale pythium strain, Pyo-P2, and its formulation. Through activation culture, fermentation culture, and mixing treatment, it is prepared into solid or liquid inoculants that can be applied to the crop growth environment or directly applied to achieve growth promotion and broad-spectrum biocontrol effects on a variety of crops.

Benefits of technology

It significantly promotes the growth of potatoes and rice, increases root length and plant height, and prevents root rot caused by Phytophthora indica. It has a broad spectrum of disease control capabilities and has a good inhibitory effect on pathogens such as Phytophthora indica, Phytophthora causalis, Rhizoctonia solani, and Fusarium graminearum, thus reducing the use of chemical pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122278645A_ABST
    Figure CN122278645A_ABST
Patent Text Reader

Abstract

This invention discloses a broad-spectrum Pythium oligandrum strain, Pyo-P2, with broad-spectrum growth-promoting and disease-resistant functions, and its applications. The preservation number of this Pythium oligandrum strain, Pyo-P2, is CGMCC No. 42579. This strain can significantly promote the plant growth and increase biomass of various crops such as potatoes, rice, and soybeans. Simultaneously, it exhibits significant inhibitory activity against multiple pathogens, including Phytophthora soybeanae, Phytophthora pathogenica, Rhizoctonia solani, and Fusarium graminearum. This strain and its microbial preparations possess both growth-promoting and disease-preventing functions, are environmentally friendly, and have broad application prospects in agriculture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial technology, specifically relating to a broad-spectrum Pythium oligomangiferum strain Pyo-P2 with broad-spectrum growth-promoting and disease-resistant functions, and its application in the preparation of microbial agents, promoting crop growth, inhibiting bacteria and preventing crop diseases. Background Technology

[0002] Crops constantly face various biotic stresses (such as pathogen infection) and abiotic stresses (such as nutrient deficiency) during their growth, severely impacting yield and quality. For a long time, chemical pesticides and fertilizers have played a crucial role in ensuring agricultural production; however, their overuse has led to increasingly prominent problems such as environmental pollution, pesticide residues, pathogen resistance, and soil degradation. Therefore, developing green and efficient biological control and bio-promoting technologies has become an urgent need for the sustainable development of modern agriculture.

[0003] Beneficial microorganisms, especially plant rhizosphere growth-promoting and biocontrol bacteria, have attracted widespread attention due to their environmental friendliness, high safety, and multifunctionality. Among them, *Pythium oligandrum* is a beneficial oomycete widely distributed in soil. Studies have shown that *Pythium oligandrum* exerts its effects through multiple mechanisms: first, as a hyperparasite, it directly infects and degrades the hyphae of various pathogenic fungi and oomycetes; second, it induces systemic resistance in plants, activating their defense responses; and third, it promotes plant growth by producing plant hormones or improving nutrient absorption.

[0004] Currently, there are reports both domestically and internationally on the control of soil-borne diseases (such as Pythium spp. and Phytophthora blight) and nematode diseases in crops such as cucumber and tomato. However, the functions of the strains reported in these studies are mostly focused on the control of specific diseases. It is well known in the field of microbiology that there are significant intraspecific genetic and functional differences among strains of the same species; that is, the functional traits of microbial strains exhibit significant strain-level heterogeneity. Furthermore, existing research has fully demonstrated that the biocontrol effects of different isolates within the Pythium oligandrum species vary greatly, and the acquisition of highly effective strains is unpredictable. Resources of Pythium oligandrum strains that significantly promote the growth of various important food and economic crops (such as potato, tomato, rice, and corn) and possess highly effective inhibitory or control capabilities against major diseases caused by different types of pathogens, including oomycetes and fungi (such as Phytophthora soybeanis, Phytophthora pathogenica, and Rhizoctonia solani), are still relatively scarce.

[0005] Therefore, isolating and screening new strains of Pythium oligandii that have both efficient growth-promoting and broad-spectrum biocontrol functions, and developing their corresponding application technologies, is of great significance for reducing dependence on chemical inputs and developing green ecological agriculture. Summary of the Invention

[0006] The purpose of this invention is to provide a novel *Pythium oligomangum* strain, Pyo-P2, which can significantly promote the growth of a variety of crops and has a broad-spectrum and highly effective control effect on diseases caused by important plant pathogens.

[0007] Another objective of this invention is to provide the application of this strain and its prepared microbial preparations in agricultural production.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention seeks protection for a strain of Pythium oligandrum, Pyo-P2, which has the accession number CGMCC No. 42579 and was deposited on February 9, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0010] Secondly, the present invention seeks protection for at least one use of the above-mentioned Pythium oligomangiferum strain Pyo-P2 in promoting crop growth, inhibiting plant pathogens, and preparing microbial agents for the prevention and control of crop diseases.

[0011] Thirdly, the present invention claims protection for a microbial preparation, the active ingredient of which comprises at least one of the hyphae, spores and fermentation broth of the aforementioned Pythium oligoandrogenes strain Pyo-P2.

[0012] Further, the microbial preparation is: (a) a solid preparation containing mycelia and / or spores of the Pythium oligosterolactem strain Pyo-P2; or (b) a liquid preparation containing fermentation broth of the Pythium oligosterolactem strain Pyo-P2.

[0013] Furthermore, the solid microbial agent described in (a) is prepared by the following method: the above-mentioned Pythium oligospermum strain Pyo-P2 is inoculated into V8 or CMA plate medium for activation culture; the obtained mycelial blocks are inoculated into V8 liquid medium for fermentation culture to obtain a fermentation broth rich in mycelia and spores; the fermentation broth or mycelia are mixed with sterilized V8 solid medium and fermented in solid state at 25°C to obtain the solid microbial agent.

[0014] The V8 liquid culture medium consists of V8 vegetable juice, calcium carbonate and water. 100 mL of commercially available V8 vegetable juice and 2 g of calcium carbonate are mixed thoroughly, filtered, and the supernatant is taken. The mixture is then diluted to 1 L with deionized water and sterilized at 121°C for 20 min.

[0015] The V8 solid culture medium is as follows: 100 mL of V8 vegetable juice (commercially available), 2 g of calcium carbonate, after thorough stirring, filter and take the supernatant, 15-20 g of agar powder, and deionized water to a final volume of 1 L, sterilize at 121℃ for 20 min.

[0016] The liquid bacterial agent mentioned in (b) is the fermentation broth obtained from the aforementioned fermentation culture, or its concentrated and purified product.

[0017] Fourthly, the present invention seeks protection for the use of the above-mentioned microbial preparation in promoting the growth of at least one of the crops: potatoes, rice, and soybeans.

[0018] Fifthly, the present invention seeks protection for the use of the above-mentioned microbial preparation in the prevention and control of root rot caused by Phytophthora in soybean.

[0019] Sixthly, the present invention claims protection for a method for promoting crop growth and / or preventing crop diseases, comprising applying the aforementioned *Pythium oligomangiferum* strain Pyo-P2 or the aforementioned microbial preparation to a crop or the crop growth environment; wherein the crop is at least one of potato, rice, and soybean; and the crop disease is root rot caused by *Phytophthora soybeani*.

[0020] Furthermore, the application methods include root irrigation, soil mixing, or spraying.

[0021] In the technical solution of this invention, the crop is at least one of potato, rice, and soybean; the plant pathogen is at least one of Phytophthora sojae, Phytophthora infestans, Rhizoctonia solani, and Fusarium graminearum.

[0022] In the technical solution of this invention, the crop disease is root rot caused by Phytophthora indicum.

[0023] Compared with the prior art, the present invention has the following significant advantages:

[0024] 1. Comprehensive Functions of the Strains: The Pythium oligomangiferum strain Pyo-P2 provided in this invention integrates growth promotion and biocontrol functions. This application is the first to systematically verify the significant growth-promoting effects of this strain and its preparations on potatoes and rice: the root length growth rate of rice reached as high as 84.36%, significantly higher than the reported growth-promoting effects of the Pythium oligomangiferum preparation "Doliweisheng" (Ouyang Younan et al., Growth-promoting, disease-preventing and yield-increasing effects of the Pythium oligomangiferum preparation "Doliweisheng" on rice [J]. Chinese Rice, 2007, (6): 48-51.). This strain has great application potential in plant nutrient absorption, stress resistance and soil structure improvement. At the same time, this strain has an 89.61% control effect on root rot caused by Phytophthora indica.

[0025] 2. Broad-spectrum and highly effective biocontrol: This strain exhibits good inhibitory effects against Phytophthora soybean (oomycetes), Phytophthora pathogenica (oomycetes), Fusarium graminearum (fungi), and Rhizoctonia solani (fungi), overcoming the limitation that single strains are usually effective only against specific types of pathogens. Its biocontrol spectrum has been verified to include many serious soil-borne diseases in Chinese crop production, providing a new solution for controlling complex soil-borne diseases.

[0026] 3. Huge application potential: Solid, liquid or extract formulations developed based on this strain can be flexibly applied to various methods such as root irrigation, soil mixing, and spraying to meet the needs of different crops and cultivation patterns.

[0027] 4. Green, safe and sustainable: The strains and preparations of this invention are derived from the natural environment, are environmentally friendly, can reduce the use of chemical pesticides and fertilizers, conform to the development direction of ecological agriculture and organic agriculture, and have good social, economic and ecological benefits. Attached Figure Description

[0028] Figure 1 The study investigated the antibacterial activity of live strain Pyo-P2 against Phytophthora soybeani, Phytophthora pathogenica, Rhizoctonia solani, and Fusarium graminearum.

[0029] Figure 2 The study investigated the growth-promoting effects of the inoculant and fermentation broth of strain Pyo-P2 on potato plants.

[0030] Figure 3 The study included the cell and fermentation broth of strain Pyo-P2, and the growth-promoting effect of the fermentation broth on rice.

[0031] Figure 4 The effect of fermentation broth of strain Pyo-P2 on the prevention and control of soybean root rot.

[0032] Information on the preservation of biological materials

[0033] The strain Pyo-P2 of *Pythium oligandrum*, classified as *Pythium oligandrum*, is deposited at the China General Microbiological Culture Collection Center (CGMCC) on February 9, 2026, with accession number CGMCC No. 42579. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. The following embodiments are for illustrative purposes only and are not intended to limit the scope of protection of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0035] The culture medium used in the examples is as follows:

[0036] V8 medium: 100 mL of V8 vegetable juice (commercially available), 2 g of calcium carbonate, stir thoroughly, filter and take the supernatant, 15 g of agar powder (added to solid medium), add deionized water to a final volume of 1 L, sterilize at 121℃ for 20 min.

[0037] CMA medium: Corn flour agar 17 g / L (added to solid medium), deionized water to a final volume of 1 L, sterilize at 121℃ for 20 min.

[0038] PDA medium: 6 g potato extract powder, 20 g glucose, 15 g agar powder (added to solid medium), deionized water to a final volume of 1 L, sterilize at 121℃ for 20 min.

[0039] RSA medium: Soak 60g of rye in 800mL of water overnight, autoclave at 121℃ for 30min, then grind with a mixer, filter through 4 layers of gauze, add 100ml of V8 (add 1g of calcium carbonate to 100mL of V8 before filtration), and bring the volume to 1L. Dispense into 200mL containers, adding 4g of sucrose and 2.7g of agar. Sterilize at 121℃ for 20min.

[0040] Example 1: Isolation and Identification of Strain Pyo-P2

[0041] 1. Strain Isolation: Soil samples were collected from the rhizosphere soil of healthy potato fields. Using the dilution-spread method, soil suspensions were spread onto CMA selective plates containing antibiotics (pimmicin 10 µg / mL, ampicillin 50 µg / mL, rifampin 50 µg / mL, pentachloronitrobenzene 100 µg / mL) and incubated in the dark at 25°C for 24–48 h. Mycelia from the edge of colonies with oospore morphology resembling *Pythium oligandrum* were picked and purified multiple times to obtain a pure culture, designated Pyo-P2.

[0042] 2. Molecular biological identification: Genomic DNA was extracted from strain Pyo-P2 using a plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd., catalog number: DP305). Using this as a template, the ITS rDNA region was amplified using primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) / ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). After sequencing the PCR products, the obtained sequences were BLAST-aligned in the NCBI database. SEQ ID NO:1 was compared on the NCBI database website, and the alignment results are shown in Table 1. The sequence alignment results showed that the ITS of Pyo-P2 had 100% sequence similarity to the known Pythium oligandrum type strain. The Cox II gene was amplified using primers FM66 (5′-TAGGATTTCAAGATCCTGC-3′) / F58 (5′-CCACAAATTTCACTACATTGA-3′). After sequencing the PCR products, the obtained sequences were BLAST-aligned in the NCBI database. The alignment of SEQ ID NO:2 was performed on the NCBI database website, and the results are shown in Table 2. The sequence alignment results showed that the Cox II sequence of Pyo-P2 had 100% sequence similarity to the known type strain of Pythium oligandrum. Based on its morphological characteristics (unseptate young hyphae, spherical or nearly spherical sporangia, terminal or intercalary oogonia with conical spines on the outer wall), it was identified as Pythium oligandrum and named Pyo-P2.

[0043] Table 1. Sequence alignment results of SEQ ID NO.1 from the publicly available website NCBI.

[0044]

[0045] Table 2. Sequence alignment results of SEQ ID NO.2 from the publicly available website NCBI.

[0046]

[0047] Example 2: Plate inhibition activity of strain Pyo-P2 against pathogenic Phytophthora, Fusarium graminearum, Rhizoctonia solani, and Phytophthora sacchariformis.

[0048] 1. Cultivating a confrontational approach:

[0049] Pythium oligomangiosporus strain Pyo-P2 and Phytophthora soybeani strain P6497 were symmetrically inoculated 1 cm from the edge of V8 medium plates, with plates inoculated only with P6497 mycelial cakes serving as controls. The plates were incubated in the dark at 25°C for 5 days, and the diameters were measured to calculate the inhibition rate.

[0050] Pythium oligomangiosus Pyo-P2 and Phytophthora pathogenica JH19 were symmetrically inoculated 1 cm from the edge of RSA agar plates, with plates inoculated only with JH19 mycelial cakes serving as controls. The plates were incubated in the dark at 18°C ​​for 7 days, and the diameters were measured to calculate the inhibition rate.

[0051] Pythium oligomangiosus Pyo-P2 and Rhizoctonia solani Rso-0 were symmetrically inoculated 1 cm from the edge of PDA medium plates, with plates inoculated only with Rso-0 mycelial cakes serving as controls. The plates were incubated in the dark at 25°C for 4 days, and the diameters were measured to calculate the inhibition rate.

[0052] Pythium oligomangiosus Pyo-P2 and Fusarium graminearum PH-1 were symmetrically inoculated 1 cm from the edge of PDA medium plates, with plates inoculated only with PH-1 mycelial cakes serving as controls. The plates were incubated in the dark at 25°C for 4 days, and the diameters were measured to calculate the inhibition rate.

[0053] 2. Results Observation:

[0054] like Figure 1 As shown, in the control group, the colonies of *Phytophthora infestans*, *Rhizoctonia solani*, *Fusarium graminearum*, and *Phytophthora spp.* expanded normally. However, in the confrontation plates, a distinct inhibition zone was formed, indicating that strain Pyo-P2 has a strong direct antagonistic effect against *Phytophthora infestans*, *Phytophthora spp.*, *Fusarium graminearum*, and *Rhizoctonia solani*.

[0055] Example 3: Growth-promoting effect of strain Pyo-P2 on potatoes

[0056] 1. Preparation: (1) Pyo-P2 mycelial cakes were inoculated into V8 solid medium and incubated in the dark at 25°C for 3 days to activate them. The activated Pyo-P2 mycelial cakes were inoculated into V8 solid medium and incubated in the dark at 25°C for 10 days. The mycelial cakes were then cut into 5x5 mm mycelial blocks with a scalpel to prepare solid inoculum. (2) The activated Pyo-P2 mycelial cakes were inoculated into V8 liquid medium and incubated in the dark at 25°C for 3 days. The mycelial cakes were filtered through gauze to obtain the fermentation broth.

[0057] 2. Pot experiment: “Dutch 15” potato mini-tubers were selected. Three groups were set up: (1) Control group: nutrient soil; (2) Treatment group 1: nutrient soil and solid inoculant were mixed at a ratio of 200:1 (w / w); (3) Treatment group 2: planted in nutrient soil, and watered with 150 mL of fermentation liquid every 5 days after emergence, for a total of 2 times. One mini-tuber was planted in each pot, and there were 3 replicates in each group. The plants were cultivated under standard greenhouse conditions (25℃ during the day / 18℃ at night, 16 h light / 8 h darkness), and data were recorded one month after emergence.

[0058] 3. Results Statistics: After cultivation, the plant height was measured. The results are as follows: Figure 2 As shown in Table 3, the plant height index of the Pyo-P2 treatment group was significantly better than that of the control group, indicating that both the Pyo-P2 inoculant and the fermentation broth can significantly promote the growth of potato plants.

[0059] Table 3. Growth-promoting effect of strain Pyo-P2 on potato.

[0060] Plant height ± standard deviation (cm) Increase rate control group 26.84±0.94 / Processing Group 1 32.46±0.46 20.83% Processing Group 2 31.37±0.14 16.87%

[0061] Example 4: Preliminary detection of root-promoting effect of strain Pyo-P2 on rice

[0062] 1. Preparation: (1) Pyo-P2 mycelium was inoculated into V8 solid medium and incubated in the dark at 25°C for 3 days for activation. The activated Pyo-P2 mycelium was then inoculated into V8 liquid medium and incubated in a shaker at 25°C for 3 days. The resulting product was used as a mixture of mycelium and fermentation broth. (2) The activated Pyo-P2 mycelium was inoculated into V8 liquid medium and incubated in a shaker at 25°C for 3 days. The culture broth was centrifuged at 8000 r / min for 10 minutes. The supernatant was collected and filtered through 4 layers of sterile filter paper. The resulting product was used as the fermentation broth.

[0063] 2. Pot experiment: "Nipponbare" seeds were selected and those with uniform germination and growth were planted after germination. Each group had 3 replicates. Three groups were set up: (1) Control group: nutrient soil; (2) Treatment group 1: nutrient soil planting. Starting from the 7th day after planting, 150 mL of a mixture of bacterial cells and fermentation liquid was applied every 3 days; (3) Treatment group 2: nutrient soil planting. Starting from the 7th day after planting, 150 mL of fermentation liquid was applied every 3 days. The plants were cultured under standard greenhouse conditions (28℃ during the day / 25℃ at night, 14 h light / 10 h darkness), and data were recorded one month after emergence.

[0064] 3. Results Statistics: After cultivation, root length and fresh weight were measured. The results are shown in Table 4 and... Figure 3 As shown, the root length index of the Pyo-P2 treatment group was significantly better than that of the control group, indicating that both the Pyo-P2 bacterial agent and the fermentation broth can significantly promote the root growth of rice plants.

[0065] Table 4. Growth-promoting effects of strain Pyo-P2 on rice.

[0066] Group Root length ± standard deviation (cm) Root length growth rate Fresh weight ± standard deviation (g) Fresh weight growth rate control group 9.40 ± 0.66 / 1.09 ± 0.11 / Processing Group 1 13.23 ± 0.61 40.74% 1.40 ± 0.03 28.44% Processing Group 2 17.33 ± 0.57 84.36% 1.47 ± 0.01 34.86%

[0067] Example 5: Preparation of liquid and solid bacterial inoculants

[0068] Preparation of liquid inoculum: Pyo-P2 strain of Pythium oligandrum was inoculated onto V8 plate medium and activated by static incubation in the dark at 25°C for 3 days; the obtained mycelial blocks were inoculated into V8 liquid medium and fermented by shaking in a shaker at 25°C for 3 days to obtain a fermentation broth rich in mycelia and spores as liquid inoculum.

[0069] Alternatively, the product obtained by concentrating and purifying the fermentation broth can be used as a liquid inoculant.

[0070] Preparation of solid inoculum: Pythium oligospermum strain Pyo-P2 was inoculated onto V8 or CMA agar plates and activated by static incubation at 25°C in the dark for 3 days; the obtained mycelial blocks were inoculated into V8 liquid medium and fermented by shaking in a shaker at 25°C for 3 days to obtain a fermentation broth rich in mycelia and spores; the fermentation broth or mycelia were mixed with sterilized V8 solid medium and solid-state fermented by static incubation at 25°C in the dark for 10 days to obtain the solid inoculum.

[0071] Example 6: Control of soybean root rot by strain Pyo-P2

[0072] 1. Cultivation and Fermentation

[0073] Pyo-P2 mycelial cells were inoculated onto V8 solid medium and activated by static incubation at 25°C in the dark for 3 days. The activated Pyo-P2 mycelial cells were then inoculated onto V8 liquid medium and cultured with shaking at 25°C for 3 days. The culture was then centrifuged at 8000 rpm for 10 minutes. The supernatant was collected and filtered through four layers of sterile filter paper; the resulting product was used as the fermentation broth. The control group for this method was V8 liquid medium.

[0074] 2. Planting of soybean etiolated seedlings

[0075] Mix vermiculite with sterile water until the mixture is moist but not waterlogged. Fill flowerpots (13cm in diameter, 13cm in internal height) with the moistened vermiculite, leaving about 6cm of vermiculite. Sow 10 soybeans (Hefeng 47 variety) in each pot, and sprinkle about 1cm of vermiculite on top of the soybeans. Grow the soybeans in the dark for 3-4 days at 25℃ and 70% relative humidity to obtain yellow soybean seedlings.

[0076] 3. Spraying treatment

[0077] Spray 10 mL of fermentation liquid onto the aboveground part of each soybean etiolated seedling. After spraying, continue to cultivate in the dark in a greenhouse at 25℃ and 70% relative humidity for 24 h. The control group was sprayed with 10 mL of V8 medium. Each treatment was replicated 3 times.

[0078] 4. Pathogen inoculation

[0079] Line a plastic tray with paper towels and moisten them with approximately 20 mL of sterile water. Remove the soybean etiolated seedlings, wash off the soil from their roots, and place them in the tray. Cover the roots with the moistened paper towels to maintain humidity. Add approximately 10 μL of *Phytophthora soyba* P6497 zoospore solution (containing 100 zoospores) to the hypocotyl of each seedling. Wrap the tray with plastic wrap to maintain humidity. Incubate the plastic-wrapped tray at 25°C, 70% relative humidity, and in the dark for 48 hours.

[0080] 5. Observation and statistics of disease incidence

[0081] After 48 hours, the soybean seedlings were removed and the disease incidence was observed. See Table 5 for details. Figure 4 As shown, the lesion length in the Pyo-P2 treatment group was significantly smaller than that in the control group, with an inhibition rate of approximately 89.61%.

[0082] Table 5. Control effect of strain Pyo-P2 on soybean root rot

[0083] Group Lesion length ± standard deviation (cm) Inhibition effect control group 3.85 ± 0.80 / Processing group 0.40 ± 0.10 89.61%

[0084] sequence list

[0085] SEQ ID NO:1

[0086] TAAACTCTCAGTCCCAAATTGGTGTTGTCTCCTTTACCTACCGAAGCAGGCGTCTGAAAACGCTAAACCACACAACCAAGCAACCATATAGCCTAAATCAACCTCACACACGACAGGTACACCTCAAGGAAAAGACAGAAAACTACACTCGCTTAGCTTAACGTCAGGCAAAGCCGAACATACCGCCAATTGAGGTTGCTTCCATATGTCCTAACCGAAGTCGCCCACCAGCGCAAAGCAATCTAAACCGATCACAAAGAGCATAGCATCGCAATTCGCAGACACAAGAAAGAATCAACGTACATTTAAAGGGACTCGAACCATCTTTAAAAAGACAGCGCGAGACACCTCACATTCTGCCATCTCTAATTTTGACTACACAAAAAAAGAAAGGCAAGTTTGATGTACGGACACTGATACAGGCATACTTCCAGGCATAACCCGAAAGTGCAATATGCGTTCAAAATTTCGATGACTCACTGAATTCTGCAATTCGCATTACGTATCGCAGTTCGCAGCGTTCTTCATCGATGTGCGAGCCTAGACATCCACTGCTGAAAGTTGTTAATTGTTAAAACCAAAAACTTTCGTATTCGGAGTATAGTTCAGTATTAAGTAATAGG

[0087] SEQ ID NO:2

[0088]

Claims

1. A strain of Pythium oligandrum, strain Pyo-P2, characterized in that, The preservation number of the Pythium oligandrum strain Pyo-P2 is CGMCC No. 42579.

2. Use of the Pythium oligandrum strain Pyo-P2 according to claim 1 for at least one of promoting crop growth, inhibiting plant pathogenic fungi and preparing a microbial formulation for controlling crop diseases, characterized in that, The crop is at least one of potato, rice and soybean; the plant pathogen is at least one of Phytophthora sojae, Phytophthora infestans, Rhizoctonia solani and Fusarium graminearum; and the crop disease is root rot caused by Phytophthora sojae.

3. A microbial preparation, characterized in that, The active ingredient of the microbial preparation comprises at least one of mycelium, spores and fermentation broth of the Pythium oligandrum strain Pyo-P2 of claim 1.

4. The microbial preparation according to claim 3, characterized in that, The microbial preparation is: (a) a solid inoculum comprising mycelium and / or spores of the Pythium oligandrum strain Pyo-P2; or (b) a liquid inoculum comprising fermentation broth of the Pythium oligandrum strain Pyo-P2.

5. Use of the microbial preparation of claim 3 or 4 in promoting growth of at least one of potato, rice and soybean.

6. Use of the microbial preparation of claim 3 or 4 in preventing and treating root rot caused by Phytophthora sojae.

7. A method of promoting the growth of a crop and / or controlling a disease of a crop, characterised in that, The Pythium oligandrum strain Pyo-P2 of claim 1 or the microbial preparation of claim 3 is applied to a crop or a crop growing environment; the crop is at least one of potato, rice and soybean; and the crop disease is root rot caused by Phytophthora sojae.

8. The method of claim 7, wherein, The application mode includes root irrigation, soil mixing or spraying.