Phytopathogenic pythium arginine methyltransferase protein and its coding gene and application

Abstract

This invention discloses an arginine methyltransferase protein from *Phytophthora* plant pathogenic oomycetes, its encoding gene, and its applications. The arginine methyltransferase protein provided by this invention is shown in sequences 6-8; its encoding gene is shown in sequences 1-3. Experiments have demonstrated that the protein of this invention plays an important role in the growth, development, and pathogenicity of *Phytophthora capsici*, a typical plant pathogenic oomycete. The absence or reduced expression level of this protein leads to slower mycelial growth rate, reduced sporangium production, decreased zoospore numbers, and reduced pathogenicity of *Phytophthora capsici*. Corresponding arginine methyltransferase inhibitors exhibit varying degrees of activity against typical plant pathogenic oomycetes such as *Phytophthora capsici*, *Phytophthora soybeani*, and *Phytophthora pathogenica*. The gene provided by this invention has significant application potential in the prevention and control of crop blight caused by *Phytophthora* plant pathogenic oomycetes. Novel fungicides developed based on this protein as a target have important practical significance for controlling the occurrence and spread of crop blight caused by *Phytophthora*.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the arginine methyltransferase protein and its encoding gene from the plant pathogenic oomycete Phytophthoras pp. and its applications. Background Technology

[0002] Oomycetes are widely distributed, with hosts spanning both the plant and animal kingdoms. Although morphologically similar to fungi, they are evolutionarily closer to diatoms and brown algae. Plant pathogenic oomycetes infect a wide variety of crops, causing severe agricultural and economic losses worldwide. They account for approximately 60% of all oomycetes and can be categorized into genera such as *Phytophthora*, *Pythium*, and *Peronospora*. Among these, *Phytophthora* spp. are particularly harmful in agricultural production, with six species, including *Phytophthora infestans*, *Phytophthora sojea*, and *Phytophthora capsici*, listed as one of the world's ten most important plant pathogenic oomycetes. Phytophthora capsici is a non-specific parasitic fungus with a wide host range, infecting more than 70 kinds of vegetable crops from 26 families, including Solanaceae, Leguminosae, and Cucurbitaceae. Phytophthora capsici causes disease from the seedling stage to the fruiting stage, leading to root and stem rot and fruit rot. In severe cases, it can cause the entire plant to wilt or even collapse, significantly impacting crop yield and quality and causing serious economic losses. Currently, control of oomycete pathogens causing crop diseases mainly relies on chemical methods. Due to certain phylogenetic differences between oomycetes and filamentous fungi, the selection of agents specifically targeting oomycetes is relatively limited. Commonly used agents in production, such as metalaxyl and cymoxanil, were developed between the 1970s and 1990s. Long-term large-scale use in production has led to increasingly serious resistance problems. Therefore, the development of novel target-based fungicides for oomycetes is particularly important and urgent. The development and utilization of molecular targets for green pesticides has become a major national need.

[0003] In recent years, post-translational modifications (PTMs) of proteins have become a focus of molecular biology research due to their important role in expanding the functional diversity and complexity of the proteome. Among them, arginine methyltransferases (PRMTs), as key proteins regulating upstream signaling pathways, are responsible for catalyzing the arginine methylation modification of histones, RNA-binding proteins, and other key target proteins, playing a crucial role in intracellular transcriptional regulation, RNA splicing, DNA repair, and signal transduction. Arginine methyltransferase 5 (PRMT5) is a type II PRMT that catalyzes symmetric dimethylation (SDMA) of the arginine side chain. Typical substrates modified include histones and ribosomal proteins, and transcriptional regulation pathways and spliceosome function are affected by PRMT5. In addition, PRMT5 plays a critical role in mammalian cell differentiation and embryonic development; studies in mice have shown that deletion of the gene encoding this protein leads to mouse death. In humans, PRMT5 has been found to be expressed at high levels in various cancer cells, and some PRMTs can affect cancer cell proliferation by modifying the methylation of other proteins. Due to its high expression in cancer cells such as breast cancer, colon cancer, and prostate cancer, PRMT has become a popular target for treating solid tumors and hematological malignancies. To date, more than 10 small molecule compounds designed based on the structure of the human PRMT5 protein, including EPZ015938, PF-06939999, and JNJ-64619178, have entered clinical trials. These compounds hold promise as a new class of oral drugs for cancer treatment.

[0004] Currently, the biological functions of arginine methylation modification and PRMT-related genes in plant pathogens, especially oomycetes, remain unclear. This invention conducts a functional study on arginine methyltransferase 5 (PRMT5) of Phytophthora oomycetes and explores its feasibility as a molecular target for fungicides. This has important guiding significance for the prevention and control of crop diseases caused by Phytophthora oomycetes and the creation of novel fungicides. Summary of the Invention

[0005] Based on the research on the function of PcPRMT5 protein in Phytophthora capsici, a typical pathogenic oomycete of the Phytophthora genus, the inventors will provide a reference and guidance for a deeper understanding of the role of arginine methylation modification in regulating the growth and development of Phytophthora genus pathogenic oomycetes and their interaction with the host, and for the design of novel targets for the control of oomycetes.

[0006] Based on Clastal W comparisons of the amino acid sequences of PRMT5 (PcPRMT5, PsPRMT5, PiPRMT5) from three typical Phytophthora species—*Phytophthora capsici*, *Phytophthora davidii*, and *Phytophthora viridiflora*—with human PRMT5, the results showed that the amino acid sequence similarity between the PRMT5 proteins from these three Phytophthora species exceeded 90%, while the similarity to human PRMT5 was 63.17%, 63.32%, and 61.56%, respectively. Furthermore, the PRMT5 proteins from these three Phytophthora species all possessed PRMT-specific protein motifs (Motif I, Post I, Motif II, Motif III, THW loop). Phylogenetic analysis of arginine methyltransferase protein sequences from three Phytophthora species and several model organisms using MEGA 11.0 revealed that the PRMT5 proteins (PcPRMT5, PsPRMT5, PiPRMT5) of the three Phytophthora species clustered with human PRMT5, indicating a direct homology between Phytophthora PRMT5 and human PRMT5. Predicted functional domains of PRMT5 from the three Phytophthora species showed that each contains one PRMT5 TIM barrel domain (PRMT5-TIM), one PRMT5 arginine-N-methyltransferase domain (PRMT5-N), and one PRMT5 Cterminal domain (PRMT5-C). These results suggest that PRMT5 is evolutionarily conserved across species and plays a relatively similar role in different organisms.

[0007] Post-translational modifications such as phosphorylation and glycosylation extend beyond the genome's coding, greatly expanding protein functional diversity and playing a crucial role in protein stability, subcellular localization, and protein-protein interactions. Using bioinformatics methods, we predicted several common post-translational modifications on three Phytophthora PRMT5 proteins, including SUMOylation of lysine at position 97 (97K), N-glycosylation of aspartic acid at position 183 (183N), and phosphorylation of threonine at position 175 (175T). Identifying specific post-translational modifications at these sites provides valuable insights for further functional studies of Phytophthora PRMT5 pathogens.

[0008] Among the oomycete pathogens of the genus *Phytophthora*, a mature gene editing technology based on the CRISPR / Cas9 system has been established for *Phytophthora capsici*, offering advantages such as simple genetic manipulation and abundant strain materials. The inventors used the standard strain LT1534 of *Phytophthora capsici* as a model and studied the gene function of PcPRMT5 using bioinformatics analysis and gene editing techniques. By screening and comparing the phenotypic differences between mutants and wild-type and empty vector control strains, the influence of PPRMT5 in *Phytophthora* on the growth, development, and pathogenicity of the pathogen was analyzed. The high sequence similarity and genetic conservation of PRMT5 among three common *Phytophthora* pathogens—*Phytophthora capsici*, *Phytophthora soybean*, and *Phytophthora pathogenica*—fully demonstrates, from a biological perspective, the important function of this type of gene in *Phytophthora* pathogens.

[0009] Based on research on PRMT5 in oomycete pathogens, such as *Phytophthora capsici*, and the high conservation of PRMT5 among these pathogens, it demonstrates its potential as a novel fungicide. Meanwhile, as a promising target, PRMT5 has shown great potential in cancer treatment in humans and mammals. Currently, approximately thirty PRMT5 inhibitors are in development, with about half in clinical trials. The most advanced is GSK3326595, jointly developed by Epizyme and GlaxoSmithKline (GSK), which is currently in Phase II clinical trials. In addition, domestic innovative pharmaceutical companies such as CSPC Pharmaceutical Group and Simcere Pharmaceutical also have related products in development.

[0010] There are three main modes of PRMT5 inhibitors: 1. SAM competitive inhibitors: PRMT5's binding pocket to its methyl donor, S-adenosylmethionine (SAM), is highly conserved. SAM competitive inhibitors prevent methylation by competitively binding to PRMT5. 2. Catalytic site inhibitors: These inhibitors directly target the catalytic site of PRMT5, blocking its enzymatic activity. 3. Substrate competitive inhibitors: These inhibitors compete with protein or peptide substrates for binding to PRMT5, thereby preventing PRMT5 from methylating its specific target substrate.

[0011] To examine the potential of PRMT5 protein as a fungicide target for Phytophthora oomycetes, the protein structures of PRMT5 from three Phytophthora oomycetes were predicted using AlphaFold2. Virtual screening of small molecule active compounds was performed using the Schrodinger Maestro 12.8 software, with ligands from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ). Based on the binding affinity of PRMT5 protein to small molecule compounds and the structures of the small molecule compounds, nine compounds were selected. Their inhibitory activity against the mycelial growth of the three Phytophthora species was measured, ultimately identifying three small molecule inhibitor lead compounds. Molecular docking of these three small molecule inhibitor lead compounds with the PRMT5 proteins of *Phytophthora capsici*, *Phytophthora sacchari*, and *Phytophthora viridiflora* showed good binding affinity to these three *Phytophthora* PRMT5 proteins. These results strongly suggest that PRMT5 protein possesses the potential to serve as a molecular drug target for Phytophthora oomycetes and has significant application prospects.

[0012] Therefore, one objective of this invention is to provide a class of arginine methyltransferase 5 (PRMT5) proteins from Phytophthora capsici, and to name them based on the initial letter of the Latin name of different Phytophthora species plus PRMT5. For example, Phytophthora capsici arginine methyltransferase 5 (PcPRMT5) is a protein with the following structure: A1), A2), A3), or A4.

[0013] A1) The amino acid sequence is that of a protein as shown in any of 6-8 of the sequence listing;

[0014] A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a protein as shown in any of sequences 6-8;

[0015] A3) Proteins derived from the amino acid sequences shown in any of sequences 6-8, having the same function as those shown in sequences 6-8, by substitution and / or deletion and / or addition of one or more amino acid residues.

[0016] A4) An amino acid sequence that has a similarity of 75% or more, preferably 85% or more, and more preferably 95% or more to the amino acid sequence shown in any one of sequences 6-8, and has the same function as the amino acid sequence shown in any one of sequences 6-8.

[0017] To facilitate the purification of proteins in A1, tags such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), and c-myc (EQKLISEEDL) can be attached to the amino or carboxyl terminus of proteins composed of amino acid sequences as shown in any of sequences 6-8 in the sequence listing.

[0018] The growth and development regulatory proteins in A1)-A4) above are generally derived from pathogenic oomycetes of the genus *Phytophthora* in nature. In other words, they are generally natural products, but can also be artificially expressed or synthesized. Alternatively, their encoding genes can be synthesized first, followed by biological expression. The encoding genes of the proteins in A2)-A4) above can be obtained by deleting one or more amino acid residues from the DNA sequences shown in sequences 1-6 of the sequence listing, and / or by performing missense mutations on one or more nucleotide pairs, and / or by attaching the coding sequence of the aforementioned tag to its 5' end and / or 3' end.

[0019] In A1), sequence 4 (PcPRMT5) consists of 629 amino acid residues, sequence 5 (PsPRMT5) consists of 630 amino acid residues, and sequence 6 (PiPRMT5) consists of 602 amino acid residues.

[0020] A second objective of this invention is to provide the nucleic acid molecule required to encode the PRMT5 protein of *Phytophthora* plant pathogens. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; it can also be RNA, such as mRNA, hnRNA, or tRNA.

[0021] The gene encoding the PRMT5 protein is either B1), B2), or B3):

[0022] B1) A DNA molecule showing the nucleotide sequence described in any one of sequences 1-3 in the sequence listing;

[0023] B2) has 75% or more, 85% or more, or 95% or more identity with the nucleotide sequence shown in B1), and is a cDNA molecule or DNA molecule encoding the PRMT5 protein of the above-mentioned Phytophthora plant pathogenic oomycetes.

[0024] B3) hybridizes with the nucleotide sequence defined by B1) or B2) under strict conditions and is a cDNA molecule or DNA molecule encoding the PRMT5 protein described above.

[0025] In this invention, the DNA sequence (coding gene and cDNA) required to encode the PRMT5 protein of *Phytophthora* plant pathogens can be specifically shown as sequences 1-3 in the sequence listing. Sequence 1 (PcPRMT5) in the sequence listing consists of 2958 nucleotides; the coding sequence is located at positions 6-71, 148-197, 271-853, 899-1574, and 1641-2173 from the 5' end of sequence 1, encoding the protein PcPRMT5 shown in sequence 6 of the sequence listing. Sequence 2 (PsPRMT5) in the sequence listing consists of 2174 nucleotides; the coding sequence is located at positions 6-71, 148-197, 271-853, 899-1574, and 1641-2173 from the 5' end of sequence 2, encoding the protein PsPRMT5 shown in sequence 7 of the sequence listing. Sequence 3 (PiPRMT5) in the sequence listing consists of 2166 nucleotides; the coding sequence is the nucleotides from the 5' end of sequence 3 at positions 150-184, 258-822, 888-1563, 902-1577, and 1634-2166, which encode the protein PiPRMT5 shown in sequence 8 of the sequence listing.

[0026] The third aspect of this invention provides a raw RNA sequence transcribed from any of the above DNA sequences, or a codon-optimized RNA sequence, wherein the sequence of the RNA molecule is as follows (C1) or (C2):

[0027] C1) An RNA sequence transcribed from a DNA sequence as shown in any one of sequences 1-3 has a similarity of 75% or more, more preferably 85% or more, and more preferably 95% or more, and has the same function as the RNA sequence transcribed from the DNA sequence as shown in sequences 1-3.

[0028] C2) An RNA sequence transcribed from a DNA sequence as shown in any one of sequences 1-3.

[0029] The DNA sequence of the present invention, under stringent conditions, can hybridize with any one of the DNA sequences shown in sequences 1-6 of the sequence listing and encode a DNA sequence encoding a protein as shown in any one of sequences 6-8 of the sequence listing. The stringent conditions can be hybridization at 65°C using a solution of 6×SSC, 0.5% SDS, followed by washing once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0030] The fourth objective of this invention is to provide the above-mentioned nucleic acid molecule-related biological materials, including recombinant vectors, expression cassettes, recombinant microorganisms, or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector or a recombinant cloning vector. In the above-mentioned biological materials, the vector can be a plasmid, granule, bacteriophage, or viral vector; the microorganism can be yeast, bacteria, algae, or fungi, such as Agrobacterium; the transgenic plant cell line does not include propagation material. Specifically, it can be any one of the following D1) to D10):

[0031] D1) An expression cassette containing the encoded gene;

[0032] D2) A recombinant vector containing the coding gene, or a recombinant vector containing the expression cassette described in D1);

[0033] D3) Recombinant microorganisms containing the coding gene, or recombinant microorganisms containing the expression cassette of D1), or recombinant microorganisms containing the recombinant vector of D2);

[0034] D4) A transgenic plant cell line containing the coding gene, or a transgenic plant cell line containing the expression cassette described in D1);

[0035] D5) Transgenic plant tissue containing the coding gene, or transgenic plant tissue containing the expression cassette described in D2);

[0036] D6) A transgenic plant organ containing the coding gene, or a transgenic plant organ containing the expression cassette described in D2);

[0037] D7) Nucleic acid molecules that inhibit the expression of the coding gene; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the coding gene, or a nucleic acid molecule that silences the coding gene, or it may be an sgRNA fragment that encodes the target gene to be knocked out, such as the sgRNA sequence (coding sequence) CTTCTCCAGCGCCTGAGTGA that targets the PcPRMT5 coding gene.

[0038] D8) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in D7);

[0039] D9) Nucleic acid molecules that inhibit the translation of the aforementioned RNA molecules;

[0040] D10) produces expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines that generate the nucleic acid molecules described in D9).

[0041] The fifth objective of this invention is to provide the application of Phytophthora PRMT5, nucleic acid molecules encoding the PRMT5 protein of Phytophthora PRMT5, and biomaterials containing nucleic acid molecules encoding the PRMT5 protein of Phytophthora PRMT5.

[0042] The application is any one or more of the following 1)-5):

[0043] 1) Application in regulating (increasing or decreasing) the number of sporangia, sporangial development capacity and / or zoospore production of Phytophthora spp. pathogenic oomycetes;

[0044] 2) Application in regulating (increasing or decreasing) the mycelial growth rate of Phytophthora spp. pathogenic oomycetes;

[0045] 3) Application in regulating (enhancing or reducing) the ability of Phytophthora spp. to infect hosts;

[0046] 4) Application in regulating (enhancing or reducing) the pathogenicity of Phytophthora oomycetes to their hosts;

[0047] 5) Application in inhibiting and / or killing pathogenic oomycetes of the genus Phytophthora.

[0048] Preferably, the application includes the application described in 1)-5) by inhibiting transcription or inactivating the coding genes described in sequences 1-3, or inhibiting the translation of the RNA molecules, or inhibiting or (completely) inactivating the PRMT5 protein of Phytophthora spp. described in sequences 6-8.

[0049] In the aforementioned applications, the growth rate of mycelium, the production of zoospores, and the ability to infect hosts are interfered with by inhibiting the transcription of the coding genes described above, or inhibiting the translation of the RNA sequences described above, or inhibiting and / or inactivating the activity of the PRMT5 protein of Phytophthora spp., thereby inhibiting and / or killing the growth of Phytophthora spp.

[0050] The sixth objective of this invention is to provide the application of the PRMT5 protein of Phytophthora spp. shown in sequences 6-8 of the sequence listing and the coding genes shown in sequences 1-3 of the above sequence listing as targets for screening antibacterial or fungicidal agents against Phytophthora capsici.

[0051] The seventh objective of this invention is to provide a method for screening or assisting in the screening of antibacterial and / or fungicidal agents against Phytophthora capsici. The method includes applying a test substance to the Phytophthora capsici pathogen. When the test substance can inhibit the transcription of the DNA sequence as shown above, or inhibit the translation of the RNA sequence as shown above, or inhibit or deactivate the PRMT5 protein of the Phytophthora genus plant pathogenic oomycetes as shown above, the test substance is a candidate antibacterial and / or fungicidal agent against Phytophthora capsici.

[0052] The eighth objective of this invention is to provide a method for reducing the activity of Phytophthora spp. pathogenic oomycetes (e.g., Phytophthora capsicum), comprising the following steps: inhibiting or deleting the transcription of the coding gene as described above, or inhibiting the translation of the RNA molecule described above, or inhibiting or deactivating the PRMT5 protein of Phytophthora spp. pathogenic oomycetes as described above.

[0053] The reduction of the activity of Phytophthora spp. is to reduce the infectivity and / or pathogenicity of Phytophthora spp. to the host, and / or reduce the growth rate of Phytophthora spp., and / or inhibit the production of zoospores of Phytophthora spp.

[0054] In the above method, the activity of the protein is inhibited or rendered inactive by suppressing or reducing the expression of the gene encoding the PRMT5 protein of Phytophthora spp., specifically by gene knockout or gene silencing.

[0055] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is achieved by altering the DNA sequence to inactivate a specific target gene.

[0056] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing can occur at two levels: one is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects; the other is post-transcriptional gene silencing, which is the loss of gene activity at the post-transcriptional level through specific inhibition of target RNA, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0057] Preferably, the proteins represented by sequences 1-3 in the sequence listing are knocked out, thereby causing the proteins represented by sequences 6-8 in the sequence listing to lose their activity.

[0058] In one embodiment of the present invention, the method for knocking out the above-mentioned gene is based on the CRISPR / Cas9 gene knockout method.

[0059] Specifically, the CRISPR / Cas9-based gene knockout method involves transfecting the Donor vector and sgRNA expression vector of the target gene, along with the Cas9 expression plasmid, into Phytophthora capsici and screening to obtain recombinant bacteria that have lost the activity of the target knockout protein.

[0060] The Donor vector (e.g., pBS-PcPRMT5-NPTII) is a recombinant vector containing a sequence of 800-1500 bp upstream of the gene to be knocked out, a Donor DNA sequence (which can be an NPTII, GFP, or RFP gene sequence, etc.), and a sequence of 800-1500 bp downstream of the gene to be knocked out, linked sequentially. The sgRNA and Cas9 protein co-expression plasmid is a vector (e.g., pYF515-PcPRMT5) encoding an sgRNA fragment targeting the gene to be knocked out and a DNA sequence expressing the Cas9 protein. The gene to be knocked out is sequences 1-3 from the sequence listing, and the sgRNA sequence targeting the PcPRMT5 gene is sgPcPRMT5:CTCGGACGAGTGCATCCTAG. Preferably, the sgRNA expression plasmid is obtained by using the pYF515 vector as the starting vector and inserting the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PcPRMT5 gene between the Nhe I and Bsa I enzyme recognition sites of the pYF515 vector.

[0061] In the above applications, the substance that inhibits the expression and / or activity of PcPRMT5 protein is a substance that inhibits the expression of PcPRMT5 protein and / or inhibits the transcription of the gene encoding PcPRMT5 protein and / or inhibits the translation of RNA molecules obtained from the transcription of the gene encoding PcPRMT5 protein.

[0062] Experiments have demonstrated that the PcPRMT5 protein provided by this invention plays a crucial role in the growth, development, and pathogenicity of *Phytophthora capsici*. A PcPRMT5 gene knockdown mutant was obtained using CRISPR / Cas9 gene editing technology. Compared to the wild-type and empty vector strains, the PcPRMT5 gene knockdown heterozygous mutant exhibited significantly reduced mycelial growth rate, sporangium production, and zoospore production, resulting in a significantly weakened ability to infect host plants tobacco and pepper. The PcPRMT5 replenished strain showed no significant difference in mycelial growth rate, sporangium production, and zoospore production compared to the wild-type, but its pathogenicity to host plants tobacco and pepper could not be restored to a level comparable to the wild-type.

[0063] Therefore, this indicates that the PcPRMT5 protein of *Phytophthora capsici* plays an important role in multiple processes, including vegetative growth, asexual reproduction, and host infection. This invention provides technical support for research into the pathogenic mechanism of *Phytophthora capsici* and provides a research foundation for potential molecular targets for the control of plant diseases caused by oomycetes and the development of novel fungicides.

[0064] Experiments have demonstrated that the proteins of this invention play a crucial role in the growth, development, and pathogenicity of *Phytophthora capsici*, a typical plant pathogen of the *Phytophthora* genus. The absence or reduced expression of these proteins leads to slower mycelial growth, decreased sporangium production, reduced zoospore numbers, and decreased pathogenicity of *Phytophthora capsici*. Corresponding arginine methyltransferase inhibitors exhibit varying degrees of activity against typical plant pathogens such as *Phytophthora capsici*, *Phytophthora soybeani*, and *Phytophthora virosa*. The genes provided by this invention have significant application potential in the prevention and control of crop blight caused by *Phytophthora* plant pathogens. Novel fungicides developed based on these proteins as targets have important practical significance for controlling the occurrence and spread of crop blight caused by *Phytophthora*. Attached Figure Description

[0065] Figure 1 (a) Schematic diagram of the PRMT5 domain in *Phytophthora capsici*, *Phytophthora sacchari*, *Phytophthora virulence*, and humans. (b) Model diagram of the PRMT5 protein structure in *Phytophthora capsici*, *Phytophthora sacchari*, *Phytophthora virulence*, and humans. (c) Phylogenetic analysis results of the co-constructed tree of PRMT5 protein sequences of pathogenic oomycetes of the genus *Phytophthora* and arginine methyltransferase protein sequences of various model studies based on MEGA 11.0 (Note: The numbers on the branch lines represent the length of the evolutionary branch; the shorter the branch length, the smaller the difference and the closer the evolutionary distance).

[0066] Figure 2 This is a schematic diagram showing the amino acid sequence alignment of PRMT5 from *Phytophthora capsici*, *Phytophthora sapiens*, and *Phytophthora virosa* with that of multiple model species (Note: Hs: Homo sapiens; At: Arabianopsis thaliana; Pc: *Phytophthora capsici*; Ps: *Phytophthora sojae*; Pi: *Phytophthora infestans*; Ce: *Caenorhabditis elegans*; Dm: *Drosophila melanogaster*).

[0067] Figure 3 Bar charts show the mycelial morphology, mycelial growth rate, sporangium number, zoospore number, and resting spore germination rate of wild-type Phytophthora capsici strain LT1534 (WT), control empty vector strain (CK), PcPRMT5 gene knockdown mutant (Kd_PcPRMT5-1), and PcPRMT5 gene knockdown complement strain (PcPRMT5-C3).

[0068] Figure 4Bar charts show the pathogenicity and lesion area data of wild-type Phytophthora capsici strain LT1534 (WT), control empty vector strain (CK), PcPRMT5 gene knockdown mutant (Kd_PcPRMT5-1), and PcPRMT5 gene knockdown complement strain (PcPRMT5-C3) in tobacco and pepper leaves.

[0069] Figure 5 The results show the toxicity of wild-type Phytophthora capsici strain LT1534, wild-type Phytophthora soybean strain P6497, and wild-type pathogenic Phytophthora DH50 under different concentrations of lead compounds GSK591, JNJ-64619178, and HLCL-61.

[0070] Figure 6 The results show the docking of the PRMT5 protein of Phytophthora capsici, Phytophthora sacchariformis, and Phytophthora viridiformis with the lead compound GSK591.

[0071] Figure 7 The results show the molecular docking of PRMT5 proteins of Phytophthora capsici, Phytophthora sacchariformis, and Phytophthora viridiformis with the lead compound JNJ-64619178.

[0072] Figure 8 The results show the docking of the PRMT5 protein of Phytophthora capsici, Phytophthora sacchariformis, and Phytophthora virosa with the lead compound HLCL-61. Detailed Implementation

[0073] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0074] The standard strain of *Phytophthora capsici*, LT1534, was preserved by the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. It was published in the literature “Wang, W., et al., PcMuORP1, an Oxathiapiprolin-Resistance Gene, Functions as a Novel Selection Marker for Phytophthora Transformation and CRISPR / Cas9 Mediated Genome Editing. Frontiers in Microbiology, 2019.10.” and is publicly available from China Agricultural University.

[0075] Culture medium or reagent formulation:

[0076] 10% V8 solid culture medium: 100mL V8 vegetable juice, 1.4g CaCO3, stir well, dilute 10 times with deionized water, i.e., add 900mL deionized water, add 15g Agar, autoclave at 121℃ for 20min.

[0077] 10% V8 liquid culture medium: 100mL V8 vegetable juice, 1.4g CaCO3, stir well, centrifuge at 12000rpm for 5min, take the supernatant, dilute 10 times with deionized water, and autoclave at 121℃ for 20min.

[0078] Nutrient pea broth (NPB): Add 125g of peas to 1L of deionized water, autoclave at 121℃ for 20min, and filter through gauze to obtain the pea nutrient solution. Mix 2.0g yeast extract, 5.0g glucose, 5.0g mannitol, 5.0g sorbitol, 2.0g CaCO3, 0.1g CaCl2, 0.5g MgSO4, 3.0g KNO3, 1.0g K2HPO4, and 1.0g KH2PO4. Centrifuge at 3000rpm for 10min or let stand for 30min, collect the supernatant, and bring the volume to 1L with the pea nutrient solution. Add 15g agar powder to the solid medium (NPBA), and autoclave for 20min. Before use, add 2mL of vitamin stock solution (Biotin 6.7×10⁻⁶) in a sterile operating room. -7 g / mL; Folic acid 6.7×10 -7 g / mL; L-inositol 4.0×10 -5 g / mL; Nicotinic acid 4.0×10 -5 g / mL; Pyridoxine-HCl 6.0×10 -4 g / mL; Riboflavin 5.0×10 - 5 g / mL; Thiamine-HCl 1.3×10 -3 g / mL) and 2 ml of trace element stock solution (FeC6H5O7·3H2O 5.4×10 g / mL) -4 g / mL; ZnSO4·7H2O 3.8×10 -4 g / mL; CuSO4·5H2O 7.5×10 -4 g / mL; MgSO4·H2O 3.8×10 -5 g / mL; H3BO3 2.5×10 -5 g / mL; Na₂MoO₄·H₂O 3.0×10⁻⁶ g / mL -5 g / mL).

[0079] Pea Mannitol (PM) medium: 91.1g mannitol, 1g CaCl2, 2g CaCO3, add to about 900mL pea nutrient solution, stir and mix for about 30min, centrifuge at 3000rpm for 10min or let stand for 30min, take the supernatant, and make up to 1L with pea nutrient solution. Add 15g agar powder to solid medium (PMA), and sterilize by moist heat for 20min.

[0080] Mycelial enzymatic hydrolysate (20 mL): 10 mL 0.8 M mannitol, 0.8 mL 0.5 M KCl, 0.8 mL 0.5 M 4-morpholinoethanesulfonic acid, 0.4 mL 0.5 M CaCl2, 0.12 g cellulase (Calbiochem, cat. No. 219466), 0.12 g lyase (Sigma, cat. No. L1412), and sterile ultrapure water to a final volume of 20 mL. Mix well to dissolve, filter through a 0.22 μm filter membrane for sterilization, and prepare fresh before use.

[0081] MMG solution (250mL): 18.22g mannitol, 0.76g MgCl2·6H2O, 2.0mL 0.5M 4-morpholinoethanesulfonic acid (pH=5.7), ultrapure water to a final volume of 250mL, sterilized by filtration through a 0.22μm filter membrane.

[0082] W5 solution: 0.1g KCl, 4.6g CaCl2·2H2O, 2.25g NaCl, 7.8g glucose, dissolved in ultrapure water and brought to a final volume of 250mL, then filtered through a 0.22μm filter membrane for sterilization.

[0083] PEG-CaCl2 solution (40% w / v): 12g PEG 4000, 3.75mL 0.5M CaCl2, 3mL sterile ultrapure water, sterilized by filtration through a 0.22μm filter membrane.

[0084] Example 1: Obtaining the PcPRMT5 protein and its encoding gene from *Phytophthora capsici* and comparing the homology of PRMT5 proteins from *Phytophthora* pathogenic oomycetes.

[0085] In this embodiment, the *Phytophthora capsici* PcPRMT5 protein and its encoding gene (or cDNA) can be obtained by amplification using the DNA (or cDNA) of *Phytophthora capsici* strain LT1534 as a template, through the primers listed in Table 1. The material from which DNA or RNA was extracted was the mycelium of *Phytophthora capsici* strain LT1534. Sequence 1 (PcPRMT5) in the sequence listing consists of 2958 nucleotides; the coding sequence is located at positions 6-71, 148-197, 271-853, 899-1574, and 1641-2173 from the 5' end of sequence 1, encoding the protein PcPRMT5 shown in sequence 6 of the sequence listing. The above protein or gene can also be synthesized artificially.

[0086] The DNA sequence (coding gene and cDNA) of the PRMT5 protein from *Phytophthora* plant pathogens is shown in Sequence 2-3 of the sequence listing. The amino acid sequence of the *Phytophthora soybeanis* PRMT5 protein is shown in Sequence 2 (PsPRMT5) of the sequence listing, which consists of 2174 nucleotides. The coding sequence is located at nucleotides 6-71, 148-197, 271-853, 899-1574, and 1641-2173 from the 5' end of Sequence 2, which encodes the protein PsPRMT5 shown in Sequence 7 of the sequence listing.

[0087] The amino acid sequence of the pathogenic Phytophthora PRMT5 protein is shown in Sequence 3 (PiPRMT5) in the sequence listing. Sequence 3 consists of 2166 nucleotides. The coding sequence is the nucleotides from the 5' end of Sequence 3 at positions 150-184, 258-822, 888-1563, 902-1577, and 1634-2166, which encode the protein PiPRMT5 shown in Sequence 8 of the sequence listing.

[0088] Table 1. Primers for amplifying the full-length coding gene of PcPRMT5

[0089]

[0090] As shown in Table 2, the amino acid sequence similarity of PRMT5 proteins from the three Phytophthora species (PcPRMT5, PsPRMT5, PiPRMT5) exceeds 90%, and their amino acid sequence similarity to human PRMT5 is 63.17%, 63.32%, and 61.56%, respectively. Furthermore, the PRMT5 proteins from the three Phytophthora species all possess the PRMT-specific domain (motif I). Phylogenetic analysis of the co-constructed tree of PRMT5 proteins from the three Phytophthora species and arginine methyltransferase proteins from various model organisms revealed that the PRMT5 proteins from the three Phytophthora species (PcPRMT5, PsPRMT5, PiPRMT5) cluster with human PRMT5, indicating that Phytophthora PRMT5 and human PRMT5 are orthologous proteins. Predictions of the functional domains of PRMT in three Phytophthora species revealed that each of the three Phytophthora species contains one PRMT5 TIM barrel domain (PRMT5-TIM), one PRMT5 arginine-N-methyltransferase domain (PRMT5-N), and one PRMT5 C terminal domain (PRMT5-C). These results suggest that PRMT5 is evolutionarily conserved across species and plays a relatively similar role in different organisms.

[0091] Table 2. Amino acid sequence similarity (%) between PRMT5 of three Phytophthora species and human PRMT5.

[0092]

[0093] Example 2: Construction of the PcPRMT5 gene knockout and complementation vector for Phytophthora capsici

[0094] The method for constructing gene knockout vectors based on CRISPR / Cas9 and the sequences of related vectors in this embodiment have been disclosed in the literature “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of aneffector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139.” and “Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.” The pBluescript II SK+ homologous arm vector plasmid (Donor vector) used in this embodiment was a gift from Professor Brett M. Tyler of Oregon State University, USA. The expression vector pYF515, which fused sgRNA and Cas9, and the Phytophthora expression vector pTOR, which fused 3×Flag tags, were provided by the Plant Pathogen and Fungicide Interaction Laboratory of the College of Plant Protection, China Agricultural University.

[0095] The pBluescript II SK+ vector carries the Donnor and homologous arm fragments. The pYF515 vector is used for transcription to generate sgRNA targeting the target sequence and to express the Cas9 protein for enzyme digestion of the target fragment. The pTOR vector is used for complementary expression of Phytophthora protein. Using the CRISPR / Cas9 system based on non-homologous end joining (NHEJ), the target gene sequence can be edited by designing sgRNA sequences specifically targeting the target protein encoding gene and homologous arm sequences 1000 bp upstream and downstream of the target sequence.

[0096] The specific construction methods of the Donor vector, the homologous arm fragment vector pBS-PcPRMT5-NPTII, the sgRNA transcription and Cas9 protein expression particle pYF515-PcPRMT5, and the complementation vector pTOR-3Flag-PcPRMT5 used in this embodiment are described below:

[0097] 1) Construction of the homologous arm vector of pBS-PcPRMT5-NPTII: Using DNA from Phytophthora capsici strain LT1534 as a template, primers were designed using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to amplify the upstream 1000bp of the target gene PcPRMT5 (shown in sequence 4 in the sequence listing), and amplified using the primers shown in Table 3 as pBS-PcPRMT5-NPTII-F1 and pBS-PcPRMT5-NPTII-R1. The NPTII gene (NPTII gene) was obtained by amplification using the pYF2-Cas9 backbone plasmid as a template, with primers pBS-PcPRMT5-NPTII-F2 and pBS-PcPRMT5-NPTII-R2 as shown in Table 3. The downstream 1000bp sequence of the PcPRMT5 gene (shown in sequence 5 of the sequence listing) was also amplified using primers pBS-PcPRMT5-NPTII-F2 and pBS-PcPRMT5-NPTII-R2 as shown in Table 3. The HD Cloning Kit sequentially fused the three amplified fragments of each of the three genes into the linearized plasmid pBluescript II SK+ (EcoR V digested). The ligation products were then transformed into E. coli DH5α competent cells and cultured overnight at 37°C. Single colonies were picked and verified by PCR using universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') and sequencing was performed.

[0098] 2) Construction of pYF515-PcPRMT5: Using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the online RNA structure analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html), sgRNA sequences specifically targeting the PcPRMT5 gene sequence and with weak secondary structure (sgPcPRMT5: GTACGAAAAGGCCATCACTC, targeting positions 1222-1242 of SEQ ID No. 1 of the PcPRMT5 gene) were selected. Primers containing NheI and BsaI restriction sites and HH ribozyme were synthesized (as shown in Table 3). The mixture was dissolved in sterile water to prepare a 100 μM solution. The double-stranded sgRNA sequence was synthesized by annealing reaction. The reaction system consisted of 3 μL forward strand solution, 3 μL reverse strand solution, 3 μL 10×T4 DNALigase Buffer (NEB), 4 μL 0.5M NaCl, and 21 μL ultrapure sterile water. The mixture was pipetted and stirred, and reacted at 100℃ for 2 min. The mixture was then allowed to cool naturally at room temperature for 4 h. After that, the reaction solution was diluted 500 times. Take 2 μL of 10×T4 DNALigase Buffer (NEB), 50 ng of pYF515 vector (double digested with Nhe I / Bsa I), 4 μL of diluted double-stranded sgRNA solution, 1 μL of T4 DNA Ligase, and sterile ultrapure water to bring the total volume to 20 μL. Incubate at room temperature for 30 min. Transform 5 μL of the ligation product into E. coli DH5α competent cells and culture overnight at 37°C. Then, use primer pair RPL41_Pseq_F (sequence: 5'-CAAGCCTCACTTTCTGCTGACTG-3') / M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') to perform PCR verification on single colonies and sequence to verify positive clones.

[0099] 3) Construction of pTOR-3Flag-PcPRMT5: Using cDNA from *Phytophthora capsici* strain LT1534 as a template, primers were designed using the TaKaRa-In-Fusion Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to amplify the target gene PcPRMT5 CDS fragment for insertion into the vector. The fragment was amplified using primers pTOR-PcPRMT5-CDS-F1 and pTOR-PcPRMT5-CDS-R1 as shown in Table 3. The product solution was recovered using 50 ng of pTOR vector (double digested with Nhe I / Not I), and 4 μL of PcPRMT5 CDS fragment was gel-extracted. The fragment was then processed using In-... The HD Cloning Kit fused the above gene fragments into the linearized plasmid pTOR vector (digested with Nhe I / Not I). The ligation product was then transformed into E. coli DH5α competent cells and cultured overnight at 37°C. Single colonies were picked and verified by PCR using universal primers pTOR_F (sequence: 5'-GCACAGGGATCGTTTCTGAT-3') / pTOR_R (sequence: 5'-GCACAGGGATCGTTTCTGAT-3') and sequencing was performed.

[0100] Table 3. Primers used for constructing and amplifying the PcPRMT5 gene knockout and complementation vector from Phytophthora capsici.

[0101]

[0102] Example 3: Obtaining the PcPRMT5 gene knockdown mutant and complement strain of Phytophthora capsici

[0103] PcPRMT5 gene knockout mutants were prepared using CaCl2-PEG-mediated protoplast transformation. The method of oomycete genetic transformation was disclosed in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139."

[0104] The gene sequence of the insert fragment PcMuORP1 used in this example was published in the literature “Wang, W., Xue, Z., Miao, J., Cai, M., Zhang, C., Li, T., Zhang, B., Tyler, B. and Liu, X. (2019) PcMuORP1, an Oxathiapiprolin-Resistance Gene, Functions as a Novel Selection Marker for Phytophthora Transformation and CRISPR / Cas9 Mediated Genome Editing. Front. Microbiol. 10, 2402.”

[0105] The single-gene knockout mutant was obtained by combining the knockout vectors from Example 2 (e.g., Donor vector pBS-PcPRMT5-NPTII fused with sgRNA and Cas9 expression vector pYF515-PcPRMT5), and co-transforming them into the wild-type strain LT1534 of *Phytophthora capsici* via PEG-mediated protoplast transformation. After the transformed protoplasts were revived into mycelia, they were covered with G418 V8 solid medium containing 50 μg / ml and incubated in the dark at 25°C. After 2-3 days of selection, mycelia with resistance markers were obtained, and DNA was extracted for PCR verification. RNA was extracted from mutants that tested positive for PCR and verified by RT-qPCR. After repeated attempts, a homozygous knockout mutant of the PcPRMT5 gene was not successfully obtained. Therefore, the heterozygous knockdown mutant Kd_PcPRMT5-1, with a PcPRMT5 expression level below 50% of that in the WT strain, was selected as the research object. Meanwhile, wild-type strains of Phytophthora capsici, which were transformed into the backbone vector plasmid and successfully obtained resistance selection markers, were used as vector control strains (CK).

[0106] The single-gene knockout complement strain was obtained by transforming the vector pTOR-3Flag-PcPRMT5, which contains the PcPRMT5 CDS fragment from Example 2, into the obtained knockdown mutant Kd_PcPRMT5-1 for PcPRMT5 gene complement expression. The strain PcPRMT5-C3, whose expression level was close to that of the wild type, was selected as the research object by RT-qPCR detection.

[0107] Example 4: Biological trait analysis of the PcPRMT5 gene sequence knockout mutant of Phytophthora capsici

[0108] I. Mycelial Growth Rate Detection

[0109] Wild-type Phytophthora capsici strain LT1534 (WT), vector control (CK), the PcPRMT5 heterozygous knockdown mutant obtained in Example 3 (Kd_PcPRMT5-1), and the PcPRMT5 complement strain obtained in Example 4 (PcPRMT5-C3) were inoculated in the center of a 90 mm V8 solid plate and cultured at 25°C in the dark for 3 days. The colony diameter of each strain was measured using the cross-cross method. Each strain was recorded in 3 technical replicates and 3 biological replicates were performed.

[0110] The results are as follows Figure 3 As shown, the mycelial growth rate of the PcPRMT5 knockdown mutant was significantly lower than that of the wild-type, CK, and complement strains (*, P<0.05). The experimental results indicate that the decreased expression level of PcPRMT5 affects the mycelial growth rate of *Phytophthora capsici*.

[0111] II. Detection of sporangium and zoospore counts

[0112] Wild-type Phytophthora capsici strain LT1534 (WT), vector control (CK), the PcPRMT5 heterozygous knockdown mutant obtained in Example 3 (Kd_PcPRMT5-1), and the PcPRMT5 complement strain obtained in Example 4 (PcPRMT5-C3) were inoculated into the center of 90 mm V8 solid plates and cultured at 25°C in the dark for 3 days, followed by 3 days of alternating light / dark conditions at 25°C to induce sporangium production. The morphology and number of sporangia in the plates were then observed under a microscope at 100x magnification. Plates treated with the same light-induced sporangium production were completely immersed in 15 ml of pre-chilled sterile liquid and placed at 4°C for 30 min, then at room temperature (25°C) for 30 min to induce zoospore release. The zoospore suspension in the plates was aspirated and observed under a microscope at 100x magnification using a hemocytometer, and the number was recorded. Three technical replicates and three biological replicates were performed for each strain.

[0113] The results are as follows Figure 3 As shown, the number of sporangia and zoospores in the PcPRMT5 knockdown mutant was significantly lower than that in the wild-type, CK, and complement strains (*, P<0.05). Furthermore, some sporangia in the PcPRMT5 knockdown mutant exhibited malformed morphology. These results indicate that reduced PcPRMT5 expression levels have a certain impact on the asexual spore development of *Phytophthora capsici*.

[0114] III. Morphological Detection and Germination Rate Statistics of Resting Species

[0115] Zoospores of wild-type *Phytophthora capsici* strain LT1534 (WT), vector control (CK), the heterozygous knockdown mutant of PcPRMT5 obtained in Example 3 (Kd_PcPRMT5-1), and the complement strain of PcPRMT5 obtained in Example 4 (PcPRMT5-C3) were obtained using the above method. The zoospore suspensions of each strain were vortexed for 1 min to obtain resting spore suspensions, which were then incubated in the dark at 25℃ for 4 h. The morphology of the resting spores in each treatment was observed and photographed under a microscope at 100x magnification, and the germination rate of resting spores in each field of view was counted based on the photographs at the same time point. Three technical replicates and three biological replicates were performed for each strain.

[0116] The results are as follows Figure 3 As shown, the germination rate of dormant spores in the PcPRMT5 knockdown mutant was not significantly different from that in the WT, CK, and complement strains (*, P<0.05), indicating that PcPRMT5 does not affect the germination of dormant spores of Phytophthora capsici.

[0117] IV. Statistical Analysis and Observation of Pathogenicity Results

[0118] The plants used in the experiment were horn pepper and tobacco Benzoin. The seedlings were planted in seedling trays (540mm×280mm, 48 cells per tray) with a 2:1 mixture of peat moss and vermiculite, and an appropriate amount of deionized water was added. The seedlings were then cultured in a greenhouse (27±2℃) for 3-4 weeks.

[0119] Using a 5mm circular punch, mycelial cakes were created on solid culture medium of *Phytophthora capsici* V8 cultured for 3-4 days. These cakes were then inoculated onto the undersides of leaves 5-8cm in length, one cake per leaf. After 3 days of incubation at 25℃ in the dark under moist conditions, the area of ​​lesions (mm²) on leaves infected with *Phytophthora capsici* and *Nicotiana benthamiana* was investigated. 2 Each strain was set up with 3 technical replicates and 3 biological replicates.

[0120] The results are as follows Figure 4 As shown, the pathogenicity level of the PcPRMT5 knockdown strain Kd_PcPRMT5-1 on pepper leaves was significantly lower than that of WT, CK, and the complement strain (*, P<0.05), indicating that the PcPRMT5 protein has the ability to affect the infection of host plants by Phytophthora capsici.

[0121] Experiments have demonstrated that the PcPRMT5 protein provided by this invention can affect the growth and development of *Phytophthora capsici* and its infection of host plants. Compared with the wild-type strain and the control strain transformed with an empty vector, the PcPRMT5 knockdown mutant also showed significantly lower mycelial growth levels, sporangium and zoospore numbers, and pathogenicity than the wild-type and control strains. Therefore, by inhibiting or affecting the function of the PcPRMT5 protein, the infection process of *Phytophthora capsici* can be controlled, the disease cycle can be interrupted, and the large-scale occurrence of the disease can be controlled.

[0122] Example 5: Study on the inhibitory activity of small molecule compounds against PRMT5 protein of Phytophthora spp.

[0123] V. Screening and Toxicity Determination of Lead Compounds

[0124] The PRMT5 protein structures of *Phytophthora capsici*, *Phytophthora sacchari*, and *Phytophthora virosa* were predicted using AlphaFold 2. Further, based on the crystal structures of the PRMT5 proteins from each of the three *Phytophthora* species, small molecule active compounds were virtually screened using the Schrodinger Maestro 12.8 software. The ligand small molecule compounds were obtained from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ). In this study, based on the binding affinity of the PRMT5 protein to the small molecule compounds and the structure of the small molecule compounds, nine small molecule compounds were selected. Wild-type *Phytophthora capsici* strain LT1534 and wild-type *Phytophthora sacchari* strain P6497 were inoculated into the center of 90 mm V8 solid plates containing different concentrations (5 μg / mL, 10 μg / mL, 20 μg / mL) of the small molecule compounds, respectively. Wild-type *Phytophthora virosa* strain DH50 was inoculated into the center of 90 mm tomato-rye solid plates containing different concentrations (5 μg / mL, 10 μg / mL, 20 μg / mL) of the small molecule compounds. Wild-type *Phytophthora capsici* strain LT1534 and wild-type *Phytophthora sacchari* strain P6497 were cultured at 25°C in the dark for 3 days, while wild-type pathogenic *Phytophthora* strain DH50 was cultured at 18°C ​​in the dark for 7 days. Colony diameters of each strain were measured using the cross-multiplication method, with three technical replicates and three biological replicates for each treatment. By determining their inhibitory activity against the mycelial growth of the three *Phytophthora* species, three small-molecule inhibitor lead compounds, GSK591, JNJ-64619178, and HLCL-61, were finally screened.

[0125] The molecular formulas of GSK591, JNJ-64619178, and HLCL-61 are shown below:

[0126]

[0127] The results are as follows Figure 5 As shown, the mycelial growth rates of *Phytophthora capsici*, *Phytophthora sacchari*, and *Phytophthora virosa* were significantly lower than their respective DMOS control treatments under three different concentrations of lead compounds GSK591, JNJ-64619178, and HLCL-61 (*, P<0.05). This indicates that some lead compounds targeting PRMT5 can have certain activities against *Phytophthora capsici*, *Phytophthora sacchari*, and *Phytophthora virosa*. The lead compound HLCL-61 showed high inhibitory effects on *Phytophthora capsici*, *Phytophthora sacchari*, and *Phytophthora virosa*, and its EC50 values ​​were significantly lower than those of the control compounds. 50 The concentrations were 7.85, 10.92, and 11.38 μg / mL, respectively. These toxicity assay results demonstrate that the PRMT5 protein of *Phytophthora*, a pathogenic oomycete, has the potential to be developed as a novel fungicide target.

[0128] VI. Molecular docking of PRMT5 protein with compounds GSK591, JNJ-64619178, and HLCL-61 in Phytophthora capsici, Phytophthora sacchariformis, and Phytophthora virosa.

[0129] Molecular docking analysis was performed using Auto Dock Vina software. Ligands were obtained from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ), and receptors were protein structures predicted using AlphaFold 2. First, the ligand molecules obtained from PubChem were preprocessed, including removing water molecules, adding hydrogen atoms, and converting to PDBQT format. Similarly, the receptor structures generated by AlphaFold 2 were preprocessed accordingly. The preprocessed ligand and receptor molecules were imported into Auto Dock Vina, a grid box was set to cover the receptor's active site, and simulations were run to record the binding affinity of each ligand to the receptor. Molecular docking results (…) Figure 6-8The results showed that the binding free energies of lead compound GSK591 with the PRMT5 protein receptors of *Phytophthora capsici*, *Phytophthora saccharina*, and *Phytophthora virosa* were -5.5 Kcal / mol, -6.3 Kcal / mol, and -5.9 Kcal / mol, respectively. The binding free energies of lead compound JNJ-64619178 with the PRMT5 protein receptors of *Phytophthora capsici*, *Phytophthora saccharina*, and *Phytophthora virosa* were -7.9 Kcal / mol, -8.3 Kcal / mol, and -7.6 Kcal / mol, respectively. The binding free energies of lead compound HLCL-61 with the PcPRMT5 protein receptors of *Phytophthora capsici*, *Phytophthora saccharina*, and *Phytophthora virosa* were -6.9 Kcal / mol, -7.1 Kcal / mol, and -7.9 Kcal / mol, respectively. These results indicate that lead compounds GSK591, JNJ-64619178, and HLCL-61 possess a certain binding affinity to the PRMT5 proteins of the three *Phytophthora* species. Conformational analysis revealed that GSK591, JNJ-64619178, and PRMT5d proteins primarily exhibit hydrophobic interactions, while HLCL-61 formed multiple stable hydrogen bonds and hydrophobic interactions. This may be one of the key reasons why it exhibits higher activity than GSK591 and JNJ-64619178. Furthermore, the molecular docking results were consistent with the bioactivity experiments, demonstrating the effectiveness of the molecular docking predictions. These results provide important structural information for further optimization and improvement of lead compounds, and also provide a theoretical basis for designing more specific and efficient agricultural inhibitors.

Claims

1. The application of knocking out the capsicum arginine methyltransferase protein or its encoding gene shown in sequence 6 of the sequence listing, characterized in that: The application is any one or more of the following 1)-3): 1) Application in reducing the number of sporangia and zoospores of Phytophthora capsici; 2) Application in reducing the growth rate of Phytophthora capsici mycelium; 3) Application in reducing the pathogenicity of Phytophthora capsici to peppers or tobacco.

2. Use of biological material associated with the Phytophthora capsici arginine methyltransferase protein, characterized in that: The application is any one or more of the following 1)-3): 1) Application in reducing the number of sporangia and zoospores of Phytophthora capsici; 2) Application in reducing the growth rate of Phytophthora capsici mycelium; 3) Application in reducing the pathogenicity of Phytophthora capsici to peppers or tobacco; The biomaterial is any one of the following D1) to D2): D1) is used to knock out nucleic acid molecules that encode the gene shown in sequence 1 of the sequence listing; D2) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in D1).

3. The application of the *Phytophthora capsici* arginine methyltransferase protein or its encoding gene, as a target for screening antibacterial or fungicidal agents against *Phytophthora capsici*, as shown in Sequence 6 of the sequence listing; if the *Phytophthora capsici* arginine methyltransferase protein shown in Sequence 6 of the sequence listing loses its activity, then the analyte to be tested is the antibacterial or fungicidal agent against *Phytophthora capsici*.

4. A method for screening or assisting in the screening of antibacterial and / or fungicidal agents of Phytophthora spp., the method comprising applying a small molecule inhibitor to Phytophthora capsici to inactivate the Phytophthora capsici arginine methyltransferase protein as shown in Sequence 6 of the sequence listing, wherein the analyte to be tested is an antibacterial and / or fungicidal agent of Phytophthora capsici.

5. A method for reducing the activity of Phytophthora capsici, comprising the following steps: The reduction of the activity of *Phytophthora capsici* is to reduce the pathogenicity of *Phytophthora capsici* to peppers or tobacco, and / or reduce the mycelial growth rate of *Phytophthora capsici*, and / or reduce the production of zoospores; The protein shown in sequence 6 of the sequence listing was inactivated by knocking out the gene shown in sequence 1 of Phytophthora capsici.

Images