Application of lncRNA ABAC1 in enhancing drought resistance in oats
By inhibiting the expression of lncRNA ABAC1 in oats and using techniques such as RNA interference, the gap in the regulation of oat drought resistance has been filled, realizing a new direction for improving oat drought resistance and molecular breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HEBEI UNIVERSITY
- Filing Date
- 2026-04-28
- Publication Date
- 2026-06-26
AI Technical Summary
The lack of research on lncRNAs that negatively regulate drought resistance in oats has affected the progress of drought resistance improvement and molecular breeding.
By reducing or inhibiting the expression of lncRNAABAC1, RNA interference, gene knockout, gene editing, or antisense nucleic acid technology can be used to regulate the expression level of lncRNAABAC1 in oats and enhance their drought resistance.
Significantly regulating the water loss rate and survival rate of oat plants enables targeted improvement of oat drought resistance phenotypes, providing new targets and theoretical basis for molecular breeding of oat drought resistance.
Smart Images

Figure CN122278918A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, and in particular to lncRNA. ABAC1 Application in improving the drought resistance of oats. Background Technology
[0002] Drought stress is one of the major abiotic stresses constraining global agricultural production, severely impacting crop yield and quality. Exploring and utilizing plants' own drought-resistant genetic resources to cultivate new drought-resistant crop varieties is a key strategy for ensuring food security and sustainable agricultural development.
[0003] Long non-coding RNAs (lncRNAs) are a class of transcripts longer than 200 nucleotides that do not encode proteins and play important regulatory roles in plant responses to abiotic stresses, including drought. Currently, in model plants such as rice and Arabidopsis thaliana, there are already [e.g., lncRNAs]. DANA1 , DRIR Positive regulatory lncRNAs for drought resistance have been reported. However, research on lncRNA involvement in drought resistance regulation in oats, an important forage crop of the Poaceae family, is still lacking, especially regarding lncRNAs with negative regulatory functions.
[0004] Therefore, identifying and analyzing lncRNAs with clear drought resistance regulatory functions in oats can not only enrich the functional theory of plant lncRNAs, but also provide new gene targets and regulatory ideas for molecular breeding of drought-resistant oats. Summary of the Invention
[0005] The purpose of this invention is to provide lncRNA. ABAC1 Its application in enhancing oat drought resistance involves reducing or inhibiting lncRNA. ABAC1 Expression can enhance the drought resistance of plants, providing new genetic resources and technical means for the genetic improvement of crop drought resistance.
[0006] To achieve the above objectives, the present invention provides lncRNA. ABAC1 Application of lncRNA in improving drought resistance of oats ABAC1 The amino acid sequence is shown in SEQ ID NO.5.
[0007] Preferably, improving oat drought resistance is achieved by reducing or inhibiting lncRNA. ABAC1 Expression and implementation.
[0008] On the other hand, the present invention provides the above-mentioned lncRNA. ABAC1 Application in the breeding of new oat varieties.
[0009] On the other hand, the present invention also provides a method for improving the drought resistance of oats, including reducing or inhibiting lncRNA in oats. ABAC1 expression levels of lncRNA ABAC1 The nucleotide sequence is shown in SEQ ID NO.5.
[0010] Preferably, lncRNA is reduced or inhibited through RNA interference, gene knockout, gene editing, or antisense nucleic acid technology. ABAC1 The expression.
[0011] Preferably, RNA interference uses targeted lncRNAs. ABAC1 The RNAi vector, and the RNAi target sequence is shown in SEQ ID NO. 12.
[0012] On the other hand, the present invention also provides a molecular marker or target for oat drought-resistant breeding, wherein the molecular marker or target is lncRNA. ABAC1 lncRNA ABAC1 The nucleotide sequence is shown in SEQ ID NO.5.
[0013] On the other hand, the present invention also provides a recombinant expression vector containing lncRNA for silencing. ABAC1 The interfering sequence targets the lncRNA shown in SEQ ID NO.5. ABAC1 .
[0014] Therefore, the lncRNA of this invention ABAC1 Its application in improving the drought resistance of oats has the following beneficial effects: (1) This invention is the first to identify and confirm lncRNA in oats. ABAC1 Its function as a negative regulator of drought resistance.
[0015] (2) Modifying lncRNA through genetic manipulation ABAC1 The expression level can significantly regulate key drought-resistant physiological indicators such as water loss rate and survival rate of oat plants, thereby achieving targeted improvement of oat drought-resistant phenotypes.
[0016] (3) lncRNA ABAC1 The discovery provides a new perspective for understanding the lncRNA regulatory network of drought resistance in plants (especially allopolyploid crops), and provides a new target with independent intellectual property rights for molecular breeding of drought resistance in crops using lncRNA, which has important theoretical value and practical application prospects.
[0017] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Picture 1 lncRNA ABAC1 lncRNA in overexpression transgenic lines and RNAi-silenced transgenic lines ABAC1 The expression level; where A is lncRNA. ABAC1 lncRNA in RNAi transgenic plants ABAC1 The expression level detection results show that B represents lncRNA. ABAC1 lncRNA overexpression in transgenic lines ABAC1 The expression level detection results; Picture 2 To determine lncRNA levels in the aboveground parts and roots of oat plants under drought conditions simulated by PEG6000. ABAC1 Expression level analysis; where a represents lncRNA from the terrestrial region. ABAC1 The expression level of b is the lncRNA in the root of the oat plant. ABAC1 The amount of expression; Picture 3 lncRNAs from the above-ground parts and roots of oat plants under drought conditions on a terrace. ABAC1 Expression level analysis; Picture 4 lncRNAs from the above-ground parts and roots of oat plants under natural drought conditions ABAC1 Analysis of expression levels; where a represents the aboveground parts; b represents the roots; Picture 5 Wild type (WT) ABAC1-OE strains and ABAC1 Phenotypic changes of RNAi lines before and after drought treatment; where A represents wild-type (WT) and ABAC1 Phenotypic changes of RNAi lines before and after drought treatment, B representing wild-type (WT) and ABAC1-OE Phenotypic changes of the strains before and after drought treatment; Picture 6 For drought treatment, wild type (WT) ABAC1-OE strains and ABAC1 Determination of water loss rate of RNAi lines; where A represents wild-type (WT) and... ABAC1 Water loss rate of RNAi lines, B being wild-type (WT) and ABAC1-OE Water loss rate of the strain; Picture 7Wild type (WT) ABAC1-OE strains and ABAC1 Survival determination of RNAi lines; where A represents wild-type (WT) and... ABAC1 Survival rate of RNAi lines, B represents wild-type (WT) and ABAC1-OE Survival rate of the strain. Detailed Implementation
[0020] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0021] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0022] The instruments, equipment, reagents, and materials used in the examples were all obtained commercially.
[0023] Example 1 lncRNA ABAC1 Cloning and vector construction include the following steps: S1. Using cDNA from leaves of the oat variety "Mengyan No. 1" as a template, primers were designed based on its known sequence, and lncRNA was obtained by RACE technology. ABAC1 The full-length sequence.
[0024] 5' RACE primer: 5'RACE-F, SEQ ID NO.1: CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT.
[0025] 5'RACE-R, SEQ ID NO.2: GATTACGCCAAGCTTTTCTATGTCA CGAGGGAGAAGG.
[0026] 3' RACE primer: 3'RACE-F, SEQ ID NO.3: GATAGATCATATTTTTTTGGGACAA.
[0027] 3'RACE-R, SEQ ID NO.4: GCCCTATAGTGAGTCGTATTAG.
[0028] lncRNA ABAC1 The nucleotide sequence is shown in SEQ ID NO.5.
[0029] SEQ ID NO.5:
[0030] S2. The obtained full-length sequence was ligated downstream of the 35S promoter of the plant overexpression vector pCambia3300-35S::GFP to construct the overexpression vector pCambia3300-35S::ABAC1. The construction of the overexpression vector pCambia3300-35S::ABAC1 was performed using the NC cloning kit (Nixing Biotechnology). First, the introductory vector was ligated using the pNC-AEnTopo blunt-end cloning vector kit (NC007), and then the expression vector was ligated using the NC cloning kit (NC001).
[0031] S3, targeting lncRNA ABAC1 The specific sequence was designed as an RNAi target, and then constructed into the RNAi silencing vector pHk-35S-RNAi to construct the silencing vector pHk-35S-ABAC1-RNAi. The steps are as follows: ① Select targets and design forward, reverse, and loop primers according to the instructions of the RNAi vector kit (RCE20M).
[0032] Forward target primers: F, SEQ ID NO. 6: cagtGGTCTCacaacTTCCCTCCCCAATTTCTAGCT.
[0033] R, SEQ ID NO. 7: cagtGGTCTCacaggCCTACAGGCTGGCGAGGGGA.
[0034] Reverse target primers: F, SEQ ID NO. 8: cagtGGTCTCagggcCCTACAGGCTGGCGAGGGGA.
[0035] R, SEQ ID NO. 9: cagtGGTCTCatacaTTCCCTCCCAATTTCTAGCT.
[0036] LOOP-F, SEQ ID NO. 10: cagtGGTCTCaCCTGCAGGTCTAGTTTTCTC.
[0037] LOOP-R, SEQ ID NO. 11:cagtGGTCTCaGCCCGGGCTCTGTAACTAT.
[0038] ② Amplification of the forward target, reverse target, and loop fragments was performed. The amplification system is shown in Table 1. The PCR reaction program was 98℃ for 3 min; 98℃ for 15 s, 55℃ for 15 s, 72℃ for 1 min, 30 cycles; 72℃ for 5 min.
[0039] Table 1 RNAi fragment amplification reaction system
[0040] ③ After the PCR reaction is completed, purification and recovery are performed using a DNA purification and recovery kit (FastPure Gel DNA Extraction Mini Kit). The recovery steps are as follows: S1. After DNA electrophoresis, the target fragment is quickly cut off under UV light, and an equal volume of Buffer GDP is added. The mixture is then placed in a 55°C water bath until the gel is completely dissolved.
[0041] S2. Place the FastPure DNA microcolumn-G adsorption column in a 2mL collection tube, transfer the sol solution to the adsorption column, and centrifuge at 12000rpm for 1min.
[0042] S3. Discard the filtrate, add 300µL of Buffer GDP to the adsorption column, let stand for 1 min, and centrifuge at 12000rpm for 1 min.
[0043] S4. Discard the filtrate, add 700µL of Buffer GW to the adsorption column, centrifuge at 12000rpm for 1min, and repeat once.
[0044] S5. Discard the filtrate, place the adsorption column on the collection tube, and centrifuge at 12000 rpm for 2 min.
[0045] S6. Place the adsorption column on a 1.5 mL centrifuge tube, add 20 µL of sterile water, let stand for 2 min, centrifuge at 12000 rpm for 1 min to obtain purified DNA, and store in a -20℃ freezer.
[0046] ④ Prepare the Golden Gate cloning reaction system as shown in Table 2.
[0047] ⑤ After the system is prepared, mix it evenly, centrifuge briefly, place it in a PCR instrument at 37℃ for 60 min and 65℃ for 20 min. After the reaction is complete, transfer it to ice for later use.
[0048] Table 2 Golden Gate Reaction System
[0049] The RNAi target sequence of lncRNA ABAC1 is shown in SEQ ID NO.12.
[0050] SEQ ID NO.12: TTCCCCTCCCAATTTCTAGCTCCTTCGATTCCCCCATGGCGGTGTTTTGCTCGCCGCTACTTGTGGTCACATCCTCAGCGGTGCCCGGCGGCAGAGCAACATGTGGGCGTTCCATGGTGCCATGTTTCT TGCAGAGGCAAAGATTTTCTCGATCAATCCTGGCCCCAAGGGGGTGGTTCTATTCATCGGCAAAGAGATCAGCATCACCCACATCTCACCAGCCAGCGAGCAGAGTCCTCCCCTCGCCAGCCTGTAGG.
[0051] Example 2 Obtaining lncRNA using an oat-based genetic transformation system ABAC1 overexpression transgenic lines, lncRNA ABAC1 Methods for establishing overexpression transgenic lines include: S1. Cultivating callus tissue: Mature embryos of the oat variety Mengyan No. 1 were cultured in L3-M medium (L3 base salt 4.6 g / L, maltose 30 g / L, Phytagel gel for plant tissue culture 4 g / L, 2,4-D stock solution 2 mg / L, Dicamba 1 mg / L with H2O added to 1 L, pH=5.8) until embryogenic callus tissue was produced.
[0052] S2. Infection of callus tissue, including: (1) Preparation of bacterial culture. The infected vector plasmid was transferred into Agrobacterium GV3101 by electroporation. Positive single colonies were picked and placed in LB liquid medium containing kanamycin and rifampin for shaking culture. In addition, Agrobacterium strain GV3101 carrying pUBI::taWOX5 was shaken using liquid LB containing the corresponding antibiotics.
[0053] (2) Centrifuge the shaken bacteria at 8000 rpm for 10 min, discard the supernatant, and adjust the OD with the resuspended solution. 600 The concentration was increased to 0.8, and then the bacterial solution containing the target vector was mixed 1:1 with the bacterial solution of Agrobacterium strain GV3101 carrying pUBI::taWOX5 in (1) after shaking.
[0054] The resuspension formulation is as follows: L3 base salt 4.6 g / L, glucose 10 g / L, MES (2-morpholino) ethanesulfonic acid 0.5 g / L, acetylsuccinone (150 µM) 1.5 ml / L.
[0055] (3) In the clean bench, use pointed tweezers to pick up embryogenic callus tissue into a sterile culture dish, then pour the mixed bacterial solution into the culture dish to immerse the callus tissue and infect for 30 minutes.
[0056] (4) After infection, remove the bacterial solution and use sterile tweezers to place the embryonic callus on sterile filter paper to dry for 5 minutes.
[0057] (5) Take a new petri dish and filter paper, put the filter paper into the petri dish, prepare sterile water containing acetylsuccinone, use the sterile water to wet the filter paper, put the dried embryogenic callus on the wetted filter paper, and incubate in a dark incubator for three days.
[0058] (6) After co-culture, the embryogenic callus was transferred to Wls-Res plates and cultured in a dark incubator for 5 days.
[0059] The formulation of Wls-Res plates is as follows: L3 base salt 4.6 g / L, doxycycline 220 µL / L, glutamate 0.5 g / L, casein acid hydrolysate 0.1 g / L, MgCl2·6H2O 0.75 g / L, maltose 40 g / L, MES (2-morpholino) ethanesulfonic acid 1.95 g / L, Phytagel gel for plant tissue culture 4 g / L, 2,4-D stock solution 500 µL / L, silver nitrate 100 µL / L, vitamin C 10 µL / L, and termethin antibiotic 1 ml / L.
[0060] (7) Place the embryogenic callus on a Wils-Res plate and culture for 7 days to screen out viable callus.
[0061] (8) Transfer the callus tissue to the differentiation medium and culture until green shoots grow.
[0062] The differentiation medium formula is as follows: L3 base salt 4.6 g / L, sucrose 20 g / L, MES (2-morpholino) ethanesulfonic acid 0.5 g / L, CuSO4·5H2O 200 µL / L, Phytagel gel for plant tissue culture 4 g / L, zeatin 5 ml / L, and termethin antibiotic 1 ml / L.
[0063] (9) After the green shoots grow to 1-2cm, transfer them to the rooting medium. After the roots grow, transfer them to a pot. For the first three days, cover the pot with plastic wrap to reduce transpiration. After three days, remove the plastic wrap and allow them to grow normally in the artificial climate chamber.
[0064] The rooting medium formula is as follows: L3 base salt 4.6 g / L, sucrose 15 g / L, MES (2-morpholino) ethanesulfonic acid 0.5 g / L, Phytagel gel for plant tissue culture 4 g / L, IBA stock solution 20 µL / L, and termethin antibiotic 1 ml / L.
[0065] (10) After three leaves have grown, take a sample and test whether it is a positive seedling.
[0066] Example 3 Obtaining lncRNA using an oat-based genetic transformation system ABAC1 The RNAi silencing transgenic line was established using the same method as in Example 2, except that the transformed oat line was “Bayou 18”, the screening resistance was hygromycin, and the screening pressure was 5 mg / L.
[0067] Test Example 1 Detection of lncRNA using RT-qPCR technology ABAC1 lncRNA in overexpression transgenic lines and RNAi-silenced transgenic lines ABAC1 The expression level, the detection results are as follows Picture 1 As shown, A is lncRNA. ABAC1 lncRNA in RNAi transgenic plants ABAC1 The expression level detection results show that B represents lncRNA. ABAC1 lncRNA overexpression in transgenic lines ABAC1 The expression level detection results.
[0068] Depend on Picture 1 It can be seen that after RNAi silencing, lncRNA ABAC1 Expression levels were downregulated to 50% or below; after overexpression, lncRNA... ABAC1 Expression levels were upregulated 4-fold or more. This demonstrates that lncRNA was successfully obtained in Examples 2-3. ABAC1 Overexpression lines (OE) with significantly upregulated expression and RNAi silencing lines with significantly downregulated expression.
[0069] Test Example 2 After the seeds of Mengyan No. 1 germinated and grew to the three-leaf stage, they were subjected to simulated drought, natural drought and terrace drought treatment with PEG6000.
[0070] PEG6000 treatment involved adding 20% PEG6000 to Hoagland nutrient solution. PEG6000 simulated drought treatment for 0h, 1h, 3h, 6h, 12h, 24h, and 48h, as well as 6h, 12h, and 24h after rehydration (R). After PEG6000 treatment, the aboveground parts and roots of oat plants were collected for lncRNA analysis. ABAC1Expression level detection. For example... Picture 2 As shown, R6, R12, and R24 represent rehydration times of 6h, 12h, and 24h, respectively; where A represents lncRNA from the aerial parts. ABAC1 The expression level of B is the lncRNA in the roots of oat plants. ABAC1 The expression levels of lncRNA ABAC1 were observed. Results showed that the expression levels of ABAC1 in both the aboveground parts and roots of oat plants were downregulated.
[0071] The conditions for the tabletop dehydration treatment were as follows: Sixteen oat plants were taken, and the second leaf from each plant was cut off and placed on a tabletop for leaf dehydration treatment. Samples were taken at 0h, 1h, 3h, 6h, and 9h. The fresh leaf samples were placed in 2mL RNase-free Eppendorf tubes and immediately placed in liquid nitrogen.
[0072] lncRNA in oat plants under drought conditions on a terrace ABAC1 Expression level analysis, such as Picture 3 As shown, WW represents normal growth, and WS represents terrace drought treatment. It can be seen that after terrace drought treatment, lncRNA... ABAC1 The expression level was downregulated.
[0073] After oats reached the three-leaf stage, a natural drought treatment was initiated, with three treatment groups: N (normal irrigation); mild drought treatment with a soil moisture content of 35% (D1); and severe drought treatment with a soil moisture content of 10% (D2). lncRNA was extracted from the aboveground parts and roots of oat plants under the four conditions (N, D1, D2, and R). ABAC1 Expression level detection. For example... Picture 4 As shown, A represents the aboveground parts, and B represents the roots. The results showed that lncRNAs in the aboveground parts and roots of oat plants... ABAC1 The expression levels were all downregulated.
[0074] In summary, lncRNA ABAC1 The expression level of is suppressed by drought.
[0075] Test Example 3 Wild type (WT), ABAC1-OE strains and ABAC1 RNAi seedlings were cultured to the three-leaf stage under normal conditions.
[0076] ① Perform natural drought treatment (stop watering), and continuously observe and record the plant phenotype.
[0077] ② Take detached leaf blades, weigh them, and place them on a dry table indoors. Weigh them at regular intervals and calculate the water loss rate.
[0078] ③ After drought treatment until the leaves wilted, the plants were rehydrated, and the proportion of plants that recovered growth was recorded.
[0079] Wild type (WT) ABAC1-OE strains and ABAC1 Phenotypic changes of RNAi lines before and after drought treatment, such as Picture 5 As shown. Picture 5 In the text, A represents wild-type (WT) and... ABAC1 Phenotypic changes of RNAi lines before and after drought treatment, B representing wild-type (WT) and ABAC1-OE Phenotypic changes of the strains before and after drought treatment.
[0080] Depend on Picture 5 It can be seen that after drought treatment, ABAC1 RNAi lines showed less wilting than WT lines, while ABAC1-OE The strains showed more severe wilting than WT.
[0081] After drought treatment, wild type (WT) ABAC1-OE strains and ABAC1 Determination of water loss rate of RNAi lines, such as Picture 6 As shown. Picture 6 In the text, A represents wild-type (WT) and... ABAC1 Water loss rate of RNAi lines, B being wild-type (WT) and ABAC1-OE Water loss rate of the strain.
[0082] Depend on Picture 6 It can be seen that after drought treatment, ABAC1 RNAi lines had a significantly lower water loss rate than WT lines, while ABAC1-OE The water loss rate of the strain was significantly higher than that of the WT strain.
[0083] After drought treatment, wild type (WT) ABAC1-OE strains and ABAC1 Survival determination of RNAi lines, such as Picture 7 As shown. Picture 7 In the text, A represents wild-type (WT) and... ABAC1 Survival rate of RNAi lines, B represents wild-type (WT) and ABAC1-OE Survival rate of the strain.
[0084] Depend on Picture 7 It can be seen that after drought treatment, ABAC1 RNAi lines had a significantly higher survival rate than WT lines, while ABAC1-OE The survival rate of the strains was significantly lower than that of WT.
[0085] The above results indicate that reducing lncRNA ABAC1 Expression of lncRNA can enhance the drought resistance of oats, while overexpression reduces its drought resistance, demonstrating that lncRNA expression enhances drought resistance. ABAC1 It is a negative regulator of oat drought resistance.
[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. lncRNA ABAC1 Its application in improving the drought resistance of oats is characterized by: lncRNA ABAC1 The nucleotide sequence is shown in SEQ ID NO.
5.
2. The application according to claim 1, characterized in that: Improving oat drought resistance by reducing or inhibiting lncRNA ABAC1 Expression and implementation.
3. The lncRNA as described in claim 1 or 2 ABAC1 Application in the breeding of new oat varieties.
4. A method for improving the drought resistance of oats, characterized in that: This includes reducing or inhibiting lncRNA in oats. ABAC1 expression levels of lncRNA ABAC1 The nucleotide sequence is shown in SEQ ID NO.
5.
5. The method according to claim 4, characterized in that: Reduce or inhibit lncRNA through RNA interference, gene knockout, gene editing, or antisense nucleic acid technology. ABAC1 The expression.
6. The method according to claim 5, characterized in that: RNA interference uses targeted lncRNA ABAC1 The RNAi vector, with the RNAi target sequence shown in SEQ ID NO.
12.
7. A molecular marker or target for drought-resistant breeding of oats, characterized in that: Molecular markers or targets are lncRNAs ABAC1 lncRNA ABAC1 The nucleotide sequence is shown in SEQ ID NO.
5.
8. A recombinant expression vector, characterized in that: Includes silencing lncRNAs ABAC1 The interfering sequence targets the lncRNA shown in SEQ ID NO.
5. ABAC1 .