Application of USP28 gene in proliferation of porcine muscle stem cells

By using genome-wide association analysis and CRISPRi technology to target and knock down the USP28 gene, the gap in the regulation of porcine muscle stem cell proliferation was filled, enabling genetic improvement of porcine meat production traits and increased breeding efficiency.

CN122278950APending Publication Date: 2026-06-26HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HENAN AGRICULTURAL UNIVERSITY
Filing Date
2026-04-22
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively explore and utilize the regulatory role of the USP28 gene in the proliferation of porcine muscle stem cells, resulting in low efficiency in genetic improvement of porcine meat production traits.

Method used

Through genome-wide association analysis and expression characterization studies, the importance of the USP28 gene in porcine muscle stem cells was clarified. The expression of the USP28 gene was knocked down using CRISPRi technology to construct porcine muscle stem cell lines and promote their proliferation.

Benefits of technology

The role of the USP28 gene in regulating the proliferation of porcine muscle stem cells has been clarified, providing a theoretical basis for the genetic improvement of porcine meat production traits, improving breeding efficiency, and providing experimental materials for studying its mechanism of action.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122278950A_ABST
    Figure CN122278950A_ABST
Patent Text Reader

Abstract

This invention discloses the application of the USP28 gene in the proliferation of porcine muscle stem cells, belonging to the field of animal genetic engineering. Resequencing data shows that this gene is selected in pig breeds with high meat production traits. Functional verification indicates that knocking down this gene in primary porcine muscle stem cells significantly reduces the mRNA expression level of the proliferation marker gene and significantly decreases the number of EdU-labeled proliferative positive cells. This invention clarifies the proliferation-promoting function of the USP28 gene, which can be used as a molecular marker or target gene for pork quality improvement and new breed breeding, providing an effective technical means to solve the problems of insufficient pork yield and genetic improvement of quality traits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biological breeding technology, specifically to the application of the USP28 gene in the proliferation of porcine muscle stem cells. Background Technology

[0002] Genetic improvement of meat production traits in pigs has always been one of the most important research topics, as this trait primarily depends on the growth and development of skeletal muscle. Muscle stem cell proliferation and differentiation are fundamental to skeletal muscle growth and development, directly influencing the formation of meat production traits in pigs. Significant differences exist between local Chinese pig breeds and commercially raised Western breeds (such as Landrace and Large White) in terms of muscle stem cell proliferation capacity and gene expression related to proliferation and differentiation, resulting in lower meat production efficiency. Therefore, utilizing modern bio-breeding techniques to identify key genes regulating meat production traits and conducting in-depth research on the molecular mechanisms and genetic basis of muscle stem cell proliferation and differentiation is of significant theoretical and urgent practical importance for the genetic improvement of meat production traits in pigs.

[0003] The USP28 gene is a deubiquitinating enzyme belonging to the ubiquitin-specific protease (USP) family. Discovered in 2001, it consists of a ubiquitin-associated domain (UBA), a ubiquitin-interacting motif (UIM), and a catalytic USP domain containing the active site (C171). As an important component of deubiquitinating enzymes (DUBs), the USP protein family plays an indispensable role in key biological processes such as intracellular protein homeostasis, signal transduction, and cell cycle regulation.

[0004] Studies have reported that USP28 is an important regulator of muscle cell differentiation and maturation, but its expression changes during skeletal muscle development have not been fully elucidated, especially in porcine muscle stem cells.

[0005] In order to solve the above problems, people have been seeking an ideal technological solution. Summary of the Invention

[0006] The purpose of this invention is to address the shortcomings of existing technologies by providing an application of the USP28 gene in the proliferation of porcine muscle stem cells.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a process for mining the porcine primary muscle stem cell proliferation gene USP28: First, based on resequencing data from 1081 pigs of five pig breeds with significantly different meat production traits worldwide, we conducted selection analysis of the USP28 gene, genome-wide association analysis of meat production traits, and analysis using the Pigbiobank database for large-scale complex trait genetic analysis. The results all showed that the USP28 gene is significantly associated with meat production traits in pigs.

[0008] Secondly, the expression characteristics of the USP28 gene were analyzed. Based on the PIGOME data platform, the PigGTEx website (a porcine gene regulation map), accelerated gene expression analysis, and the process of porcine skeletal muscle cell proliferation and differentiation, the expression characteristics of the USP28 gene and its important regulatory potential in skeletal muscle were profoundly revealed.

[0009] Secondly, the present invention provides the application of the USP28 gene in promoting the proliferation of porcine primary muscle stem cells, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] Thirdly, the present invention provides applications of biomaterials related to the USP28 gene, wherein the applications are any of the following: A1) Application in regulating the proliferation of porcine primary muscle stem cells; A2) Application in the preparation of porcine muscle stem cells with inhibited proliferation capacity; The biomaterial is any one of the following: B1) Primers targeting the sgRNA sequence of the USP28 gene; The primer nucleotide sequences for sgRNA are one of three groups: Seq ID NO.2 and Seq ID NO.3, Seq ID NO.4 and Seq ID NO.5, and Seq ID NO.6 and Seq ID NO.7. B2) U6-sgRNA vector containing an sgRNA sequence targeting the USP28 gene; B3) 293T cells were transfected with the U6-sgRNA vector containing the sgRNA sequence targeting the USP28 gene, the dCas9-KRAB plasmid vector, and the lentiviral packaging tool plasmids pM2.G and psPAX2. B4) Porcine primary muscle stem cell lines infected with packaged lentiviruses.

[0011] Fourthly, the present invention provides a method for regulating the proliferation of porcine primary muscle stem cells using the USP28 gene, characterized by comprising the following steps: S1. Construct the sgRNA vector for the porcine USP28 gene; The sgRNA vectors obtained in S2 and S1 were transferred into porcine primary muscle stem cells via lentiviral infection to obtain transgenic knockdown cell lines.

[0012] The present invention has the following beneficial effects: (1) The important role of the USP28 gene in regulating the proliferation of primary porcine muscle stem cells was first discovered, verified and clarified, filling the research gap of the USP28 gene in porcine muscle stem cells and providing a theoretical basis for the genetic improvement of porcine meat production traits.

[0013] (2) The proliferation-promoting function of the USP28 gene has been clarified, and it can be used as a molecular marker or target gene for pork quality improvement and new breed breeding to improve breeding efficiency.

[0014] (3) The expression of the USP28 gene in the porcine muscle stem cell line constructed by the sgRNA provided by the present invention was significantly reduced, providing excellent experimental material for further study on the mechanism of action of the USP28 gene on porcine muscle stem cells. Attached Figure Description

[0015] Figure 1 A is the Manhattan plot showing all the significant selective clearance areas in Eastern and Western pig breeds.

[0016] Figure 1 B represents the composite likelihood ratio of the region where USP28 is located, comparing Western and Eastern pig breeds.

[0017] Figure 1 C is the Manhattan plot of genome-wide association analysis of meat production traits.

[0018] Figure 1 D is a scatter plot of the full phenotypic association analysis.

[0020] Figure 2 A represents the expression levels of the USP28 gene in various tissues.

[0021] Figure 2 B is a scatter plot showing the expression levels of USP28 in multiple cell subpopulations.

[0022] Figure 2 C is a negative PAS value, indicating that USP28 is expressed at an accelerated rate in Landrace pigs.

[0023] Figure 2 D represents the change in USP28 expression at different time points during the differentiation of porcine muscle stem cells.

[0024] Figure 3 A compares the efficiency of RT-qPCR detection in knocking down USP28 using CRISPRi technology.

[0025] Figure 3B represents the changes in mRNA expression levels of the proliferation marker genes Ki67 and PCNA detected by RT-qPCR.

[0026] Figure 3 C is EdU, used to detect cell proliferation capacity.

[0027] Figure 3 D represents the quantitative analysis of the percentage of EdU-positive cell nuclei using ImageJ software, with graphs plotted using GraphPad Prism software. Detailed Implementation

[0028] This invention delves deeper into the potential functional differences of the USP28 gene in the growth and development of porcine skeletal muscle. To aid those skilled in the art in understanding and implementing this invention, although preferred embodiments have been described in detail, this does not limit the scope of protection of the invention; all variations based on the inventive concept are protected. The reagents and instruments used in the embodiments are all from commercially available biotechnology companies.

[0029] This invention aims to apply the differences in the regulatory function of the USP28 gene in the growth and development of porcine skeletal muscle.

[0030] The following technical solution is adopted: The full name of the porcine USP28 gene is ubiquitin specific peptidase 28, with a gene ID of 100519614. It is located on chromosome 9 and has the NCBI number NC_010451.4.

[0031] SEQ ID NO.1 ATGACTGCGGAGCTGCAGCAGGACGACGCGGCCGGAGCAGCGGACCGCCACGGCTCGAGC TGCCAAATGCTGTTAAAACCAACTGAGAGAAATTACAGGCATTCAGGACCCTTCTTTTCTC CATGAAGCTCTAAAGGCCAGTAATGGTGACATCACCCAGGCAGTCAGCCTTCTCACTGAT GAAAGAGTTAAAGAGCCCAGCCAAGACACTGTTGCGACAGAGCCATCTGAAGTCGAGGGC AGTGCTGCCAACAAAGAGGTGTTAGCAAAAGTTATAGACCTTACTCATGATAACAAAGAT GATCTTCAGGCTGCCATTGCTTTGAGTCTTTTGGAGTCCCCCAAAATTCAAACTGATGGA AGAGATCTTAACAGGATGCCCGAGGCAACTTCTGCAGAAACTAAACGCTCAAAGAGAAAA CGCTGTGAAGTCTGGGGAGAAAATCCCAATCCCAATGACTGGAGGCGAGTGGATGGCTGG CCAGTTGGGCTGAAAAATGTTGGCAATACGTGTTGGTTTAGTGCTGTTATTCAGTCTCTC TTTCAGTTGCCTGAATTCCGCAGACTCGTCCTCGGCTATAGTCGACCACAGAACGCACTT GAAAACTGTCCAAGTCACGCGGAAAAGAGAAATATCGTGTTTATGCAGGAGCTTCAGTAC TTGTTTGCTCTGATGATAGGATCAAATCGCAAGTTCGTAGACCCCTCAGCAGCCCTGGAC CTCTTAAAGGGAGCGTTCCGATCACCTGAGGAACAGCAGCAAGATGTGAGTGAATTCACA CACAAGCTCCTGGATTGGCTAGAGGACGCATTCCAGCTAGCCGTTAATGTTAATAGCAAT CCCAGGAACAAATCTGAAAATCCAATGGTGCAGCTATTCTATGGTACCTTCCTCACTGAA GGGGTTCGTGAAGGAAAGCCATTTTGTAACAACGAGACCTTCGGCCAGTACCCCCTTCAG GTAAATGGTTATCGCAACTTAGACGAATGTTTGGAAGGGGCCATGGTGGAGGGTGACCTT GAGACACTTCCTTCCGATCATTCAGTGAAGTATGGACAAGAGCGTTGGTTTACAAAGCTA CCTCCAGTGTTGACTTTTGAACTCTCAAGATTTGAGTTTAATCAGTCCCTTGGTCAGCCA GAGAAAATTCACAATAAGCTGGAATTTCCTCAGATCATTTATATGGACAGGTACATGTAC AGGAGCAAAGAGCTTATTCGAAGTAAGAGGGAGTGTATTCGAAAGTTGAAAGAAGAAATA AAAGTTCTGCAGCAAAAACTGGAAAGGTATGTCAAGTACGGCTCGGGCCCGGCTCGGTTC CCTCTCCCGGATATGCTGAAGTACGTGATTGAATTTGCTAGTACAAAACCTGCCTCAGAA AGCACTTTGTCTCAAAGTGACGCATGCATGACATCACCAGTGTCTTCAGTGCACTGCGCA GCTTCTGACCTGACATCCGAGGAAAGTACAAGTAAAGAGGGCACGTCTCAGGATGCTGAG AGTACCTTTTCTTCTTCTGAAGATTCTGCACACAAGTCTAAGCCAGTGAATCAGCCCCTT CCACCTTCCCGGTCTTCCATGGAAATGCCTGCACATCCAGCTCCTCGAACGGTCACAGAT GAGGAGATAAACTTTGTTAAGACCTGCCTTCAGAGGTGGAGGAGTGAAATTGAACAAGAT ATACAAGATCTAAAGAATTGTATTGCAAGCACTACGCAGACTATTGAGCAGATGTACTGT GATCCTCTCCTCCGCCAGGTGCCTTACCGCTTGCATGCGGTTCTTGTTCATGAGGGACAA GCAAACGCAGGACACTACTGGGCGTACATCTATAATCAGCCCCGGCAGGTCTGGCTCAAG TACAACGACATCTCCGTTACTGAGTCTTCCTGGGAAGAACTCGAAAGAGACTCCTATGGG GGCCTGAGAAACGTCAGTGCTTACTGTCTGATGTACATTAATGACAAGCTGCCGCACTGC CATGCAGAATCAGCCCCAAATGAATTGGATCAGATGTCAGGAGAGGTGGAAGCCCTCTCT GTTGAACTTAAGCATTACATTCAGGAAGATAACTGGAGGTTTGAGCAAGAAATCGAGGAG TGGGAAGAAGAGCAGTCTTGCAAAATCCCTCAAATGGACTCTTCCACCAGCTCAGCATCA CAGGAGTTCTCTCCATCGCAAGAGTCTTCAGTAGCCTCTTCCCATGGGGTTCGCTGCCTG TCCTCGGAGCACGCCGTGATCGTGAAGGAACAGACTGCCCAGGCTATAGCAAACACGGCC CGCGCCTACGAGAAGAGTGGGGTAGAAGCAGCATTGAGTGAGCTTAAGGAAGCTGAACCC AAGACGCCCCTGCCCCCGGAAACACACCCCGCAGAGCAGTCAGAGCAGCCCCCACAGGCT CATGACGCAGAGTCTGCTGCCCAGCCCAATTCTGAGGTCTCTGAAGTCGAGATTCCCAGT GTGGGAAGGATTCTGGTTAGATCTGATGCAGATGGATATGATGAGGAGGTGATGCTGAGC CCTGCCATGCAAGGGGTCATCCTGGCCATAGCTAAAGCCCGTCAGACCTTTGACCGAGAC GGGTCTGAAGCAGGGCTTATTAAGGCATTCCATGAAGAGTACTCCAGGCTCTATCAGCTT GCCAAGGAGACCCCCACCTCTCACAGTGACCCCCGACTTCAGCACGTGCTTGTCTACTTC TTCCAAAATGAAGCACCCAAGAGGGTAGTAGAGCGGACCCTGCTGGAACAGTTTGCAGAT AAAAATCTTAGCTACGATGAAAGGTCCATCAGCATTATGAAGGTGGCTCAAGCGAAACTG AAGGAGATTGGTCCAGATGACATGAATATGGAGGAGTACAAGAAGTGGCATGAAGATTAT AGTTTGTTTCGAAAAGTGTCTGTGTATCTCCTGACCGGCCTGGAACTCTATCAGAAAGGA AAGTACCAGGAGGCGCTTTCCTACCTGGTGTACGCCTACCAGAGCAATGCTGCTCTGCTG CTGAAGGGGCCTCGCCGCGGCGTGAAGGAGTCCGTGATCGCTTTATACCGAAGAAAATGC CTTCTGGAGCTAAATGCCAAAGCGGCTTCTCTCTTTGAAACAAATGATGAACACTCTGTA ACAGAGGGTATTAATGTGATGAATGAATTGATCATTCCCTGCATTCACCTTATCATTAAT AATGACATCTCCAAGGATGACCTGGATGCCATTGAGATCATGAGAAACCATTGGTGCTCT TACCTTGGGCAAGATATTGCAGAAAATCTGCAACTGTGCTTGGGGGAGTTTCTACCCAGG CTTCTAGATCCTTCTGCAGAAATCATTGTCTTGAAGGAGCCTCCAACTATTCGACCCAAT TCTCCCTATGACCTTTGCAGCCGATTTGCAGCTGTCATGGAGTCAATTCAAGGAGTGTCA ACTGTGACAGTGAAATAA Example 1 Discovery of USP28, a gene with potential regulatory function in meat production traits.

[0032] Previously, resequencing data were collected from 1081 pigs across 5 categories with significantly different meat production traits. (Reference source: [link to literature]). Liu L, Yi G, Yao Y, Liu Y, Li J, Yang Y, Liu M, Fang L, Mo D, ZhangL, Liu Y, Niu Y, Wang L, Qu X, Pan Z, Wang L, Chen M, Fan X, Chen Y, Zhang Y, et al. Multiomics analysis reveals signatures of selection and lociassociated with complex traits in pigs. iMeta, 2024, 3: e250.

[0033] Selection analysis revealed that 700 genes in high-meat-producing Western pig breeds are located in regions of genome with strong selective clearance, among which the USP28 gene shows a relatively strong selection signal. Figure 1 (A and 1B).

[0034] In addition, a genome-wide association analysis was performed on growth traits (age at 100 kg, backfat thickness, and eye muscle area) of 1186 pigs from three breeds (206 Duroc, 385 Landrace, and 595 Large White). The analysis revealed a significant association between USP28 and meat production traits. Figure 1 C). Data source: Zeng M, Wang B, Liu L, Yang Y, Tang Z. Genome-wide association study identifies 12 new genetic loci associated with growth traits in pigs. Journal of Integrative Agriculture, 2024b, 23: 217-227.

[0035] Meanwhile, online analysis using PigBiobank, a large-scale genetic analysis database of pig complex traits, showed that USP28 was significantly associated with average daily weight gain and age at 100 kg. Figure 1 D).

[0036] All of the above results indicate that USP28 is a potential candidate gene for regulating the meat production trait in pigs.

[0037] Example 2 Analysis of USP28 gene expression characteristics.

[0038] Using the PIGOME data platform, USP28 was found to be specifically expressed in porcine skeletal muscle tissue (N = 1586). Figure 2 A). Source of the document: Han G, Yang P, Zhang Y, Li Q, Fan The PigGTEx consortium provides the most comprehensive map of pig multi-tissue gene regulation to date. The PigGTEx website shows that, in cell subpopulations, USP28 is significantly highly expressed in the myonuclei of types IIa and IIb, higher than in other tissue cell types. Figure 2 B).

[0039] Accelerated gene expression analysis showed that USP28 was expressed at an accelerated rate during the embryonic stage in high-meat-yielding Western pig breeds, indicating that USP28 has a significant promoting effect on skeletal muscle formation during the pig embryonic stage. Figure 2 C).

[0040] Furthermore, during the proliferation and differentiation of porcine muscle stem cells, the expression level of USP28 showed a trend of increasing ( Figure 2 (D) Consistent with the expression trends of differentiation-related marker genes, this suggests that USP28 has a potentially important regulatory role in skeletal muscle generation.

[0041] Example 3 The regulatory function of the USP28 gene on the proliferation of porcine muscle stem cells.

[0042] The CRISPR interference (CRISPRi) functional genomics platform, which relies on nuclease-inactivated Cas9 (dCas9) fused to effector domains such as KRAB, is used to epigenetically suppress gene expression. Three specific single-lead RNAs (sgRNAs) were designed and implemented to generate lentivirally infected cell lines, thereby achieving targeted knockdown of the USP28 gene.

[0043] I. Construction and extraction of sgRNA vector.

[0044] 1.1 The sgRNA primer sequence information is as follows. An sgRNA for repressing the USP28 gene (CRISPRi) based on CRISPR / dCas9 technology was designed, and the primer sequences were synthesized at Shanghai Sangon Biotech Co., Ltd.

[0045] sg1-F: CACCCAGTAATGGTGACATCACCCAGG (Seq ID NO.2) sg1-R:AAACCCTGGGTGATGTCACCATTACTG (Seq ID NO.3) sg2-F: CACCGGCACAATATAGGATGCCCGAGG (Seq ID NO.4) sg2-R:AAACCCTCGGGCATCCTATATTGTGCC (Seq ID NO.5) sg3-F: CACCTATCCCCTTTAGGCCAGTAATGG (Seq ID NO.6) sg3-R:AAACCCATTACTGGCCTAAAGGGGATA (Seq ID NO.7) 1.2 The vector U6-sgRNA was digested with BbsI and ligated with T4 DNA ligase. It was then transformed into Fast T1 E. coli competent cells. The next day, the cells were picked and sent to Sanger Biosciences Shanghai for sequencing. After successful sequencing, plasmids were extracted using the OMEGA plasmid miniprep kit.

[0046] The sequencing primers were U6-PF: CCGTAACTTGAAAGTATTTCG.

[0047] II. Slow virus packaging and attack.

[0048] Lentiviral packaging was performed in the second passage of 293T cells. Following the manufacturer's instructions, Polyplus's Jetprime transfection reagent was used for lentivirus packaging. The packaging system consisted of 4 μg PM2.G, 8 μg psPAX2, 12 μg dCas9-KRAB / U6-sgRNA-NC / U6-sgRNA-1 / U6-sgRNA-2 / U6-sgRNA-3, and 40 μL transfection reagent, added to 500 μL OPTI-DMEM. After incubation at room temperature for 10-15 min, the mixture was added to human 293T cells. The supernatant virus solution was collected 48-72 h post-transfection based on cell condition, with timely nutrient replenishment.

[0049] Cell challenge. Porcine primary muscle stem cells were seeded in six-well plates the night before. The next day, supernatants of dCas9-KRAB and U6-sgRNA viruses were added to the plates at a 1:1 ratio, mixed with 1 / 1000 Polybrene assisted reagent. After 24 hours, the medium was replaced with complete culture medium. Cells were harvested after 48-60 hours for subsequent assays.

[0050] III. RNA extraction.

[0051] RNA was extracted from transfected cells using the Trizol method 24 hours later. After removing the plate and discarding the old culture medium, 1 mL of Trizol reagent was added, and the mixture was repeatedly pipetted and transferred to a 1.5 mL centrifuge tube. The cells were lysed on ice for 5-10 min. Then, 200 μL of nucleic acid extraction reagent was added, and the mixture was shaken well and centrifuged at 12,000 rpm for 10 min at 4 °C. The supernatant was carefully transferred to a new centrifuge tube, and an equal volume of pre-chilled isopropanol was added. The mixture was inverted and centrifuged at 12,000 rpm for 10 min at 4 °C. A precipitate was observed at this point. The liquid was carefully discarded, and 75% ethanol and 100% anhydrous ethanol were added sequentially. After two centrifugations, RNA precipitate was obtained. The cells were air-dried at room temperature for 10-30 min, and 10-20 μL of pure water was added. The concentration and purity of the RNA were detected using a Thermo Fisher Nanodrop nucleic acid analyzer.

[0052] IV. RT-qPCR detection.

[0053] RT-qPCR confirmed successful inhibition of USP28 gene expression. RNA was reverse transcribed using Novizan's HiScript II Q RT SuperMix for qPCR (+gDNA wiper). Step 1: DNA removal. 1 μg RNA and 4 μL of 4x gDNA wiper were mixed, and the volume was brought to 16 μL with purified water. The mixture was incubated at 42 ℃ for 2 min in a PCR instrument. Step 2: Reverse transcription. 5 μL of 5x HiScript II qRT SuperMix II was added, and the mixture was incubated at 50 ℃ for 15 min in a PCR instrument, followed by inactivation at 85 ℃ for 5 sec to prepare cDNA. Quantitative PCR was then performed using Novizan's 2x TaqPro Universal SYBR qPCR Master Mix to detect the knockdown efficiency of USP28 and changes in the expression levels of proliferation marker genes. Each well contained: 0.2 μL quantitative primer F, 0.2 μL quantitative primer R, 1 μL cDNA template, 5 μL 2xTaq Pro Universal SYBR qPCR Master Mix, and 3.6 μL ddH2O. Quantitative reaction conditions: 95℃, 30 sec; 95℃, 10 sec; 60℃, 30 sec; the last two steps were repeated for 40 cycles. A Bio-Rad quantification instrument was used. Quantitative results were plotted using a GraphPad Prism. The quantitative results showed that all three sgRNA sequences effectively knocked down the expression of the USP28 gene and inhibited the expression of proliferation marker genes.

[0054] Quantitative detection primer sequence information: qS-USP28-F: GTCCAAGTCACGCGGAAAAG (Seq ID NO.8) qS-USP28-R: CTGCTGAGGGGTCTACGAAC (Seq ID NO.9) qS-Ki67-F:ATGCTGACGATCTGGCTACG (Seq ID NO.10) qS-Ki67-R:TTCTCGGGCTTGTTGAGGAC (Seq ID NO.11) qS-PCNA-F:CTGCAAGTGGAGAACTCGGA (Seq ID NO.12) qS-PCNA-R:AGTTCAGGTACCTCAGTGCAA (Seq ID NO.13) V. EdU detection of cell proliferation capacity.

[0055] The reagent kit was purchased from Shanghai Beyotime Biotechnology. Following the instructions, EdU reagent was diluted 1:1000 with DMEM (containing 10% fetal bovine serum FBS and 1% penicillin-PS antibodies). After incubation in a cell culture incubator for 1 hour, the cells were removed, fixed, permeabilized, and incubated with the reaction solution for 30 minutes. Then, the cells were incubated with DAPI-stained nuclei and photographed using a confocal microscope. Figure 3 C). The captured images were used to quantify the number of proliferating cells (red light) and total cells (blue light) using ImageJ software, to compare differences between groups, and to create bar charts using GraphPadPrism. Figure 3 D). The results showed that knocking down the USP28 gene significantly reduced the number of cells in the replicating state.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them; although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications can still be made to the specific implementation of the present invention or equivalent substitutions can be made to some technical features without departing from the spirit of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the technical solutions claimed in the present invention.

Claims

1. The application of the USP28 gene in regulating the proliferation of porcine primary muscle stem cells, characterized by: The nucleotide sequence of the USP28 gene is shown in SEQ ID NO.

1.

2. The application of the USP28 gene-related biomaterials according to claim 1, characterized in that, The application is any one of the following: A1) Application in regulating the proliferation of porcine primary muscle stem cells; A2) Application in the preparation of porcine muscle stem cells with inhibited proliferation capacity; The biomaterial is any one of the following: B1) Primers targeting the sgRNA sequence of the USP28 gene; The primer nucleotide sequences for sgRNA are one of three groups: Seq ID NO.2 and Seq ID NO.3, Seq ID NO.4 and Seq ID NO.5, and Seq ID NO.6 and Seq ID NO.

7. B2) U6-sgRNA vector containing an sgRNA sequence targeting the USP28 gene; B3) 293T cells were transfected with the U6-sgRNA vector containing the sgRNA sequence targeting the USP28 gene, the dCas9-KRAB plasmid vector, and the lentiviral packaging tool plasmids pM2.G and psPAX2. B4) Porcine primary muscle stem cell lines infected with packaged lentiviruses.

3. A method for regulating the proliferation of porcine primary muscle stem cells using the USP28 gene, characterized in that, Includes the following steps: S1. Construct the sgRNA vector for the porcine USP28 gene; The sgRNA obtained from S2 and S1 was transferred into porcine primary muscle stem cells via lentiviral infection to obtain transgenic knockdown cell lines; The nucleotide sequence of the USP28 gene is shown in SEQ ID NO.1.