A method for rapid creation of high-quality germplasm of fresh-soybean by gene molecular marker-assisted screening

By designing specific primer sets and genotype verification methods, the problems of low efficiency and high cost in screening gene-edited progeny in the process of creating high-quality fresh soybean germplasm have been solved, achieving efficient and accurate germplasm screening and trait stabilization, which is suitable for large-scale creation.

CN122279012APending Publication Date: 2026-06-26SHUNFENG BIOTECHNOLOGY (HAINAN) CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610638082.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-11
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

In the process of backcrossing and gene editing to create high-quality fresh soybean germplasm, there are problems such as the easy introduction of transgenic genetic mutations into gene-edited offspring, the high time and cost of creating multi-gene knockout, and the lack of specific screening tools suitable for the backcrossing process, resulting in low early screening efficiency and large errors.

Method used

We designed specific primer sets targeting the GmLOX1, GmLOX2, GmLOX3, GmBadh1, and GmBadh2 genes. Through PCR amplification, we amplified only the edited genotype without amplifying the wild-type genotype. Combined with genotype verification and trait stabilization steps, we rapidly screened out high-quality germplasm.

Benefits of technology

It achieves precise screening, simplifies the process, significantly improves screening efficiency and reduces costs, adapts to the needs of large-scale creation, and shortens the screening cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122279012A_ABST
    Figure CN122279012A_ABST
Patent Text Reader

Abstract

This invention discloses a method for rapidly creating high-quality fresh soybean germplasm using gene molecular marker-assisted screening, relating to the field of genetic engineering technology. Specific primers were designed targeting frameshift mutation editing sites in the GmLOX1, GmLOX2, GmLOX3, GmBadh1, and GmBadh2 genes. These specific primers amplify only the edited genotype and not the wild-type. This method can assist in screening for fresh soybeans that are free of beany odor and have a pleasant aroma, and can also distinguish between edited and wild-type soybeans. The method is simple to operate, highly efficient, and has a short screening cycle.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a method for the rapid creation of high-quality fresh soybean germplasm using gene molecular marker-assisted screening. Background Technology

[0002] Currently, there are three major technical challenges in the backcrossing and gene editing of high-quality fresh soybean germplasm: First, gene-edited offspring are prone to introducing transgenic genetic mutations, requiring significant additional manpower and resources to eliminate these ineffective mutations and avoid affecting germplasm quality. Second, when creating high-quality germplasm without beany smell and with a pleasant aroma through multi-gene knockout, a large number of edited offspring must be bred to screen for individuals with frameshift mutations in all five target genes (GmLOX1, GmLOX2, GmLOX3, GmBadh1, and GmBadh2), resulting in extremely high time and cost. Third, existing molecular markers are mostly used for late-stage detection of single traits and lack specific screening tools suitable for the backcrossing and conversion process, making it impossible to accurately distinguish between the edited genotype and wild genotype of the target genes, leading to low early screening efficiency and large errors. Therefore, there is an urgent need to develop a set of specific primers and supporting rapid creation methods to achieve precise screening that amplifies only the edited genotype and not the wild genotype. This will be used for the rapid detection of five target genes during backcrossing and breeding, simultaneously excluding genetic mutations introduced by transgenes, reducing the number of edited offspring to be bred, shortening the screening cycle, filling the gaps in existing technologies, and meeting the needs of large-scale creation of high-quality fresh soybean germplasm. Summary of the Invention

[0003] To address the aforementioned deficiencies in existing technologies, this invention proposes a method for the rapid creation of high-quality fresh soybean germplasm using gene molecular marker-assisted screening, thereby resolving the problems mentioned in the background section.

[0004] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a method for the rapid creation of high-quality fresh soybean germplasm using gene molecular marker-assisted screening, comprising the following steps: (1) Parent selection: Fresh soybean 213 germplasm was selected as the donor parent, and wild-type fresh soybean germplasm with excellent agronomic traits was selected as the recurrent parent to carry out backcross breeding; (2) Genotype verification: Extract genomic DNA from the offspring of backcrossing and fertilization, and perform PCR amplification using the specific primer set described above. Select germplasm that can amplify a single clear target band (i.e., containing edited genotype), and exclude germplasm that has no band (wild genotype), abnormal amplification, or heterozygous band (containing genetic mutations introduced by transgene). These are the candidate high-quality germplasm. (3) Trait stabilization: The candidate high-quality germplasm obtained in step (2) is subjected to soybean flavor and aroma phenotypic verification. The qualified germplasm is self-pollinated and purified to obtain high-quality fresh soybean germplasm with stable traits.

[0005] Preferably, the specific primer set is designed for frameshift mutation editing sites of the GmLOX1, GmLOX2, GmLOX3, GmBadh1, and GmBadh2 genes, and only specifically amplifies the edited genotype, without amplifying the wild-type genotype; The specific primers for the GmLOX1 gene are as follows: upstream primer is CAGTGGTGTTGATGCCCAAGAATGG (SEQ ID NO.1), and downstream primer is CCCTCTATGAATTAAAAATGTAAAAA (SEQ ID NO.2). The specific primers for the GmLOX2 gene are as follows: the upstream primer is GGAGGGCATAAGATAAAAGGGACTG (SEQ ID NO.3), and the downstream primer is CTTCCTTCCACATAATCAATAAC (SEQ ID NO.4). The specific primers for the GmLOX3 gene are: upstream primer ACTCGATACTCTTACTGCCTTCTCG (SEQ ID NO.5), and downstream primer ACGGTGTTTCATTTCAATCTATCC (SEQ ID NO.6). The specific primers for the GmBadh1 gene are: upstream primer TACTATGCCGAGCGAAGGATTGGAC (SEQ ID NO.7), and downstream primer TGGCTACATGGAAAGTTGCTCCTGC (SEQ ID NO.8). The specific primers for the GmBadh2 gene are as follows: upstream primer is AAGGCTCATGTGTCTCTTGGACACA (SEQ ID NO.9), and downstream primer is CTACGTGGAAGGTTGCTCCTGCTC (SEQ ID NO.10).

[0006] Preferably, the GmLOX1, GmLOX2, GmLOX3, GmBadh1 and GmBadh2 genes of the fresh soybean 213 germplasm described in step (1) are all confirmed to have frameshift mutations and are qualified in terms of traits.

[0007] Preferably, the excellent agronomic traits mentioned in step (1) include fresh soybean germplasm that reaches or exceeds the level of the local main cultivated varieties in core agronomic traits such as yield, plant type, resistance, marketability, and growth period, and is suitable for large-scale cultivation and market promotion.

[0008] Preferably, the PCR amplification reaction conditions in step (2) are: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

[0009] The method provided by this invention is applied to screening fresh soybeans that have no beany smell and have a pleasant aroma.

[0010] The method provided by this invention is applied to distinguishing between edited genotype soybeans and wild genotype soybeans.

[0011] Compared with the prior art, the beneficial effects of the present invention are: (1) High primer specificity and accurate screening: The specific primer set involved in this invention specifically binds to the target gene editing site (frameshift mutation site) at the 3' end of the primer. The corresponding sequence of wild-type germplasm cannot match the 3' end of the primer. Therefore, this specific primer set can only amplify the editing genotypes of 5 target genes (GmLOX1 gene, GmLOX2 gene, GmLOX3 gene, GmBadh1 gene and GmBadh2 gene) and cannot amplify wild genotypes. It can accurately distinguish between the two types of genotypes, without false positive or false negative problems, and completely solves the pain point of large error in traditional screening. (2) Simplify the process and reduce costs: The target germplasm screening and transgenic mutation exclusion are achieved simultaneously, without the need to breed a large number of edited offspring or to conduct separate mutation exclusion testing, which greatly reduces the investment of manpower, material resources and time, and reduces the cost of germplasm creation; (3) High efficiency and short cycle: The screening cycle of backcross and breeding offspring is shortened from the traditional 3 generations to 1 generation. There is no need for long-term continuous planting and identification, which significantly improves the efficiency of creating high-quality germplasm and meets the needs of large-scale creation. (4) Highly practical and easy to promote: The specific primer set sequence is clear and the PCR amplification conditions are mature, enabling the five primers to be amplified simultaneously under the same PCR conditions, extracting the genomic DNA of the backcrossed offspring. The method steps are clear, no complicated instruments and equipment are required, and it can be quickly applied to various laboratories and germplasm creation scenarios. Attached Figure Description

[0012] Figure 1 Schematic diagram of a dual sgRNA tandem expression cassette; Figure 2 For the specific amplification verification results, WT is the common wild-type fresh soybean germplasm Qingsu 2; 213-1, 213-2, and 213-3 are three biological replicates of fresh soybean germplasm No. 213. Detailed Implementation

[0013] To enable those skilled in the art to better understand the technical content of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0014] Example 1 Specificity Verification 1. Experimental Materials (1) Germplasm materials: The donor parent is fresh soybean 213 germplasm (based on Qingsu 7 as the original material, selected for qualified traits after directional frameshift mutation of 5 target genes); the recurrent parent is wild-type fresh soybean germplasm with excellent agronomic traits and no frameshift mutation of the above 5 target genes (i.e., the commercially available Qingsu 7 soybean variety); ordinary wild-type fresh soybean germplasm was selected as negative control (WT, the commercially available fresh soybean variety without gene editing, Qingsu 2).

[0015] (2) Reagents: PCR Buffer, dNTPs mixture, Taq DNA polymerase, specific primer set, agarose, DNA extraction kit; (3) Instruments: PCR amplification instrument, gel imaging system, centrifuge, pipette and other conventional molecular biology instruments.

[0016] 2. Experimental Methods (1) The editing process for obtaining fresh soybean No. 213 germplasm Using the CRISPR / Cas9 system, simultaneous and precise editing was performed on three LOX homologous genes (GmLOX1, GmLOX2, GmLOX3) controlling the beany flavor of fresh soybeans and two Badh homologous genes (GmBadh1, GmBadh2) controlling the aroma. A schematic diagram of the dual sgRNA tandem expression cassette is shown below. Figure 1 As shown, the specific construction process is as follows: driven by the AtU6 promoter, dual-target co-expression is achieved through a tRNA-sgRNA-scaffold tandem unit. To introduce the designed GmLOX family target A and GmBadh family target B into this expression cassette, a pair of construction primers were designed: the upstream primer contains the target A sequence and a BsaI restriction site, and the downstream primer contains the target B sequence and a BsaI restriction site. PCR amplification was performed using tRNA and scaffold as templates to obtain a complete dual sgRNA expression cassette fragment with sticky ends. After BsaI digestion, it was ligated into the pCAMBIA1300-Cas9 vector backbone to construct the recombinant vector. The specific implementation process is as follows: (1.1) Three healthy seedlings (3-4 true leaves) of the fresh soybean variety Qingsu 7 were selected, and genomic DNA was extracted from the leaves. The GmLOX1, GmLOX2, GmLOX3 genes and GmBadh1, GmBadh2 genes were cloned. The specific gene accession numbers are shown in Table 3. Homology comparison analysis was performed after sequencing. Highly conserved core structural domains, namely the core functional structural domains with GmLOX conservation ≥99.6% and GmBadh conservation ≥99.5%, were screened as target site regions, and a set of sgRNA target sequences were designed. (1.2) Design a dual-target knockout vector based on the target sequence. The primers designed and constructed are as follows: F:taggtctcctgca GATCGATCGATCGATCGGCT gttttagagctagaa (SEQ ID NO.11), the underlined part is the sgRNA sequence of the GmLOX core domain, i.e. the target A sequence; R:atggtctcaaaac GATCGATCGATCGATCCGCA tgcaccagccgggaa (SEQ ID NO.12), the underlined part is the reverse complementary sequence of the sgRNA sequence of the GmBadh core domain, i.e. the target B sequence; (1.3) AtU6 is the Arabidopsis U6 promoter; tRNA sequence: AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA (SEQ ID NO. 13); scaffold sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO. 14); Amplification was performed using the intermediate vector scaffold and tRNA as templates. The pCAMBIA1300-Cas9 vector was digested with BsaI (37℃ water bath for 3 h, digestion system 20 μL, containing 5 μg vector DNA, 1 μL BsaI enzyme, 2 μL 10× Buffer, and 12 μL ddH2O), and the vector backbone was recovered by gel electrophoresis. The vector backbone and target sequence were ligated via homologous recombination to obtain the recombinant vector. This vector was transformed into DH5α competent cells, and positive clones were screened. Restrictions and sequencing were performed to verify the correct vector construction, ensuring the absence of base mutations and fragment deletions. Plasmid DNA was extracted and adjusted to a concentration of 100 ng / μL for subsequent validation experiments.

[0017] (2) Verification process (2.1) Instantaneous verification method for soybean hairy roots (2.1.1) Preparation of experimental materials: After disinfection, soybean seeds of Qingsu No. 7 were inoculated on MS basic medium and cultured at 25℃ and 16 hours / day for 5 to 7 days to obtain sterile seedlings. Cotyledon nodes were selected as explants. The recombinant vector was introduced into Agrobacterium EHA105 strain and three replicates were set up. (2.1.2) Hairy root induction and positive screening: Agrobacterium tumefaciens bacterial suspension was adjusted to OD 600 =0.6~0.8, infect cotyledonary nodes for 10 min, and co-culture at 23℃ in the dark for 2 days; transfer to hairy root induction medium (MS + 1.0 mg / L IBA + 500 mg / L cephalosporin), and culture at 25℃ in the dark for 7~10 days; when the hairy roots grow to 2~3 cm, use 50 mg / L hygromycin for resistance selection, and at the same time, PCR amplify the Hpt gene to identify positive hairy roots; at least 50 positive hairy roots are selected in parallel for each vector group; (2.1.3) Editing efficiency detection: DNA was extracted from positive hairy roots, and the target editing regions of 5 target genes were amplified by PCR. After sequencing, the sequences were compared with wild-type sequences, and the editing efficiency and simultaneous mutation efficiency of 5 genes were statistically analyzed. The results are shown in Table 1.

[0018] Table 1

[0019] (2.2) Stable transformation (2.2.1) Preparation of recipient materials: Soybean seeds were sterilized and inoculated into MS medium and cultured for 3-4 days. Cotyledonary nodes were then excised as explants. (2.2.2) Preparation of Agrobacterium: The recombinant vector was transformed into Agrobacterium EHA105, inoculated into LB liquid medium (containing 50 μg / mL hygromycin and 50 μg / mL rifampin), and cultured at 28℃ and 200 rpm until OD600=0.6~0.8. The culture was then resuspended in MS liquid medium, 100 μmol / L acetylsyl syringone was added, and the culture was allowed to stand for 30 min for later use. (2.2.3) Infection and co-culture: Fresh soybean Qingsu No. 7 explants were immersed in Agrobacterium bacterial solution for 15-20 min, and after the bacterial solution was dried, they were inoculated into co-culture medium (MS + 1.0 mg / L 6-BA + 0.1 mg / L NAA + 100 μmol / L acetylsylgenone) and cultured in the dark at 23℃ for 3 days; (2.2.4) Desiccation, screening and rooting: Explants were successively transferred to desiccation medium (containing 500 mg / L cephalosporin), screening medium (containing 50 mg / L hygromycin), and rooting medium (1 / 2 MS + 0.5 mg / L IBA) to obtain T0 generation regenerated seedlings; (2.2.5) T0 generation editing result detection: When the T0 generation regenerated seedlings grew to 4-5 true leaves, DNA was extracted, the target editing region was amplified by PCR and sequenced. The editing results were statistically analyzed by the overlapping peak phenomenon in the sequencing peak diagram (overlapping peaks indicate that gene editing has occurred and mutant sequences exist). Positive editing plants were preliminarily screened. At the same time, off-target effects and trait improvement effects were detected. The results are shown in Table 2. (2.2.6) T1 generation core data detection: T0 generation positive editing plants were transplanted to the experimental field, self-pollinated to obtain T1 generation seeds, and sown and cultivated until the 4-5 true leaf stage. DNA was extracted from each plant, and the target editing regions of 5 target genes were amplified by PCR and sequenced. The number of biallelic edits in the 5 genes was counted (biallelic edits include homozygous and chimeric edits, which are the core data of this validation); at the same time, agronomic traits were investigated to ensure that there were no obvious abnormalities. The results are shown in Table 2.

[0020] Table 2

[0021] (2.3) Verification of quality traits The results of aroma substance testing showed that the average 2AP content of all T1 biallelic edited Qingsu 7 T1 generation edited materials was about 215 ppb, which was significantly higher than that of its wild type.

[0022] The results of the no-bean odor test showed that, using an ELISA kit and a microplate reader, the dilution factor was adjusted to ensure that the wild-type results were within the effective range of 0.3 to 0.8. The edited materials were then tested using the same dilution factor. The absorbance of the wild-type GmLOX1 ELISA test was 0.7, GmLOX2 ELISA test was 0.6, and GmLOX3 ELISA test was 0.3. For all edited materials, the results of the three independent ELISA systems (GmLOX1 / GmLOX2 / GmLOX3) were all less than 0.2, proving that the edited material resulted in a deficiency of fatty acid oxidase.

[0023] (3) Selected strains with high biallelic editing efficiency in the T1 generation were self-pollinated to the T3 generation. Fresh soybean 213 germplasm was subjected to Sanger sequencing, which confirmed that all five target genes had frameshift mutations, and these were the donor parents. The specific mutation sites were: GmLOX1: deletion of bases 892-898; GmLOX2: C→T substitution of base 1023; GmLOX3: insertion of bases 765-770 into GATCGC; GmBadh1: G→A substitution of base 543; GmBadh2: deletion of bases 678-683.

[0024] (4) Genotype verification: Genomic DNA was extracted from the donor parent, recurrent parent, and negative control using a DNA extraction kit, and the purity and concentration (OD) of the DNA were tested. 260 / OD 280 The ratio should be 1.8–2.0, the DNA concentration should be no less than 50 ng / μL, and there should be no significant degradation. Ensure that the PCR amplification requirements are met. Use the DNA from the three materials as templates and perform PCR amplification using the specific primer sets shown in Table 3. Set up three biological replicates and a blank control (no template DNA, NTC). Set up a PCR amplification system of 20 μL (2×PCR Mix (containing Taq DNA polymerase, dNTPs, Mg²⁺)). + The reaction mixture consisted of 10 μL of buffer, 0.5 μL each of forward and reverse primers (10 μmol / L), 1 μL of genomic DNA template (50~100 ng / μL), and sterile ddH2O to a final volume of 20 μL. The PCR amplification conditions were as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min. Table 3 Specific primer sets

[0025] (5) Experimental Results: The PCR amplification products were detected by 1.5% agarose gel electrophoresis, and the band patterns were observed. Figure 2 As shown, germplasm sample No. 213 was able to amplify a single, clear target band (positive for edited genotype) with all five primer pairs, and the amplified product was consistent with the expected fragment size; the recurrent parent and negative control samples showed no bands; the blank control showed no amplification and no nonspecific bands, indicating that the primer set specificity met the requirements, and could only amplify the edited genotype, not the wild genotype.

[0026] Experiment Example 2: Rapid Creation and Screening of High-Quality Fresh Soybean Germplasm 2.1 Parental Selection Using fresh soybean 213 as the donor parent and recurrent parent (Qingsu 7) as the female parent, conventional backcrossing was carried out to obtain 50 F1 generation backcross offspring. 2.2 Genotype Verification Genomic DNA was extracted from 50 F1 generation offspring. PCR amplification and electrophoresis were performed using the specific primer set shown in Table 3. The PCF amplification system and reaction conditions were the same as in Example 1. Candidate germplasm that could amplify a single clear target band was screened, and germplasm without bands, amplified abnormally, or with heterozygous bands was excluded. These were the candidate high-quality germplasm. 2.3 Phenotypic Validation Phenotypic verification of candidate high-quality germplasm was performed. The content of 2AP in soybean seeds was detected by GC-MS (specific method referred to CN202310679211.1) to characterize the aroma content of soybeans. The content of soybean lipoxygenase protein was detected using a soybean lipoxygenase ELISA kit to characterize the beany flavor trait. Germplasm with abnormal phenotypic expression was removed. 2.4 Self-pollination purification and retesting: The qualified candidate germplasm was purified by first-generation self-pollination, with routine water and fertilizer management and self-pollination during flowering; after harvesting the seeds, genomic DNA was extracted and retested using the specific primer set shown in Table 3. Germplasm that could amplify a single clear band was selected as stable and high-quality fresh soybean germplasm. 2.5 Control Experiment: Using the traditional phenotypic screening method (without primer assistance), 50 F1 generation offspring were treated simultaneously and planted for 3 consecutive generations for phenotypic identification and genotypic verification. The screening cycle, screening efficiency, and input cost of the two methods were statistically analyzed. Screening cycle = time from obtaining F1 generation through backcross to obtaining stable high-quality germplasm; screening efficiency = number of stable high-quality germplasm / number of initial F1 generation samples × 100%. The advantages of the method of this invention were compared and verified.

[0027] 2.6 Experimental Results (1) After PCR amplification, 31 candidate high-quality germplasm samples were selected from 50 F1 generation offspring genomic DNA samples. 15 samples without bands (wild genotype) and 4 samples with abnormal amplification (including transgenic mutations) were excluded. The screening time was only 8 days. Moreover, the soybean lipoxygenase activity of these 31 candidate high-quality germplasm samples was ≤5U / g and the 2AP content was ≥0.2mg / kg. The phenotypic expression was normal and all were qualified. (2) The 31 candidate germplasms were purified by first-generation self-pollination. After the seeds were harvested, DNA was extracted and retested. 30 stable and high-quality germplasms that could amplify a single clear band were selected, and the homozygosity met the standard. (3) The screening cycle of the method of the present invention is 7 months and the screening efficiency is 60%; the traditional phenotypic screening method processes 50 samples in the same period, with a screening cycle of 16 months and a screening efficiency of 22%. The screening cycle of the method of the present invention is shortened by 56%, the screening efficiency is increased by 173%, and the subsequent breeding investment of ineffective transgenic germplasm is greatly reduced, which has significant advantages.

[0028] Example 3: Application and verification of primer sets in backcross transformation screening 3.1 Experimental Materials Using fresh soybean 213 as the donor parent, and Qingsu 2, Qingsu 7 and Taiwan 75 as the recurrent parents, backcrossing was carried out to obtain three groups of F1 offspring, with 50 samples in each group, for a total of 150 samples.

[0029] 3.2 Experimental Methods The specific primer set described in Table 3 was used to screen 150 samples by PCR amplification, and transgenic mutations were excluded simultaneously. The screened candidate germplasms were then subjected to phenotypic verification and self-cross retesting.

[0030] 3.3 Experimental Results A total of 88 stable and high-quality germplasm accessions were screened from the three groups of samples, with an average screening efficiency of 58.7%. Phenotypic identification revealed that all screened germplasm accessions possessed excellent traits such as no beany taste and good aroma, and no genetic mutations introduced by transgenes. The screening results of backcross progeny from different recurrent parents were stable, indicating that the primer set and supporting methods are suitable for different backcross breeding scenarios, have strong practicality, and can be widely promoted and applied.

[0031] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for rapid creation of high-quality fresh soybean germplasm using gene molecular marker-assisted screening, characterized in that, Includes the following steps: (1) Parent selection: Fresh soybean 213 germplasm was selected as the donor parent, and wild-type fresh soybean germplasm with excellent agronomic traits was selected as the recurrent parent for backcrossing and breeding; the wild-type fresh soybean germplasm with excellent agronomic traits is any one of Qingsu 2, Qingsu 7 and Taiwan 75. (2) Genotype verification: Genomic DNA was extracted from the offspring of backcrossing and fertilization, and PCR amplification was performed using a specific primer set. Those that could amplify a single clear target band were selected as candidate high-quality germplasm. (3) Trait stabilization: The candidate high-quality germplasm obtained in step (2) is subjected to bean flavor and aroma phenotypic verification. The qualified germplasm is self-pollinated and purified to obtain high-quality fresh soybean germplasm with stable traits. The specific primer set is designed for frameshift mutation editing sites of the GmLOX1, GmLOX2, GmLOX3, GmBadh1, and GmBadh2 genes, and only specifically amplifies the edited genotype, without amplifying the wild-type genotype; The specific primers for the GmLOX1 gene are as follows: upstream primer is CAGTGGTGTTGATGCCCAAGAATGG (SEQ ID NO.1), and downstream primer is CCCTCTATGAATTAAAAATGTAAAAA (SEQ ID NO.2). The specific primers for the GmLOX2 gene are as follows: the upstream primer is GGAGGGCATAAGATAAAAGGGACTG (SEQ ID NO.3), and the downstream primer is CTTCCTTCCACATAATCAATAAC (SEQ ID NO.4). The specific primers for the GmLOX3 gene are: upstream primer ACTCGATACTCTTACTGCCTTCTCG (SEQ ID NO.5), and downstream primer ACGGTGTTTCATTTCAATCTATCC (SEQ ID NO.6). The specific primers for the GmBadh1 gene are: upstream primer TACTATGCCGAGCGAAGGATTGGAC (SEQ ID NO.7), and downstream primer TGGCTACATGGAAAGTTGCTCCTGC (SEQ ID NO.8). The specific primers for the GmBadh2 gene are as follows: the upstream primer is AAGGCTCATGTGTCTCTTGGACACA (SEQ ID NO. 9), and the downstream primer is CTACGTGGAAGGTTGCTCCTGCTC (SEQ ID NO. 10).

2. The method according to claim 1, characterized in that, In step (1), the GmLOX1, GmLOX2, GmLOX3, GmBadh1 and GmBadh2 genes of the fresh soybean 213 germplasm were all confirmed to have frameshift mutations and were qualified for the traits.

3. The method according to claim 1, characterized in that, The PCR amplification reaction conditions in step (2) are as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

4. The application of the method of claim 1 in screening fresh soybeans that have no beany smell and have a pleasant aroma.

5. The application of the method of claim 1 in distinguishing between edited genotype soybeans and wild genotype soybeans, characterized in that, The edited genotype soybean is soybean with deletion of bases 892-898 in the GmLOX1 gene, C→T substitution at base 1023 in the GmLOX2 gene, insertion of bases GATCGC at positions 765-770 in the GmLOX3 gene, G→A substitution at base 543 in the GmBadh1 gene, and deletion of bases 678-683 in the GmBadh2 gene; the wild genotype soybean is any one of Qingsu 2, Qingsu 7, and Taiwan 75.

Citation Information

Patent Citations

  • A tobacco fragrance gene, its targeted sgRNA and applications

    CN116590317B