Gna probe library, methods of making and designing the same, methods of targeting a sequence of interest and imaging nucleic acids, and applications thereof

Abstract

This application presents a gRNA probe library, its preparation and design methods, a method for targeting genes, and a nucleic acid imaging method. This application combines gRNA probes containing modified groups with nucleases, enabling dynamic observation of DNA and RNA by binding to target genomic sequences or RNA transcripts in living cells. By utilizing fluorescently labeled crRNAs, tracrRNAs, and sgRNAs, this application achieves real-time imaging of repetitive and non-repetitive sites, establishing a powerful gene imaging toolkit. Furthermore, the gRNA probe library prepared in this application will be applied to CRISPR systems for gene editing, transcriptional regulation, gene targeting, and delivery.

Description

Technical Field

[0001] This application belongs to the field of gene editing technology, specifically relating to a gRNA probe library and its preparation and design methods, a method for targeting target sequences, and a method for nucleic acid imaging and their applications. Background Technology

[0002] In situ nucleic acid imaging allows for the identification and localization of specific nucleic acid sequences within tissues or cells, enabling analysis of gene expression and function at the single-cell level. This technology is widely used in molecular diagnostics and biological research for various diseases. The classic FISH technique, using in vivo synthesized fluorescent oligonucleotide probes to observe specific gene loci, is the gold standard for DNA imaging in fixed cells. With advancements in technology, CRISPR-based live-cell nucleic acid imaging has overcome the limitations of sample fixation in traditional nucleic acid imaging, allowing visualization of dynamic changes in nucleic acids within living cells. This breakthrough has facilitated research into the spatiotemporal control patterns of the genome, contributing to the elucidation of various disease mechanisms and serving as a powerful tool for studying genome function and clinical diagnosis.

[0003] However, most CRISPR-based DNA imaging systems rely on protein expression systems, requiring complex engineering and gene expression modulation. In previous research, the inventors proposed a method for live-cell imaging using in vitro assembly of dCas protein and fluorescently modified guide RNA (gRNA) to generate fluorescent ribonucleoprotein complexes (fRNPs). The inventors used CRISPR LiveFISH to observe various cellular activities in live cells, including real-time gene editing, chromosomal translocations, and RNA transcription at specific genomic loci. However, its application was limited to imaging highly repetitive genomic regions. Given that most coding genes do not contain highly repetitive sequences, extending its application to low-repetitive and non-repetitive regions is essential.

[0004] Currently, widely used methods for chemically modified gRNA mainly rely on solid-phase chemical synthesis, a technique that directly integrates modified nucleotides during synthesis, providing researchers with an effective tool. However, this method faces severe limitations when applied to RNA library synthesis and longer RNAs. Although some advanced solid-phase synthesis techniques can synthesize RNAs with more than 100 nucleotides, their significantly reduced synthesis efficiency and high cost limit their widespread application in practical research. Another method for preparing modified RNA is in vitro transcription (IVT). IVT is not limited by RNA length, but it is difficult to achieve precise site-specific RNA modification. During IVT, modified nucleotides often replace natural nucleotides through uniform substitution or random insertion. This non-specific chemical modification may disrupt the three-dimensional structure of RNA or interfere with its interaction with Cas proteins, thus adversely affecting the normal function of the CRISPR system. Therefore, developing low-cost labeled gRNA probe libraries applicable to nucleic acid targeting holds great promise. Summary of the Invention

[0005] To overcome the aforementioned problems, this application provides a gRNA probe library for CRISPR, capable of multi-site imaging of low-duplication or non-duplication genomic regions in living cells. The gRNA probe library of this application can effectively image various coding genes in different cell types.

[0006] Specifically, this application relates to the following technical solutions:

[0007] 1. A gRNA probe library, wherein:

[0008] It includes n gRNA probes, where n is an integer greater than or equal to 1;

[0009] The total length of the genomic regions that can be identified by the spacer sequences of all gRNAs in the gRNA probe library is between 5 and 100 kb.

[0010] The number of target gene sequences targeted by the spacer region sequences of gRNAs in the gRNA probe library is at least 5, and the distance between the two target gene loci identified by any two gRNA spacer region sequences in the gRNA probe library is at least 5 nucleotides.

[0011] The GC content of the spacer region sequence of any gRNA in the gRNA probe library is 35%–85%; and

[0012] The spacer region sequence of any gRNA in the gRNA probe library is 10 to 100 nucleotides in length.

[0013] 2. The gRNA probe library according to item 1, wherein the gRNA probe library is capable of forming a functional ribonucleoprotein complex with a nuclease;

[0014] The gRNA probe is a crRNA probe, a tracrRNA probe, or a sgRNA probe.

[0015] 3. The gRNA probe library according to item 2, wherein the nuclease is a nuclease of Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB or TnpB or a variant thereof with a site mutation, including nicked enzymes and variants that retain binding capacity but lack nuclease activity, preferably a nuclease of Cas9 or a variant thereof with a site mutation, preferably a variant of the nuclease of Cas9 with a site mutation including nCas9(D10A), nCas9(H840A) or dCas9(D10A,H840A).

[0016] 4. The gRNA probe library according to item 2, wherein the crRNA probe, tracrRNA probe or sgRNA probe further comprises an elongated stem-loop structure and a nucleic acid aptamer.

[0017] 5. The gRNA probe library according to item 4, wherein the extended stem-loop structure and nucleic acid aptamer domain are selected from one or more of MS2, PP7, xrRNA and eQ1.

[0018] 6. The gRNA probe library according to item 2, wherein the crRNA probe, tracrRNA or sgRNA probe contains a modifying group.

[0019] 7. The gRNA probe library according to any one of items 2 to 6, wherein the sequence of the tracrRNA probe is GGAACCAUUCAAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGU UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU; or,

[0020] The sequence of the crRNA probe is N1N2N3...N m-1 N m GUUUAAGAGCUAUGCUGUUUUG, where m is an integer from 10 to 20; or,

[0021] The sequence of the sgRNA probe is N1N2N3...N m-1 N mGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU UUU, where m is an integer from 10 to 20.

[0022] 8. The gRNA probe library according to item 6, wherein the gRNA probe has non-natural bases, the modification group is located on the non-natural bases, and preferably the modification site is a site that does not participate in pairing with the target gene sequence.

[0023] 9. The probe library according to item 8, wherein,

[0024] The non-natural base is located on the gRNA backbone sequence, preferably at the 3' or 5' end and / or stem loop of the backbone sequence, more preferably at the 3' or 5' end and stem loop of the backbone sequence.

[0025] 10. The probe library according to item 9, wherein the sequence of the tracrRNA probe is as follows: Wherein, when the gRNA probe is a tracrRNA probe, the non-natural bases are located at the bold underlined positions; or,

[0026] The sequence of the crRNA probe is as follows: Where m is an integer from 10 to 20, and when the gRNA probe is a crRNA probe, the non-natural base is located at the bold underlined position; or

[0027] The sequence of the sgRNA probe is as follows: Where m is an integer from 10 to 20, and when the gRNA probe is an sgRNA probe, the non-natural bases are located at the bold underlined positions; preferably, the sequence of the sgRNA probe is as follows:

[0028] 11. The gRNA probe library according to item 6, wherein the modifying group is selected from any one or more of the following: fluorescent groups, quantum dots, nanoparticles, therapeutic drugs, affinity tags, photocage groups, lipid molecules, peptides, metal complexes and antibody fragments.

[0029] 12. The gRNA probe library according to item 6, wherein the method for preparing the gRNA probe library containing the modified group comprises the following steps:

[0030] A chemically synthesized crRNA library containing modified groups is annealed and assembled with universal tracrRNA to form a gRNA probe library; or

[0031] A gRNA probe library is formed by annealing a crRNA library synthesized through in vitro transcription with chemically synthesized tracrRNA containing modified groups; or

[0032] Non-natural base pairs are bound to designated sites in the DNA transcription template library of the gRNA probe library. The DNA transcription template library is then transcribed in vitro to synthesize a gRNA probe library containing non-natural bases. Modifying groups are introduced at the positions of the non-natural bases to obtain a gRNA probe library containing modifying groups.

[0033] 13. The gRNA probe library according to item 12, wherein a modifying group is introduced at the position of the non-natural base by a linking chemical reaction to obtain a gRNA probe library containing the modifying group.

[0034] 14. The gRNA probe library according to item 8, wherein the non-natural bases are selected from one or more of the following: CNMO, TAT1, 5FM, NaM, TPT3, 5SICS, MMO2, PICS, Pa, Ds, Px, isoG, isoC, P, Z and their derivatives.

[0035] 15. A method for preparing a gRNA probe library, comprising the following steps:

[0036] A chemically synthesized crRNA library containing modified groups is annealed and assembled with universal tracrRNA to form a gRNA probe library; or

[0037] A gRNA probe library is formed by annealing a crRNA library synthesized through in vitro transcription with tracrRNA containing modified groups; or

[0038] Non-natural base pairs are bound to designated sites in the DNA transcription template library of the gRNA probe library. The DNA transcription template library is then transcribed in vitro to synthesize a gRNA probe library containing non-natural bases. Modifying groups are introduced at the positions of the non-natural bases to obtain a gRNA probe library containing modifying groups. Preferably, the non-natural bases are selected from one or more of the following: CNMO, TAT1, 5FM, NaM, TPT3, 5SICS, MMO2, PICS, Pa, Ds, Px, isoG, isoC, P, Z and their derivatives.

[0039] 16. The method for preparing the gRNA probe library according to item 15, wherein the gRNA probe library is any one of items 1 to 14.

[0040] 17. A method for designing a gRNA probe library, comprising designing the gRNA probe library according to the following principles:

[0041] The gRNA probe library contains n gRNA probes, where n is an integer greater than or equal to 1;

[0042] The total length of the genomic regions that can be identified by the spacer sequences of all gRNAs in the gRNA probe library is between 5 and 100 kb.

[0043] The number of target gene sequences targeted by the spacer region sequences of the gRNAs in the gRNA probe library is at least 5, and the distance between the two target gene loci recognized by any two gRNA spacer region sequences is at least 5 nucleotides; and

[0044] The GC content of the spacer region sequence of any gRNA in the gRNA probe library is 35%–85%; the length of the spacer region sequence of any gRNA in the gRNA probe library is 10–100 nucleotides.

[0045] 18. The method for preparing the gRNA probe library according to item 17, wherein the gRNA probe library is any one of items 1 to 14.

[0046] 19. A method for targeting a gene, comprising:

[0047] Nuclease and RNA are assembled to obtain a ribonucleoprotein complex, and the ribonucleoprotein complex is delivered into a cell containing nucleic acid of the target gene;

[0048] The RNA is the gRNA probe library described in any one of items 1 to 14.

[0049] 20. The method according to claim 19, wherein the nuclease is a nuclease of Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB or TnpB or a variant thereof with a site mutation, including nicked enzymes and variants that retain binding capacity without nuclease activity, preferably a nuclease of Cas9 or a variant thereof with a site mutation, preferably a variant of the nuclease of Cas9 with a site mutation including nCas9(D10A), nCas9(H840A) or dCas9(D10A,H840A).

[0050] 21. A nucleic acid imaging method, comprising:

[0051] Nucleases and RNA are assembled to obtain ribonucleoprotein complexes, which are then delivered into cells containing nucleic acids. Nucleic acids are imaged by detecting signals generated by the ribonucleoprotein complexes.

[0052] The RNA is the gRNA probe library described in any one of items 1 to 14.

[0053] 22. The method according to claim 21, wherein the nuclease is a nuclease of Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB or TnpB or a variant thereof with a site mutation, including nicked enzymes and variants that retain binding capacity without nuclease activity, preferably a nuclease of Cas9 or a variant thereof with a site mutation, preferably a variant of the nuclease of Cas9 with a site mutation including nCas9(D10A), nCas9(H840A) or dCas9(D10A,H840A).

[0054] 23. The application of the gRNA probe library described in any one of items 1 to 14, the gRNA probe library prepared by the preparation method described in item 15, the gRNA probe library designed by the design method described in item 17, the method for targeting target genes described in item 19 or 20, or the nucleic acid imaging method described in item 21 or 22 in cell imaging, gene editing, gene targeting, and delivery systems.

[0055] The effects of the invention

[0056] The gRNA probe library for CRISPR in this application can perform multi-site imaging of low-repetition or non-repetition genomic regions in living cells, and can effectively image various coding genes in different cell types.

[0057] The gRNA probe library of this application can target specific DNA and RNA sites according to specific needs, and perform labeling, manipulation, multi-omics analysis and drug delivery, enabling dynamic imaging characterization of nucleic acid dynamic changes in primary cells, embryos and organoids.

[0058] The gRNA probe library and nucleic acid imaging method of this application can dynamically track multiple different genomic sites in multiple colors without interfering with each other.

[0059] The gRNA probe library of this application is suitable for a live-cell nucleic acid diagnostic platform for precision medicine in diseases such as cancer and viral infections.

[0060] This application innovatively utilizes gRNA libraries assembled with RNA-guided nucleases to label, modify, regulate, and manipulate specific gene sites. It enables diverse chemical modifications of gRNA libraries at low cost, offering high flexibility, efficiency, and selectivity. This system provides a unique solution for enhancing the functionality and applicability of CRISPR systems in a variety of biomedical and therapeutic applications.

[0061] The method described in this application produces gRNA compatible with various commercially available click chemistry-based fluorescent dyes (including small molecule dyes and quantum dots), providing multiple solutions for CRISPR imaging. This system can effectively label gRNA with multicolor dyes, thereby facilitating the imaging of multiple...

[0062] Simultaneous imaging of DNA and RNA targets can help advance cell visualization and molecular tracking in biological research and medical diagnostics.

[0063] This application describes a method for preparing various chemically modified gRNAs with higher stability and longer lifespan through modification of CRISPR-gRNAs. This method is suitable for the cost-effective preparation of site-specific modified gRNA probe libraries and is not limited by RNA length, modification site, or modification type. The gRNAs prepared by this method can achieve more precise and efficient CRISPR genome editing and regulation results, and facilitate the preparation of gRNAs with various tag-modified bases, which can be used for a variety of gene or chromatin targeting and delivery applications. Attached Figure Description

[0064] Figure 1a This is a schematic diagram of CRISPR LiveFISH imaging using fluorescent crRNA.

[0065] Figure 1b Genome locations and representative live-cell images of various low-duplication loci, including MUC4 (Atto565), FBN3 (Atto565), and ZNF34 (Atto565).

[0066] Figure 1c This is a schematic diagram of crRNA-LiveFISH, which uses a fluorescent crRNA library to image genomic sites.

[0067] Figure 1d A schematic diagram of the PCDHα region labeled with crRNA-LiveFISH to utilize a fluorescent crRNA library targeting the PCDHα region.

[0068] Figure 1e and Figure 1fThe image shows the results of annealing Atto565-labeled crRNAs with unlabeled tracrRNAs, then assembling them with dCas9 protein to generate fRNPs, and subsequently delivering the fRNPs into U2OS live cells.

[0069] Figure 1g To show representative U2OS cells using LiveFISH imaging of the highly repetitive Chr3 locus (approximately 500 copies) with fluorescent tracrRNA.

[0070] Figure 1h Box plots were generated to compare the signal-to-noise ratio (SNR) of fluorescent crRNA (N = 100 loci, Cy3) and fluorescent tracrRNA (N = 100 loci, Cy3) at the Chr3 locus. The p-values ​​were calculated using a two-sided unpaired t-test.

[0071] Figure 1i This is a schematic diagram of two-color LiveFISH imaging using a combination of fluorescent crRNA and fluorescent tracrRNA.

[0072] Figure 1j This image shows the results of imaging the Chr3 site in representative U2OS cells using a pair of crRNAs (red, AF647) and tracrRNAs (green, Cy3) labeled with different fluorophores.

[0073] Figure 1k For along Figure 1j The relative fluorescence intensity line scan of the dashed line.

[0074] Figure 11 This is a schematic diagram of tracr-LiveFISH imaging of non-repetitive sequences.

[0075] Figure 1m A schematic diagram of the PAX6 gene labeled with tracr-LiveFISH.

[0076] Figure 1n Representative U2OS cells showing PAX6 gene loci labeled with tracr-LiveFISH using Cy3-labeled tracrRNA.

[0077] Figure 2a This demonstrates how structure-guided sgRNA modification is achieved by introducing non-natural base pairs (UBP, orthogonal bases are represented as XY in red) at specific positions in stem-loop 2 using expanded genetic codon technology.

[0078] Figure 2b This is a schematic diagram of LiveFISH imaging using site-specific fluorescently labeled orthogonal non-natural base pairs (UBP, denoted as XY) sgRNA.

[0079] Figure 2c The image shows the U2OS cell imaging results of highly repetitive Chr3 sites based on UBP-labeled sgRNA.

[0080] Figure 2d Comparison of SNR at the Chr3 locus using fluorescent tracrRNA markers (N = 100 sites, Cy3), fluorescent sgRNA markers using a random insertion method (N = 100 sites, Cy3), and fluorescent sgRNA markers using a UBP-based method (N = 100 sites, JF549).

[0081] Figure 2e Representative U2OS cell imaging results using JF549-labeled UBP-sgRNA at the ZNF34 site (20 copies).

[0082] Figure 2f The signal-to-noise ratio of fluorescent tracrRNA (N=100 sites, Cy3) and fluorescent UBP-sgRNA (N=100 sites, JF549) at the ZNF34 locus was compared.

[0083] Figure 2g DNA FISH validated the accuracy of UBP-based fluorescent sgRNA markers targeting the ZNF34 genomic locus, showing co-localization of the fluorescent sgRNA marker signal (red) and the DNA FISH signal (green).

[0084] Figure 2h Comparison of live-cell imaging of UBP-based fluorescent sgRNA and fluorescent dCas9 protein. JF549-labeled UBP-sgRNA (red) was paired with dCas9-EGFP (green) to image the ZNF34 site.

[0085] Figure 2i for Figure 2h The signal-to-noise ratio line scan diagram is shown by the dashed line in the middle.

[0086] Figure 2j A comparison of the signal-to-noise ratio (SNR) of dCas9-EGFP (N = 100 sites) and UBP-sgRNA (N = 100 sites, JF549) markers at the ZNF34 site was performed. The SNR of UBP-sgRNA was more than 3-fold higher than that of dCas9-EGFP.

[0087] Figure 2k This is a schematic diagram of multicolor LiveFISH using site-specific fluorescent sgRNA labeled with UBP.

[0088] Figure 2lTo show representative U2OS cells that were labeled with UBP-labeled sgRNA for the MUC4 gene locus (red, AF647) and the ZNF34 gene locus (green, JF549), respectively.

[0089] Figure 2m To display Figure 2l Line scan of the relative fluorescence intensity of the MUC4 and ZNF34 gene loci at the dashed line.

[0090] Figure 2n To demonstrate representative U2OS cells, UBP-sgRNA was differentially labeled with six different sites simultaneously: T1 (green, AF488), FBN3 (red, JF549), ZNF34 (blue, AF647), Chr13 (orange, AF488 and JF549), MUC4 (purple, JF549 and AF647), and PR1 (cyan, AF488 and AF647).

[0091] Figure 2Ea This is a schematic diagram of CRISPR LiveFISH performed by randomly inserting Cy3-tagged sgRNA into repetitive sequences.

[0092] Figure 2Eb The figure shows the results of 8% TBE denaturing urea polyacrylamide gel electrophoresis (PAGE) analysis of Cy3-labeled sgRNA generated by UBP markers (lanes 1, 2, and 3) and random insertion markers (lane 4).

[0093] Figure 2Ec The image shows the results of representative imaging of the Chr3 site in the U2OS system using Cy3-labeled sgRNA prepared with random insertion.

[0094] Figure 3a This is a schematic diagram illustrating how CRISPR PRO-LiveFISH images non-repetitive sequences using orthogonal UBP-labeled sgRNA.

[0095] Figure 3b The genomic location of the non-repetitive MUC4 intron 1 region (MUC4.I1) targeted by 80 sgRNAs is shown, as well as two nearby repetitive regions for multicolor imaging: the repetitive region in MUC4 intron 3 (MUC4.I3) and the Chr3 locus.

[0096] Figure 3c Imaging of representative U2OS cells to highlight the non-duplicated MUC4.I1 locus (red), the duplicated MUC4.I3 locus (green), and the Chr3 locus (purple).

[0097] Figure 3dTo display Figure 3c A graph showing how the mid-range distance changes over time.

[0098] Figure 4a This is a schematic diagram illustrating the effects of chemical inhibitors A-485 and TSA on H3K27ac histone modification.

[0099] Figure 4b Scatter plots of ZNF 34-step shifts (dx, dy) in U2OS live cells under three conditions: control group (Ctrl, DMSO treatment: gray), A-485 treatment group (A-485, 100 μM, 16 h: blue), and TSA treatment group (TSA, 10 μM, 24 h: red).

[0100] Figure 4c Three-dimensional box plots of ZNF34 in U2OS cells were used to compare the control group (Ctrl, gray, N = 476 sites), the A-485 treatment group (A-485, blue, N = 481 sites), and the TSA treatment group (TSA, red, N = 489 sites).

[0101] Figure 4d This is a scatter plot of the 4-step displacement (dx, dy) of MUC in live U2OS cells.

[0102] Figure 4e Three-dimensional box plots of MUC4 in U2OS cells were used to compare the control group (Ctrl, gray, N = 955 site steps), the A-485 treatment group (A-485, blue, N = 921 site steps), and the TSA treatment group (TSA, red, N = 985 site steps).

[0103] Figure 4f Bar graphs showing the H3K27ac signal around the Xist gene in NIH3T3 (blue), MEF (gray), and XEN (orange) cells.

[0104] Figure 4g Representative images of the Xist gene locus in XEN cells (top), MEF cells (middle), and NIH3T3 cells (bottom) using sgRNA labeled with JF549.

[0105] Figure 4h This is the 3D tracer trajectory of the Xist gene locus.

[0106] Figure 4i Scatter plot of Xist step displacement (dx, dy) in NIH3T3 (blue), MEF (gray), and XEN (orange) cells.

[0107] Figure 4jThree-dimensional step box plots of Xist in NIH3T3 (blue, N=167 site steps), MEF (gray, N=167 site steps), and XEN (orange, N=167 site steps) cells were compared.

[0108] Figure 4k Box plots comparing the step size of Xist in XEN cells between the control group (Ctrl, DMSO treatment, orange, N=130 site steps) and the A-485 treatment group (A485, 100 μM, 16 h, blue, N=130 site steps).

[0109] Figure 4l A model to illustrate the observed correlation between epigenetic states and genome dynamics.

[0110] Figure 4Ea ATAC-seq signal bars around the Xist gene in NIH3T3 (blue), MEF (gray), and XEN (orange) cells. Figure 4Eb Bar graphs showing the H3K4me1 signal around the Xist gene in NIH3T3 (blue), MEF (gray), and XEN (orange) cells. Figure 4Ec The H3K27me3 signal bar graphs around the Xist gene in NIH3T3 (blue), MEF (gray), and XEN (orange) cells.

[0111] Figure 5a The results of an integrated multi-omics analysis of the PCDHα gene cluster and its enhancer HS5-1 in U2OS cells.

[0112] Figure 5b This is a schematic diagram of the PCDHα gene cluster.

[0113] Figure 5c The image shows the results of imaging PCDHα (red, AF647-labeled sgRNA merging) and HS5-1 (green, JF549-labeled sgRNA merging) loci (scale bar, 5 μm) in representative U2OS cells.

[0114] Figure 5d for Figure 5c The two illustrations show the distance between PCDHα and HS5-1 over time, with the dashed line representing the average distance.

[0115] Figure 5e This is a schematic diagram of two non-interacting control loci (locus 1 and locus 2) on chromosome 3.

[0116] Figure 5fRepresentative U2OS cells are imaged to indicate loci 1 (red, JF549) and loci 2 (green, AF488; scale bar, 5 μm).

[0117] Figure 5g for Figure 5f The two illustrations show the distance between loci 1 and loci 2 over time, with the dashed line representing the average distance.

[0118] Figure 5h This shows a distance comparison between the non-interacting control pairs (N = 210 loci pairs) and the PRO-LiveFISH-tagged PCDHα to HS5-1 pairs (N = 210 loci pairs).

[0119] Figure 5i This shows a comparison of the distance between two genomic loci 300 kb apart in non-circular (N = 60 locus pairs) and bound circular (N = 60 locus pairs) states.

[0120] Figure 5j The distance distribution between PCDHα and HS5-1 obtained by PRO-LiveFISH imaging analysis.

[0121] Figure 5k A proposed model is proposed to clarify that the interaction between enhancers and promoters persists to a large extent despite their continuous dynamic motion.

[0122] Figure 5l Imaging of representative female primary MEF cells labeled with the Xist (red, JF549) and Ftx (green, AF488) loci, respectively.

[0123] Figure 5m for Figure 5l The two illustrations show the change in distance over time between the two allele loci, Xist and Ftx. The dashed line represents the average distance.

[0124] Figure 5n Images of representative male primary MEF cells, highlighting the Xist (red, JF549) and Ftx (green, AF488) loci, respectively.

[0125] Figure 5o for Figure 5n The magnified view shows the distance between the Xist and Ftx loci over time, with the dashed line representing the average distance.

[0126] Figure 6a Genomic locations of the non-repetitive MYC regions targeted by 10 sgRNAs and the CCAT1 region within the MYC super-enhancer (SE) were displayed for two-color imaging of HeLa cells.

[0127] Figure 6b Image showing the results of imaging representative HeLa cells labeled MYC (green, JF549) and their SEs (red, CCAT1, AF647) using PRO-LiveFISH.

[0128] Figure 6c for Figure 6b The two illustrations show the distance between MYC and its SE over time, with the dashed line representing the average distance.

[0129] Figure 6d RT-PCR analysis of MYC expression in HeLa cells of the control group (Ctrl, DMSO treatment) and the JQ1 treatment group (JQ1, 5 μM, 24 h).

[0130] Figure 6e This image shows the results of imaging representative HeLa cells labeled with JQ1 (green, JF549) and its SE (red, CCAT1, AF647) after treatment with JQ1 (JQ1, 5 μM, 24 h).

[0131] Figure 6f for Figure 6e The two magnified local images show the distance between the two alleles MYC and its SE (CCAT1) over time, with the dashed line representing the average distance.

[0132] Figure 6g Box plots comparing the distances between MYC and its SE (CCAT1) in HeLa cells of the control group (Ctrl, DMSO treatment: gray, N = 300 locus pairs) and the JQ1 treatment group (JQ1, 5 μM, 24 hours: yellow, N = 300 locus pairs).

[0133] Figure 6h The histograms show the distance between MYC and its SE (CCAT1) in the control group (Ctrl, DMSO treatment, gray, left) and the JQ1 treatment group (JQ1, yellow, right).

[0134] Figure 6i A proposed model to elucidate the role of BRD4 in the three-dimensional organization of the MYC oncogene superenhancer.

[0135] Figure 6Ea PRO-LiveFISH imaged representative female primary MEF cells for the Xist gene locus, based on a set of sgRNAs labeled with JF549.

[0136] Figure 6EbPRO-LiveFISH imaged representative male primary MEF cell Xist gene loci based on a set of sgRNAs labeled with JF549.

[0137] Figure 6Ec DNA FISH image of the Xist gene locus in female primary MEF cells.

[0138] Figure 6 Ed DNA FISH image of the Xist gene locus in male primary MEF cells.

[0139] Figure 6Ee Integrated maps of Hi-C and H3K27ac signals (ChIP-seq) in the Xist and Ftx genomic regions of MEF cells.

[0140] Figure 6Ef DNA FISH images of the Xist and Ftx loci in primary MEF cells from female (top) and male (bottom).

[0141] Figures 7a-7c The images show representative CRISPR-based imaging results of the chr8 site (with 20 target gene sequences and an average gRNA spacing of 20 nt) and the chr19 site (with 22 target gene sequences and an average gRNA spacing of 6 nt) in HEK293T cells, used to construct a fusion protein by linking green fluorescent protein with dCas9.

[0142] Figure 8a This is a schematic diagram of generating a fluorescent sgRNA library through in vitro transcription; Figure 8b and Figure 8c The images show the imaging results of using approximately 500 copies of sgRNA to label the Chr3 site and approximately 82 copies of sgRNA to label the MUC4 site, respectively. Figure 8d A schematic diagram illustrating the effectiveness of the CRISPR PRO-LiveFISH method on the non-repetitive and repetitive regions of the MUC4 locus by using two sets of fluorescently labeled sgRNAs. Figure 8e This is a diagram showing the results of multicolor tracking of two closely located genomic loci.

[0143] Figure 9 This is a schematic diagram of a labeling method for randomly inserted fluorescent dye nucleotides.

[0144] Figure 10a A schematic diagram of the insertion site of non-natural bases into gRNA; Figure 10b Statistical results of fluorescent labeling efficiency at different sites. Detailed Implementation Plan

[0145] The present application will now be described in detail. While specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0146] It should be noted that the terms "comprising" or "including" used throughout the specification and claims are open-ended and should be interpreted as "comprising but not limited to". The subsequent descriptions in the specification are preferred embodiments for carrying out this application; however, these descriptions are intended to illustrate the general principles of this application and are not intended to limit the scope of this application. The scope of protection of this application shall be determined by the appended claims.

[0147] This application provides a gRNA probe library, wherein:

[0148] It includes n gRNA probes, where n is an integer greater than or equal to 1;

[0149] The total length of the genomic regions that can be identified by the spacer sequences of all gRNAs in the gRNA probe library is between 5 and 100 kb.

[0150] The number of target gene sequences targeted by the spacer region sequences of gRNAs in the gRNA probe library is at least 5, and the distance between the two target gene loci identified by any two gRNA spacer region sequences in the gRNA probe library is at least 5 nucleotides.

[0151] The GC content of the spacer region sequence of any gRNA in the gRNA probe library is 35%–85%; and

[0152] The spacer region sequence of any gRNA in the gRNA probe library is 10 to 100 nucleotides in length.

[0153] In some implementations, n can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 20, 22, 25, 30, etc.

[0154] In some implementations, n is 1, meaning one probe can identify multiple sites.

[0155] In some implementations, each gRNA probe in the gRNA probe library can recognize one or more sites.

[0156] In some implementations, the n gRNA probes can be the same or different from each other.

[0157] In some implementations, the number of target gene sequences targeted by the spacer region sequence of any gRNA in the gRNA probe library can be, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 50, 60, 70, 80, 90, etc.

[0158] In some implementations, the distance between two target gene loci at the target locus identified by the spacer region sequences of any two gRNAs in the gRNA probe library can be 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, etc.

[0159] In some embodiments, the GC content of the spacer region sequence of any gRNA in the gRNA probe library may be, for example, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, etc.

[0160] In some implementations, the length of the spacer region sequence of any gRNA in the RNA probe library can be, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, or 100 nucleotides.

[0161] In some implementations, the gRNA probe is a crRNA probe, a tracRNA probe, or an sgRNA probe.

[0162] In this application, gRNA is short for guide RNA, referring to a guiding RNA or master RNA. crRNA refers to CRISPR RNA, which plays a navigational role, guiding CRISPR-related proteins to bind to invading nucleic acids and recognize target sequences. It is an important component of CRISPR gene editing, targeting, and imaging systems. tracrRNA is short for trans-activating crRNA, meaning it is a trans-activating crRNA. sgRNA (single guide RNA), also known as single guide RNA, is obtained by fusing and expressing tracrRNA and crRNA.

[0163] In some implementations, the gRNA probe library can form a functional ribonucleoprotein complex with a nuclease.

[0164] In some embodiments, the nuclease is a Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB, or TnpB nuclease or a variant thereof with a site mutation, preferably a Cas9 nuclease or a variant thereof with a site mutation, said variant including nCas9(D10A), nCas9(H840A), or dCas9(D10A,H840A). For example, a variant of the Cas9 nuclease with a site mutation may be SpCas9, SaCas9, SpG Cas9, SpRY Cas9, or ScCas9 nuclease.

[0165] In some implementations, the crRNA probe, tracRNA probe, or sgRNA probe further comprises an elongated stem-loop structure and a nucleic acid aptamer. For example, the elongated stem-loop structure and nucleic acid aptamer domains may be selected from one or more of MS2, PP7, xrRNA, and eQ1.

[0166] In some implementations, the crRNA probe, tracrRNA, or sgRNA probe contains a modifying group.

[0167] In some implementations, the tracrRNA probe is The sequences of the aforementioned tracrRNA probes include the sequences themselves as well as sequences that introduce non-natural bases.

[0168] In some implementations, the sequence of the crRNA probe is as follows: (m is an integer from 10 to 20), where GUUUAAGAGCUAUGCUGUUUUG is represented by SEQ ID No:2. The sequence of the above crRNA probe includes the sequence itself, as well as the sequence with introduced non-natural bases.

[0169] In some implementations, the sequence of the sgRNA probe is as follows: (m is an integer from 10 to 20), where guuuaagagcuaugcuggaaacagcauagcaaguuuaaauaaggcuaguccguuaucaacuugaaaaag uggcaccgagucggugcuuuuuu is represented by SEQ ID No:3. The sequence of the above sgRNA probe includes the sequence itself, as well as the sequence with introduced non-natural bases.

[0170] In the above tracrRNA probe, crRNA probe, and sgRNA probe sequences, N represents any possible base, the underlined part is the spacer sequence, m represents the length of the spacer sequence, and the bolded underlined part is the available modification site.

[0171] In some implementations, the sequence of the sgRNA probe is as follows: In some implementations, Y is TPT3 or NaM.

[0172] In some embodiments, the modifying group can be directly used to modify tracrRNA, crRNA, or sgRNA at the modification site; alternatively, the bases at the modification site can be replaced with non-natural bases, and the non-natural bases can be modified using the modifying group. In some embodiments, the modifying group is selected from any one or more of the following: fluorescent groups, quantum dots, nanoparticles, therapeutic agents, affinity tags, photocage groups, lipid molecules, peptides, metal complexes, and antibody fragments. In some embodiments, the modifying group is a fluorescent group. Fluorescent groups include, but are not limited to, Cy3, Cy5, Atto565, Atto647, AF488, JF549, and AF647.

[0173] For fluorescently modified tracrRNA, this can be achieved, for example, by attaching a fluorescent group to the 5' or 3' terminal nucleotide. Fluorescent groups include, but are not limited to, Cy3, Cy5, and Atto565.

[0174] For fluorescently modified crRNA probes, this can be achieved, for example, by attaching a fluorescent group to the 5' or 3' terminal nucleotide. Fluorescent groups include, but are not limited to, Cy3, Cy5, Atto565, Atto647, and AF488.

[0175] For fluorescently modified sgRNA probes, for example, this can be achieved by introducing a non-natural base Y into the second stem-loop of the sgRNA, replacing the original A, and then using click chemistry to attach the fluorescent group to the non-natural base Y. Fluorescent groups include, but are not limited to, Cy3, JF549, AF647, and AF488.

[0176] In some embodiments, the gRNA is an sgRNA with the spacer sequence located at the 5' end, and the non-natural base is located at the 3' end and / or stem loop of the backbone sequence, more preferably at the 3' end and stem loop of the backbone sequence.

[0177] In some embodiments, the gRNA is an sgRNA with the spacer sequence located at the 3' end, and the non-natural base is located at the 5' end and / or stem loop of the backbone sequence, more preferably at the 5' end and stem loop of the backbone sequence.

[0178] In some embodiments, the linking chemical reaction is a Staudinger linking reaction, a copper-catalyzed azido-yne cycloaddition reaction, a ring-strained azido-yne cycloaddition reaction, an electron-demanding Diels-Alder [4+2] cycloaddition reaction, or a linking reaction of an N-hydroxysuccinimide ester with an amine.

[0179] In some implementations, the method for preparing an sgRNA probe library containing modified groups is as follows: a PCR reaction is performed using a PCR reaction system containing non-natural base pairs and primers to bind the non-natural base pairs to a designated site in the DNA transcription template library of the sgRNA probe library; the DNA transcription template library is transcribed in vitro to synthesize an sgRNA probe library containing non-natural bases; and modified groups are introduced at the positions of the non-natural bases to obtain an sgRNA probe library containing modified groups.

[0180] In some embodiments, the primer comprises an upstream primer and a downstream primer. For CRISPR gRNAs with a spacer sequence at the 5' end, the upstream primer may contain a T7 promoter and a spacer sequence complementary to the target gene sequence, and the downstream primer is a 3' universal downstream primer. For CRISPR gRNAs with a spacer sequence at the 3' end, the upstream primer contains a T7 promoter and a 5' universal backbone sequence, and the downstream primer contains a partial backbone sequence and a spacer sequence complementary to the target gene sequence.

[0181] In some embodiments, the non-natural base is selected from one or more of the following: CNMO, TAT1, 5FM, NaM, TPT3, 5SICS, MMO2, PICS, Pa, Ds, Px, isoG, isoC, P, Z, and their derivatives. In some preferred embodiments, the non-natural base is TPT3 or NaM.

[0182] This application also provides a method for preparing a gRNA probe library, which includes the following steps:

[0183] A chemically synthesized crRNA library containing modified groups is annealed and assembled with universal tracrRNA to form a gRNA probe library; or

[0184] A gRNA probe library is formed by annealing a crRNA library synthesized through in vitro transcription with chemically synthesized tracrRNA containing modified groups; or...

[0185] Non-natural base pairs are bound to designated sites in the DNA transcription template library of the gRNA probe library. The DNA transcription template library is then transcribed in vitro to synthesize a gRNA probe library containing non-natural bases. Modifying groups are introduced at the positions of the non-natural bases to obtain a gRNA probe library containing modifying groups. Preferably, the non-natural bases are selected from one or more of the following: CNMO, TAT1, 5FM, NaM, TPT3, 5SICS, MMO2, PICS, Pa, Ds, Px, isoG, isoC, P, Z and their derivatives.

[0186] This application also provides a method for designing a gRNA probe library, which includes designing the gRNA probe library according to the following principles:

[0187] The gRNA probe library contains n gRNA probes, where n is an integer greater than or equal to 1;

[0188] The total length of the genomic regions that can be identified by the spacer sequences of all gRNAs in the gRNA probe library is between 5 and 100 kb.

[0189] The number of target gene sequences targeted by the spacer region sequences of the gRNAs in the gRNA probe library is at least 5, and the distance between the two target gene loci recognized by any two gRNA spacer region sequences is at least 5 nucleotides.

[0190] The GC content of the spacer region sequence of any gRNA in the gRNA probe library is 35%–85%; and

[0191] The spacer region sequence of any gRNA in the gRNA probe library is 10 to 100 nucleotides in length.

[0192] In some implementations, the design method of the gRNA probe library also includes using a gRNA off-target prediction tool to filter out gRNAs that target sites other than the target gene site.

[0193] In some implementations, the algorithm for predicting gRNA off-target effects works by searching the entire genome of the target substance for sequences that match the gRNA, identifying fully matched sites and sites with 1-3 mismatches. This application will remove sequences with a high risk of off-target effects based on the results. In some implementations, the gRNA off-target prediction tool is CasOffinder.

[0194] In some implementations, gRNAs are designed with reference to the scoring systems of gRNA design websites.

[0195] This application also provides a method for targeting a specific gene, comprising:

[0196] Nuclease and RNA are assembled to obtain a ribonucleoprotein complex, and the ribonucleoprotein complex is delivered into a cell containing nucleic acid of the target gene;

[0197] The RNA is any of the aforementioned gRNA probe libraries.

[0198] In some embodiments, the nuclease is a nuclease of Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB, or TnpB, or a variant thereof with a site mutation, preferably a nuclease of Cas9 or a variant thereof with a site mutation, the variant of which includes nCas9(D10A), nCas9(H840A), or dCas9(D10A,H840A). For example, a site mutation variant of the Cas9 nuclease may be SpCas9, SaCas9, SpG Cas9, SpRY Cas9, or ScCas9 nuclease.

[0199] This application also provides a nucleic acid imaging method, which includes:

[0200] Nucleases and RNA are assembled to obtain ribonucleoprotein complexes, which are then delivered into cells containing nucleic acids. Nucleic acids are imaged by detecting signals generated by the ribonucleoprotein complexes.

[0201] The RNA is any of the aforementioned gRNA probe libraries.

[0202] In some embodiments, the nuclease may be, for example, a nuclease of Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB, or TnpB, or a variant thereof with a site mutation, preferably a nuclease of Cas9 or a variant thereof with a site mutation, the variant of which includes nCas9(D10A), nCas9(H840A), or dCas9(D10A,H840A). For example, a site mutation variant of the Cas9 nuclease may be SpCas9, SaCas9, SpG Cas9, SpRY Cas9, or ScCas9 nuclease.

[0203] On the other hand, this application also provides the application of any of the aforementioned gRNA probe libraries, gRNA probe libraries prepared by any of the aforementioned preparation methods, gRNA probe libraries designed by any of the aforementioned design methods, any of the aforementioned methods for targeting target genes, or any of the aforementioned nucleic acid imaging methods in cell imaging, gene editing, gene targeting, and delivery systems.

[0204] This application combines RNA-guided nucleases with fluorescently modified gRNA probes, enabling dynamic observation of DNA and RNA by binding to target genomic sequences or RNA transcripts in live cells. By utilizing fluorescently labeled crRNAs, tracrRNAs, and sgRNAs, we achieved real-time imaging of highly repetitive, low-repetitive, and especially non-repetitive sites, establishing a powerful gene imaging toolkit. Previous CRISPR imaging studies only tested fluorescent crRNA probes for imaging highly repetitive sequences. This application systematically explores the probe quantity limitations required for CRISPR LiveFISH (CRISPR live-cell fluorescent insitu hybridization) and uses this toolkit to reveal dynamic changes in Xist gene loci associated with different epigenetic and transcriptional states in different cell types, as well as the dynamic interaction between the PCDHα gene and its enhancer in live cells. In conclusion, the gRNA probe library in this application is a valuable resource for dynamic studies of gene loci in live cells.

[0205] In some implementations, the nucleic acid imaging method of this application can dynamically track multiple closely located genomic loci in multiple colors without interfering with each other. For example, it can dynamically track 1, 2, 3, 4, 5, or 6 different genomic loci in multiple colors.

[0206] The method described in this application produces gRNA compatible with a variety of commercially available fluorescent dyes (including small molecule dyes and quantum dots) based on click chemistry, providing multiple solutions for CRISPR imaging. This system can effectively label gRNA with multicolor dyes, thereby facilitating simultaneous imaging of multiple DNA and RNA targets and contributing to cell visualization and molecular tracking in biological research and medical diagnostics.

[0207] This application enables the preparation of various chemically modified gRNAs with higher stability and longer lifespan through the modification of CRISPR-gRNAs, achieving more precise and efficient CRISPR genome editing and regulation. It also facilitates the preparation of gRNAs modified with various tag bases, which can be used for various gene / chromatin targeting and delivery applications.

[0208] Example

[0209] The cells used in the following examples were obtained by culturing cells using the following methods:

[0210] The cell line was maintained in DMEM supplemented with GlutaMax and 10% fetal bovine serum.

[0211] The microscopic imaging methods used in the following embodiments are as follows:

[0212] Microscopic imaging was performed using a Nikon TiE inverted microscope equipped with an ANDOR Dragonfly confocal microscope system, which included a 60x PLAN APO oil objective (NA=1.40) and lasers at 405nm, 488nm, 561nm, and 637nm. Live-cell imaging was conducted in a humidified chamber, maintaining cells at 37°C and 5% CO2.

[0213] The image processing methods used in the following embodiments are as follows:

[0214] Image processing was performed using Fiji or Imaris. To distinguish genomic sites from the cytoplasmic background, we used the Imaris tool to delineate nuclear boundaries and analyze signals in each imaging channel.

[0215] The imaging data analysis methods used in the following embodiments are as follows:

[0216] Fluorescence imaging data were analyzed using Fiji (ImageJ). For line scan analysis, pixel intensities were obtained from the raw data using Fiji's "Analysis / Plotting Profile" function (ImageJ). Relative intensities were calculated based on the intensity distribution, with the maximum signal intensity set to 1 and the average background intensity set to 0. The signal-to-background ratio was calculated by setting the average background fluorescence intensity in the cell nuclei to 1. The line scan data were plotted using Prism9 (GraphPad).

[0217] To calculate the signal-to-noise ratio (SNR), the maximum intensity of the signal, the average intensity of the background, and the standard deviation (SD) of the background are analyzed using Fiji (ImageJ)'s "Analysis / Histogram" function. The SNR is calculated using the following formula:

[0218] SNR = (Maximum signal strength - Average background strength) / (Background SD)

[0219] The statistical analysis methods used in the following embodiments are as follows:

[0220] The p-values ​​were determined using a two-sided hypothesis test performed in Prism 9 (GraphPad). The significance levels are as follows: **, **, and **** correspond to p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively, while ns indicates no significance. The violin plot illustrates the distribution of the data, with dashed lines representing the 25th percentile, median, and 75th percentile generated by Prism 9 (GraphPad).

[0221] The sequences used in the following examples are as follows, where N represents any possible base, underlined sequences are spacer sequences, and bolded underlined sequences are available modification sites.

[0222] dCas9 tracrRNA sequence (5'-3'):

[0223]

[0224] The fluorescently modified tracrRNA used in the examples was achieved by attaching a fluorescent group to the 5' or 3' terminal nucleotide.

[0225] dCas9 crRNA sequence (5'-3'):

[0226] (m is an integer from 10 to 20).

[0227] The fluorescently modified crRNA used in the examples was achieved by attaching a fluorescent group to the 5' or 3' terminal nucleotide.

[0228] The dCas9 sgRNA sequence (5'-3') is as follows:

[0229] (m is an integer from 10 to 20).

[0230] The fluorescently modified sgRNA used in the examples was achieved by introducing a non-natural base Y (TPT3) into the second stem-loop of the sgRNA, replacing the original A, and then using click chemistry to attach the fluorescent group to the non-natural base Y (TPT3).

[0231] Example 1: Design of a Guided RNA Probe Library for Non-Repetitive Sequence Marking

[0232] (1) gRNA design is crucial for the success of CRISPR LiveFISH imaging. In this embodiment, the sgRNA of *Streptococcus pyogenes* Cas9 was designed using the CHOPCHOP web tool (https: / / chopchop.cbu.uib.no / ). For spacer regions less than 20 nucleotides in length, off-target sites were identified using the Cas OFFinder web tool (http: / / www.rgenome.net / cas-offinder / ). The GC content of the spacers was maintained between 35% and 75% to minimize off-target sites. The first base was ensured to be “G” for efficient in vitro transcription, and additional “G”s were added as necessary.

[0233] (2) When designing the gRNA probe library, the optimal number of LiveFISH probes required for visualizing specific genomic sites was first determined. This was achieved by designing probes for genomic regions with varying numbers of low-repetition sequences (<100 repeats) using fluorescent CRISPR RNA (crRNA) probes. The gRNA probes consist of fluorescent crRNA and unlabeled trans-activating CRISPR RNA (tracrRNA). Figure 1a Annealing generates these fluorescent gRNA probes. These fluorescent gRNA probes bind to the dCas9 protein to form a fluorescent ribonucleoprotein (fRNP) complex, which is then introduced into U2OS cells (a human osteosarcoma cell line) via electroporation.

[0234] This application achieves MUC4 Effective labeling of intron 3 regions (82 repeats) yielded an average signal-to-noise ratio (SNR) of 53 ( ). Figure 1b In contrast, the previously reported high reproducibility... Chr3 The average signal-to-noise ratio at the locus (approximately 500 replicates) was 113. The markers were also effective for regions with fewer replicates. FBN3 Region (repeated 22 times) and ZNF34 Region (repeated 20 times) Figure 1b The average signal-to-noise ratios were 20 and 21, respectively.

[0235] (3) When designing gRNA probe libraries, the distance between two adjacent target gene sites should be at least 5 nucleotides. In this embodiment, a fusion protein of dCas9 linked to green fluorescent protein (dCas9-GFP) was used in HEK293T cells to perform representative CRISPR-based imaging on chr8 sites with 20 target gene sites and an average gRNA spacing of 20 nt; and sites with 22 target gene sites and an average gRNA spacing of 6 nt. The results showed that the relative fluorescence signal of chr8 site labeling was higher in representative cells. Figure 7a and Figure 7b Statistical results also showed that the signal-to-noise ratio (SNR) of the chr8 site marker was significantly higher than that of the chr19 site marker (p < 0.0001). Figure 7c This indicates that the distribution of gRNA affects imaging results, and the minimum spacing between each gRNA-targeted site should be 5 nt.

[0236] Example 2 PRO-LiveFISH v1 - Tracking the real-time dynamics of the PCDHα gene using the LiveFISH fluorescent crRNA library

[0237] Pro-LiveFISH v1 utilizes a library of fluorescent crRNAs covering genomic loci to monitor the dynamics of protein-coding genes. As an example, this embodiment images and tracks the Protocadherinα (PCDHα) gene in human cells. The PCDHα gene is crucial for normal developmental function of the nervous system. This embodiment designs crRNAs (SEQ ID No:4–SEQ ID No:14) targeting a genomic region containing low-repetition sequences and 95 binding sites. Figure 1d Then, Atto565-labeled crRNAs were annealed with unlabeled tracrRNAs, then assembled with dCas9 protein to generate fRNPs, which were subsequently delivered into U2OS live cells for imaging. Figure 1c In this study, the Atto565-labeled crRNA library was synthesized by IDT or Sangon, and unlabeled tracrRNA was synthesized using in vitro transcription. Experimental results showed that the Pro-LiveFISH v1 method was used for efficient imaging of the PCDHα gene in U2OS cells. Two distinct signal points at the PCDHα site were also observed in live cells. Figure 1e and Figure 1f Therefore, the Pro LiveFISH v1 method is efficient in labeling gene-coding genes.

[0238] Example 3 PRO-LiveFISH v2 - Live-cell imaging of non-repetitive sites using a library of in vitro transcribed crRNAs and fluorescently labeled tracrRNAs.

[0239] This example first tested the feasibility of using fluorescent tracrRNA paired with unlabeled crRNA for imaging repetitive regions. Using fluorescent tracrRNA, this method successfully labeled the Chr3 locus (approximately 500 repeats) and MUC4 intron 3 (82 repeats) with highly repetitive sequences. Figure 1g However, it was ineffective for the ZNF34 locus (20 repeats) with low repetition sequences. Notably, when imaging the Chr3 locus, the signal-to-noise ratio (SNR) of fluorescent tracrRNA was significantly lower than that of fluorescent crRNA. Figure 1h Using a two-color imaging strategy ( Figure 1i A similar trend was observed, where crRNA and tracrRNA labeled with different fluorophores were paired to target Chr3 (…). Figure 1j , Figure 1k The study also examined the ZNF34 locus (with 20 repeat sequences) and the MUC4 locus. Furthermore, when imaging the ZNF34 site with 20 repeat sequences, the fluorescent tracrRNA signal was weak, with a signal-to-noise ratio mostly below 10 (mean = 4.7), while crRNA achieved stable imaging. These results indicate a decrease in the labeling efficiency of fluorescent tracrRNA.

[0240] To image non-repetitive sites using tracr-LiveFISH, we used an in vitro transcribed crRNA library in combination with a common fluorescent tracrRNA. Figure 11 Due to the low labeling efficiency of fluorescent tracrRNA, we increased the size of the crRNA library to improve imaging of non-repetitive genomic target regions. Specifically, we designed a library containing 257 crRNAs (SEQ ID No:15–SEQ ID No:271) targeting a region approximately 7 kb upstream of the human PAX6 gene, which is crucial for embryonic development. Figure 1m (and Supplementary Table 2). tracr-LiveFISH successfully labeled the PAX6 site, and a clear signal was observed in representative cell nuclei (and Supplementary Table 2). Figure 1n Therefore, although the labeling efficiency of fluorescent tracrRNA is lower than that of fluorescent crRNA, this limitation can be overcome by using a larger library of crRNAs that span the target genomic region, thereby enabling imaging of non-repetitive genomic sites.

[0241] Example 4: Multicolor imaging using a fluorescent sgRNA library targeting non-repetitive sites

[0242] Considering the challenges and costs of directly synthesizing fluorescent sgRNAs through chemical synthesis, this application develops a method for generating a fluorescent sgRNA library through in vitro transcription. Figure 8a An sgRNA IVT template DNA library was generated via PCR using an upstream primer library containing the T7 promoter and a spacer region sequence complementary to the genomic target, and a universal downstream primer containing the sgRNA 3' region. This technique enables simultaneous imaging of multiple genomic sites in living cells.

[0243] As an example, we used approximately 500 copies of sgRNA to label the Chr3 site (imaging results are shown below). Figure 8b (as shown) and approximately 82 copies of sgRNA marker MUC4 site (imaging results as shown) Figure 8c (As shown).

[0244] In addition, this application also confirmed the effectiveness of the CRISPR PRO-LiveFISH method on the non-repetitive region (region 1) and repetitive region (region 2) of the MUC4 locus by using two sets of fluorescently labeled sgRNAs. Figure 8d By co-delivering JF549-labeled sgRNA targeting non-repetitive MUC4 region 1 and AF647-labeled sgRNA targeting repetitive MUC4 region 2, along with dCas9 protein, to U2OS cells, we observed significant close proximity between JF549-labeled region 1 and AF647-labeled region 2. Figure 8e These results demonstrate that the method is suitable for imaging non-repetitive sites and for dynamic multicolor tracking of two closely located genomic sites. Figure 8e ).

[0245] The marking method used in this embodiment is as follows: Figure 2a As shown, the labeling sites in stem-loop 2 were rationally designed, and the GAAA quadruple loop was replaced with a GAYA loop containing UBP insertion. Using chemically synthesized DNA primers containing an artificial base (X) at a predetermined position, a PCR amplification DNA template containing orthogonal UBPs was generated for IVT. During transcription, the UBP in the DNA template guides the Y nucleotide site with the reactive group to specifically insert into the GAYA loop designed with sgRNA. Subsequently, the mixture was incubated overnight at 37°C and purified. Then, a click chemical reaction was performed between the non-natural base-labeled sgRNA and the azide-modified dye, causing the fluorophore to modify the non-natural base; site-specific fluorescently labeled sgRNA was obtained. Figure 2a , Figure 2b and Figure 2Eb ).

[0246] Example 5: UBP-based fluorescent sgRNA probes enable multicolor LiveFISH imaging.

[0247] UBP-based LiveFISH technology can simultaneously image multiple genomic loci in living cells. Figure 2k To achieve this goal, we used click chemistry to label UBP-sgRNAs targeting different gene loci with different dyes. Figure 2k For example, we labeled UBP-sgRNA targeting the ZNF34 gene locus with JF549 dye and sgRNA targeting the MUC4 gene locus with AF647 dye. After co-delivery of these sgRNAs, the ZNF34 and MUC4 gene loci exhibited different localizations and dynamic changes in living cells. Figure 2l , Figure 2m This confirms that there is no signal crosstalk between the two channels in UBP-based multicolor LiveFISH.

[0248] In contrast, fluorescence imaging of dCas9 using pre-assembled RNPs exhibited significant crosstalk. We prepared two independently assembled RNPs in vitro: dCas9-EGFP with JF549-sgRNA (targeting the Chr13 locus) and unlabeled dCas9 with AF647-sgRNA (targeting the Chr3 locus), and co-delivered them to U2OS cells. Due to the interaction between the pre-assembled RNPs, live-cell imaging showed that dCas9-EGFP (green) unexpectedly localized to the Chr3 locus (red), instead of the expected Chr13-specific localization.

[0249] To further demonstrate the versatility of our multicolor labeling technology, we simultaneously labeled up to six different genomic loci in live cells. Figure 2n We generated UBP-based fluorescent sgRNAs and assigned them three primary colors—red (JF549), green (AF488), and blue (AF647)—and expanded this color library by generating three additional combined colors. This method enables the clear visualization of each genomic locus by specific colors or color combinations, allowing us to simultaneously visualize up to six different genomic loci in living cells. Figure 2n These results highlight the technology's ability to perform multicolor imaging of different genomic loci in living cells.

[0250] Example 6: Selection of gRNA modification sites for site-specific fluorescent labeling

[0251] This embodiment uses the highly repetitive Chr3 site as an example to compare two in vitro transcription-based methods: a method that randomly inserts dye nucleotides during transcription, and a method that uses unnatural base pairs (UBP) for site-specific labeling of sgRNAs based on expanded genetic alphabet technology.

[0252] (1) Methods for randomly inserting fluorescent dye nucleotides: such as Figure 9 As shown, fluorescent sgRNAs were prepared by randomly inserting Cy3-UTPs during in vitro transcription. The specific method was as follows: a DNA template with a T7 promoter was generated by PCR; the reverse transcription reaction mixture with Cy3-UTP added was incubated at 37°C for 4 to 8 hours; and then the fluorescently labeled sgRNAs were obtained after purification. Because fluorescently modified uracil was randomly inserted into some sites that should have been inserted into native uracil during transcription, randomly labeled sgRNAs were obtained.

[0253] (2) Site-specific labeling method: Refer to the labeling method used in Example 4.

[0254] Fluorescently labeled sgRNAs obtained by the two methods described above were delivered to cells via electroporation. Specifically, fluorescent sgRNAs were mixed with dCas9 protein to form an RNP complex. The assembled RNP complex was transfected into U2OS cells using the standard protocol of the Neon Transfection System 10 μL kit (Thermo Fisher, Cat#MPK1025). Transfected cells were immediately transferred to preheated culture medium. Hoechst 33342 (Thermo Fisher, Cat#H3570) was added to the cells for nuclear staining before imaging. We compared the live-cell imaging performance of fluorescent sgRNAs generated based on RI and UBP strategies. Site-specific labeling of the sgRNA loop region using orthogonal UBP significantly improved the signal-to-noise ratio (SNR) compared to randomly labeled sgRNAs. Although both methods produced fluorescent sgRNAs that labeled the highly repetitive Chr3 site (…),… Figure 2c and Figure 2Ec However, the signal-to-noise ratio (SNR) of site-specific labeled sgRNA probes based on UBP was more than 3 times higher than that of fluorescent gRNA generated by the RI method and fluorescent gRNA labeled by fluorescent tracrRNA. Figure 2dThese results indicate that UBP-mediated stem-loop 2-site specific labeling can generate high-quality LiveFISH probes, possibly by reducing interference with sgRNA-DNA hybridization or dCas9 interactions. Figure 2a ).

[0255] Further analysis showed that the performance of orthogonally UBP-labeled fluorescent sgRNA in imaging the Chr3 and MUC4 regions was very close to that of chemically synthesized fluorescent crRNA, both exhibiting significantly higher signal-to-noise ratios than fluorescent tracrRNA. Figure 1h , Figure 2d Notably, the UBP-based sgRNA probe effectively labeled 20 repeats of the ZNF34 site. Figure 2e Its signal-to-noise ratio is comparable to that of fluorescent crRNA, and superior to that of fluorescent tracrRNA. Figure 2f ).

[0256] UBP-based fluorescent sgRNA labeling of genomic loci has been validated by DNA FISH, and the results show that LiveFISH and FISH labeling signals co-localize. Figure 2g Furthermore, RNA FISH and real-time quantitative PCR (RT-qPCR) analyses confirmed that the LiveFISH labeling method had no significant effect on endogenous ZNF34 transcription, indicating that the RNAFISH probe co-localized with the PRO-LiveFISH DNA labeling signal.

[0257] Previous studies have shown that fluorescent gRNAs exhibit higher sensitivity than dCas9 labels due to the intrinsic stability switch of gRNAs. Consistent with this finding, UBP-labeled fluorescent sgRNAs have a higher signal-to-noise ratio than fluorescent dCas9. For example, when imaging low-repetition ZNF34 sites using fRNPs containing dCas9-EGFP and UBP-labeled sgRNAs ( Figure 2h The sgRNA channel exhibits a strong site-specific signal, while the dCas9-EGFP channel shows almost no signal differentiation. Figure 2h , Figure 2i Overall, UBP-labeled fluorescent sgRNA showed a signal-to-noise ratio (SNR) improvement of more than 3-fold at both the MUC4 and ZNF34 sites. Figures 2h-2j Furthermore, dCas9-EGFP exhibits nonspecific accumulation in the nucleolus, while this undesirable accumulation is not observed in sgRNA channels. Figure 2hThe enhanced performance of fluorescent sgRNA stems from a target DNA-dependent stability switch: unbound sgRNA degrades rapidly, while binding to the target DNA stabilizes the target sgRNA in the Cas9:sgRNA:DNA ternary complex, thus ensuring high specificity and minimal background interference.

[0258] Example 7: Selection and Optimization of Non-Natural Base Modification Sites

[0259] This embodiment explores suitable sites in sgRNA for inserting non-natural bases. Based on the complex structure of Cas9, sgRNA, and target DNA (PDB ID: 8G1I), we hypothesize that labeling the stem-loop and end of sgRNA can avoid affecting sgRNA base pairing. Furthermore, these sites do not participate in Cas9 protein recognition; therefore, introducing non-natural bases for labeling will not affect the formation of the Cas9 and sgRNA complex.

[0260] This application tested the effectiveness of non-natural base labeling modification at different sites on sgRNA using fluorescent labeling. Different genomic sites were labeled separately, and based on… Figure 10a A schematic diagram of the insertion sites of non-natural bases into sgRNA is shown. Following the method in Example 4, non-natural bases were introduced into the stem-loop of sgRNA, the 3' end of sgRNA, and both the stem-loop and 3' end of sgRNA. Subsequently, a click chemistry reaction was used to modify the fluorophore to the corresponding sites on the sgRNA. Fluorescence detection demonstrated that site-specific labeling of non-natural bases could be achieved at the stem-loop and end of sgRNA. Figure 10b The statistical results of the fluorescent labeling efficiency show that, compared with labeling at the end of sgRNA, we found that labeling at the internal stem-loop position is more efficient.

[0261] Example 8: Live-cell imaging of non-repetitive sites using a site-specific fluorescent sgRNA library

[0262] The UBP-based LiveFISH method, which uses a library of fluorescent sgRNAs with orthogonal bases to image non-repetitive sites, is called CRISPR PRO-LiveFISH. Figure 3a To address the challenges of chemically synthesizing fluorescent sgRNAs, this strategy utilizes DNA oligonucleotide libraries to generate high-quality, site-specific fluorescent gRNA libraries for live-cell imaging of non-repetitive sequences.

[0263] In PRO-LiveFISH, the DNA template library encoding sgRNA is generated via PCR, using a library of forward primers containing different spacer sequences, and a single common reverse primer containing orthogonal non-natural bases (X) at a specified site. Figure 3a Following this, an IVT reaction was performed to generate a library of sgRNAs containing a modified non-natural base (Y) at the designed stem-loop 2 position, for site-specific fluorescent labeling. Figure 3a This fluorescent sgRNA library is assembled with dCas9 to form an fRNP library, which is used as a PRO-LiveFISH probe. Figure 3a ).

[0264] To test this method, we designed a JF549-tagged PRO-LiveFISH fRNP library containing 80 sgRNAs targeting the non-repetitive MUC4 intron 1 region. Figure 3b (SEQ ID No: 272~SEQ ID No: 351). As a control, we generated AF647 marker RNPs targeting the nearby repeating MUC4 intron 3 region and AF488 marker RNPs targeting the Chr3 site using a UBP-based method. Since the two MUC4 intron regions are approximately 30kb apart in the genome (…),… Figure 3b Therefore, the repeating MUC4 intron 3 is used as a reference to verify the accuracy of the non-repeating MUC4 intron 1 labeling.

[0265] We validated the labeling ability of PRO-LiveFISH on non-repetitive MUC4 intron 1 sites and two nearby repetitive sites using multicolor imaging of live cells. The JF549-labeled non-repetitive MUC4 intron 1 site was very close to the AF647-labeled intron 3 site. Figure 3c , Figure 3d This confirms the ability of CRISPR PRO-LiveFISH to image non-repetitive genomic sites. Furthermore, we tracked the dynamic changes of these three regions and plotted their distances over time. Although there is dynamic movement between the two intronic regions of the MUC4 locus, the average physical distance between them (30 kb) is greater than the distance between the MUC4 intron 3 locus and the Chr3 locus (approximately 300 kb). Figure 3d (Closer.) Therefore, CRISPR PRO-LiveFISH technology can image non-repetitive sites and perform multicolor tracking of local chromatin dynamics at genomic sites that are close in location.

[0266] Example 9 uses the CRISPR PRO-LiveFISH method to monitor the dynamics of PCDHα and enhancer interactions.

[0267] The interaction between enhancers and promoters plays a crucial role in regulating gene expression and determining cell fate. Enhancers are DNA sequences that amplify the transcription of target genes and interact with promoters over long distances via chromatin loops. This interaction is essential for activating gene transcription by recruiting transcriptional machinery and regulatory proteins to the promoter region.

[0268] In this embodiment, the dynamics of enhancer-gene interactions are visualized using the CRISPR PRO-LiveFISH method, taking the PCDHα gene as an example. It is hypothesized that the PCDHα promoter cluster activates gene expression by forming chromatin loops with downstream common enhancer elements (especially the HS5-1 enhancer). Therefore, this embodiment constructs a library of 44 AF647-labeled sgRNAs targeting the PCDHα region (SEQ ID No: 362–SEQ ID No: 405) and a library of 52 JF549-labeled sgRNAs targeting the HS5-1 region (SEQ ID No: 406–SEQ ID No: 457). Figure 5b PRO-LiveFISH gRNA and dCas9 were co-delivered to U2OS cells, enabling simultaneous imaging of the PCDHα and HS5-1 regions. Figures 5b-5d ).

[0269] Uniallelic tracing in live U2OS cells revealed that, although the PCDHα gene and the HS5-1 enhancer exhibited dynamic movement, they largely maintained close spatial proximity. Figure 5b -d). In contrast, non-interacting control sites, approximately 235 kb apart, exhibited significantly greater spatial separation ( Figure 5e Quantitative analysis showed that the spatial distance between the PCDHα gene and the HS5-1 enhancer was 0.23 ± 0.12 μm, significantly lower than that of the control pair without interaction (0.77 ± 0.20 μm). Figure 5h This spatial proximity and Hi-C interaction data ( Figure 5a This consistency supports the view that despite the dynamic movement of chromatin, the EP interaction between the PCDHα gene promoter and the HS5-1 enhancer still keeps them spatially close.

[0270] To further verify the observed spatial proximity corresponding to the EP circular structure, we designed an artificial chromosome loop between two loci approximately 300 kb apart. (Compared to the non-circular state...) Figure 5i In comparison, although the artificially restrained ring structure undergoes continuous dynamic movement, its spatial distance is significantly shortened. Figure 5iNotably, the natural PCDHα-HS5-1 ring structure exhibits similar spatial compression and dynamic properties to the artificially bound ring, suggesting that persistent EP interactions may still be maintained despite chromatin movement. Figure 5h , Figure 5i Further statistical analysis showed that in over 90% of the traced alleles in living cells, the spatial proximity between the PCDHα and HS5-1 loci remained within <0.4 μm. Figure 5j This was further confirmed by FISH. Based on these results, we hypothesize that, despite chromatin movement dynamics, the PCDHα promoter-enhancer pair tends to function in a relatively persistent anchored loop conformation, which may facilitate sustained communication between the two loci in living cells. Figure 5k This interaction between the PCDHα promoter and its enhancer differs from previous studies, which suggested that chromatin loops primarily employ acyclic or partially cyclic configurations. This difference may reflect variations in genome-environment-dependent chromatin dynamics.

[0271] Example 10 reveals the correlation between epigenetic status and genome dynamics in different cell types.

[0272] Epigenetic modifications regulate precise gene regulation during development and differentiation. Fluorescence in situ hybridization (FISH) imaging reveals distinct patterns in chromatin expression associated with specific epigenetic states. In living cells, fluorescently labeled histone or DNA stains can be used to study overall changes in chromatin condensation caused by epigenetic alterations. Differentiated cells possess unique epigenetic signatures that are crucial for cell type-specific gene expression. However, how epigenetic modifications affect the real-time dynamics of specific coding gene loci, particularly across different cell types, remains unclear.

[0273] To investigate the effects of histone acetylation on chromatin dynamics, we examined the dynamics of the MUC4 and ZNF34 gene loci in U2OS cells. A-485, a P300 / CBP acetyltransferase inhibitor, decreased H3K27ac levels; TSA, a histone deacetylase (HDAC) inhibitor, increased H3K27ac levels. Figure 4a For both gene loci, A-485 treatment enhanced genomic locus migration, while TSA treatment decreased it, indicating a negative correlation between H3K27ac levels and genome migration. Figures 4b-4e ).

[0274] Because differentiated cells possess distinct epigenetic characteristics that form the basis for cell type-specific gene expression, we investigated whether epigenetic status is also associated with genome dynamics across different cell types. We focused on the Xist locus on the X chromosome, which is crucial for X chromosome inactivation in female cells. Multi-omics analyses, including ChIP-seq and ATAC-seq of H3K27ac, H3K4me1, and H3K27me3, revealed the epigenetic status of the Xist locus across different cell types. Figure 4f , Figure 4Ea-Figure 4Ec To perform live-cell imaging, we selected three mouse cell types with different H3K27ac levels. Figure 4f ): Male NIH3T3 cells (lowest), female mouse embryonic fibroblasts (MEF, moderate), and extraembryonic endoderm (XEN) cells (highest).

[0275] We designed a LiveFISH probe library targeting the Xist locus (SEQ ID No:352–SEQ ID No:361) and visualized its dynamic changes in live XEN, MEF, and NIH3T3 cells. Male NIH3T3 cells typically express one Xist locus, while female MEF and XEN cells express two Xist loci, consistent with their X chromosome copy number. Figure 4g RNA-FISH and RT-qPCR analyses confirmed that the PRO-LiveFISH marker did not alter Xist expression, and the detected Xist RNA transcripts were very similar to the PRO-LiveFISH DNA marker signal. In XEN cells, the Xist locus was more dispersed and less densely packed than in NIH3T3 and MEF cells, occupying a significantly larger area. Figure 4g This is consistent with the higher chromatin accessibility measured by ATAC-seq and was validated by DNAFISH (4a).

[0276] The Xist locus exhibits different dynamic characteristics in different cell types. Figures 4h-4j Dynamic tracking showed that, compared with NIH3T3 and MEF cells, the Xist locus had lower migration and restricted motility in XEN cells. Figures 4h-4j Notably, the migration rate of the Xist locus was negatively correlated with active chromatin markers (e.g., H3K27ac, H3K4me1) and chromatin accessibility as measured by ATAC-seq signals. Figure 4f , Figure 4j and Figure 4Ea , Figure 4EbFor example, the Xist locus, which has the lowest migration rate in XEN cells, has the highest levels of active chromatin markers (e.g., H3K27ac, H3K4me1) and chromatin accessibility. Figure 4f , Figures 4h-4j and Figure 4Ea , Figure 4Eb ).

[0277] Differences in Xist site viable cell kinetics were associated with H3K27ac levels across different cell types, consistent with the relationships observed at MUC4 and ZNF34 sites after inhibitor treatment. To assess whether these cell type differences reflected a potential causal relationship, we used A-485 to reduce H3K27ac levels in XEN cells, resulting in a significant increase in Xist site migration (…). Figure 4k In summary, these results (from intrinsic epigenetic differences between differentiated cell types and epigenetic perturbations via small molecules) support a negative correlation between active chromatin markers and chromatin migration. Figure 4l ).

[0278] Example 11: Monitoring the dynamic changes of Xist and enhancer interactions in primary mouse fibroblasts using CRISPR PRO-LiveFISH technology.

[0279] CRISPR PRO-LiveFISH technology enables real-time tracking of genomic loci and gene-enhancer interactions in primary cells. For the Xist locus, CRISPR PRO-LiveFISH successfully tagged female primary MEFs (two X chromosomes). Figure 6Ea Two loci in ), and male primary MEF (one X chromosome, Figure 6Eb One of the Xist loci was identified and validated using DNA FISH. Figure 6Ec , Figure 6 Ed ).

[0280] The Ftx region, located approximately 70 kb in Xist, acts as an enhancer of Xist, promoting its transcription and thus playing a crucial role in X chromosome inactivation. Hi-C data analysis revealed an interaction between Ftx and Xist. Figure 6EeTo explore the dynamic interaction between Xist and its enhancer (Ftx) in primary MEF cells, we designed two sets of sgRNAs using PRO-LiveFISH technology: sgRNAs targeting the Ftx locus (SEQ ID No: 458–SEQ ID No: 569) and sgRNAs targeting the Xist locus (SEQ ID No: 352–SEQ ID No: 361). We simultaneously imaged these two loci using two sets of fRNPs. Our live-cell imaging showed that although Ftx and Xist exhibit dynamic movement, they are located close to each other in primary MEF cells, a finding confirmed by DNA FISH experiments. Figures 5l-5o and Figure 6Ef This supports the interaction between the Ftx enhancer and the Xist locus in primary MEF cells. These results highlight the effectiveness of PRO-LiveFISH in real-time visualization of chromatin interactions between genes and their enhancers in primary cells at single-cell resolution.

[0281] Example 12: Visualization of the key role of BRD4 in the interaction between the oncogene MYC locus and its super-enhancer in cancer cells.

[0282] In many cancers, overexpression of key oncogenes (such as MYC) is driven by super-enhancers (SEs), characterized by large clusters of enhancers rich in H3K27ac, transcription factors, and coactivators. BRD4, a BET family protein and histone acetylation reader, is enriched in SEs and is crucial for activating key oncogenes. BRD4 inhibitors (such as JQ1) can suppress SE-driven oncogene expression and tumor growth. However, the role of BRD4 in regulating SE-related genomic three-dimensional structure remains controversial. Hi-C studies have shown that BRD4 deficiency destabilizes approximately 70% of chromatin loops, accompanied by spatial decompression observed in FISH; while Capture-C analysis indicates that BRD4 inhibition has minimal impact on the EP interaction between MYC and BCL2 sites. Therefore, live-cell imaging is crucial for investigating the contribution of BRD4 to the regulation of SE-related three-dimensional structure.

[0283] To investigate the role of BRD4 in regulating the dynamic interaction between the MYC oncogene and its SE region, we designed two sets of fluorescent PRO-LiveFISH probes (SEQ ID No:580–SEQ ID No:589 and SEQ ID No:570–SEQ ID No:579) to target the MYC oncogene and its distal enhancer region (CCAT1, SE), which are 400 kb apart, in the human cervical cancer cell line HeLa. PRO-LiveFISH technology uses only 10 fluorescent sgRNA libraries targeting each site to efficiently perform live-cell imaging of the MYC and CCAT1 sites. Figures 6a-6c In HeLa cells, despite chromatin motility dynamics, a tight spatial proximity was observed between the MYC oncogene and its enhancer CCAT1, indicating the presence of an SE-MYC loop. Figure 6b , Figure 6c RNAFISH and RT-qPCR analyses confirmed that RNA expression remained unchanged after PRO-LiveFISH labeling and revealed colocalization between the RNAFISH probe and the PRO-LiveFISH DNA labeling signal.

[0284] To investigate the role of BRD4 in maintaining the SE tissue between MYC and its SE (CCAT1), HeLa cells were treated with the BRD4 inhibitor JQ1. Consistent with previous results, JQ1 treatment inhibited MYC expression ( Figure 6d It is worth noting that JQ1 inhibition of BRD4 increases the spatial distance between MYC-CCAT1 pairs. Figure 6e , Figure 6f This indicates that the MYC-SE loop interaction is unstable after BRD4 inhibition. Quantitative analysis showed that in HeLa cells, the spatial distance between MYC and CCAT1 increased from 0.35±0.18 μm to 0.54±0.20 μm. Figure 6g DNAFISH analysis confirmed this. Further live-cell imaging analysis showed that JQ1 treatment caused a shift in the MYC-CCAT1 distance distribution, with the main peak at 0.46 μm and the secondary peak at 0.92 μm. Figure 6h Based on these findings, we hypothesize that BRD4 inhibition leads to partial dissociation of the MYC-CCAT1 loop, resulting in a mixture of loose, partially looped, and non-looped states in individual cells. Figure 6i Furthermore, increased migration rates of both MYC and CCAT1 sites were observed after JQ1 treatment, consistent with loop instability induced by BRD4 inhibition.

[0285] In summary, our PRO-LiveFISH data provide direct live-cell evidence demonstrating that BRD4 plays a crucial role in regulating SE-mediated three-dimensional chromatin interactions at the oncogenic MYC site. JQ1 inhibition of BRD4 not only suppresses MYC expression but also disrupts the stability of SE-gene interactions, indicating that BRD4 is involved in transcriptional activation and the maintenance of SE-mediated three-dimensional genome structure.

[0286] Studying the dynamic changes of specific genomic loci in living cells is crucial for understanding the spatiotemporal structure of the three-dimensional genome and its gene regulation. In this study, we developed the CRISPR PRO-LiveFISH toolkit using orthogonal bases from expanded genetic codon technology to generate rationally designed, site-specific fluorescent sgRNAs for sensitive imaging of non-repetitive genomic loci in living cells. Using PRO-LiveFISH, we revealed the correlation between decreased genome mobility and active epigenetic states, and achieved multiple tracking of EP interaction dynamics in various cell types, including primary cells. Our data suggest that persistent EP interactions may exist in living cells despite continuous chromatin movement. Furthermore, our live-cell imaging data directly demonstrate the role of BRD4 in maintaining oncogenes. MYC -SE interactions play a crucial role in the three-dimensional structure of the genome. Therefore, PRO-LiveFISH provides a sensitive and multiplexed live-cell genome imaging platform based on expanded genetic codon technology, which can be used to study chromatin dynamics and three-dimensional genome structure.

[0287] The high sensitivity of PRO-LiveFISH stems from its combination of codon amplification technology and structure-guided orthogonal base sgRNA design, enabling efficient imaging of non-repetitive sites without signal amplification. Compared to previous reagent-based live-cell imaging methods, CRISPR PRO-LiveFISH requires only 10 sgRNAs from the MYC site to achieve reliable imaging of non-repetitive genomic regions. In contrast, the previous fluorescent dCas9-based CAS-LiveFISH technology used 288 sgRNAs to image the MYC site, while Oligo-LiveFISH technology used 340 gRNAs to image the MYC region. Furthermore, this study systematically evaluated fluorescent labeling strategies compatible with IVT-based hybrid gRNA synthesis, including dCas9 labeling (…). Figures 2h-2j ), tracrRNA markers ( Figures 2c-2f ) and sgRNA markers ( Figure 2c , Figure 2d and Figure 2Ea-Figure 2EcFurthermore, it was found that site-specific labeled UBP-sgRNAs in PRO-LiveFISH provide efficient imaging performance with high sensitivity and specificity. The high sensitivity of CRISPR PRO-LiveFISH reduces the number of sgRNAs required to image non-repetitive loci, which not only enhances experimental feasibility but also reduces potential interference with native genome organization and function.

[0288] Compared to DNA-encoded CRISPR imaging systems, CRISPR PRO-LiveFISH offers a reagent-based, sensitive platform that enables multicolor live-cell genomic imaging in various cell types, including primary cells, without the need for genetic engineering or signal amplification. Previous DNA-encoded CRISPR imaging systems required strict control over the expression of multiple components, often necessitating the construction of stable cell lines or transgenic animals for reliable imaging of non-repetitive or low-repetitive sites. Furthermore, the need for orthogonal imaging systems presented challenges in multicolor imaging. While signal amplification methods can image non-repetitive sites using single gRNAs, recent studies have raised concerns about non-specific signals generated by unbound sgRNAs or DNA regions transcribed from sgRNAs in control cells. CRISPR PRO-LiveFISH overcomes these challenges by balancing high sensitivity, specificity, and versatility, achieving efficient labeling of non-repetitive genomic sites and enabling multiplex live-cell imaging in different cell types.

[0289] While epigenetic modifications are key to gene regulation, visualizing their impact on coding region dynamics across different cell types remains challenging. Although previous studies have shown that dCas9-KRAB-mediated H3K9me3 deposition affects chromatin migration, these observations have been limited to highly repetitive regions. Using CRISPR PRO-LiveFISH, our study reveals a significant correlation between active chromatin markers and reduced coding region migration. This correlation was observed at genomic loci with intrinsic epigenetic differences between differentiated cell types and at multiple loci after epigenetic perturbation with small molecules. These results suggest that active epigenetic states are generally associated with reduced chromatin migration, likely due to decondensed chromatin binding to more transcription factors and experiencing greater friction in the nuclear environment. Previous H2B-based live-cell imaging studies have reported enhanced nucleosome dynamics in acetylated regions and reduced migration in transcription initiation regions (marked by RNAP2-Ser5ph). Our locus-level measurements of DNA dynamics revealed reduced locus migration associated with enhanced histone acetylation. We propose that the locus-level DNA migration measured by CRISPR PRO-LiveFISH in this study integrates the dynamic changes in nucleosome-rich and nucleosome-free regions, and may be further influenced by DNA-binding factors, chromatin three-dimensional structure, nuclear condensates, and the surrounding nuclear environment. For example, enhanced histone acetylation may enhance transcription factor binding and EP interactions, thereby limiting locus migration.

[0290] Our study provides new insights into the dynamics of EP interactions and the involvement of regulatory protein factors: high-sensitivity imaging of non-repetitive loci without signal amplification; multiplex in vivo imaging of EP dynamics in primary cells; application of expanded genetic codons (XY) to sgRNA generation; and enabling specific labeling to enhance sensitivity. While previous studies have proposed transient loop interactions in mammalian cells, our statistical analysis suggests that PCDHα-enhancer pairs likely maintain persistent, spatially proximal interactions despite changes in chromatin motion dynamics, potentially reflecting genomic environment-dependent chromatin dynamics. Although slight cell movement may occur between imaging channels during live-cell imaging, the live-cell observations are consistent with DNAFISH and Hi-C data, suggesting that persistent EP interactions may facilitate communication at the studied loci. Furthermore, while previous studies have reported controversial results regarding the role of BRD4 in 3D genome organization, our study provides live-cell evidence demonstrating the important role of BRD4 in maintaining 3D interactions between SEs and oncogenes, as well as oncogene activation, as illustrated by the disruption of MYC-enhancer interactions induced by the BRD4 inhibitor JQ1. In summary, these findings demonstrate the applicability of CRISPR PRO-LiveFISH in providing spatiotemporal insights into chromatin dynamics, EP interactions, and regulatory protein functions.

[0291] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.

[0292] sequence list

[0293]

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300]

[0301]

[0302]

[0303]

Claims

1. A gRNA probe library, wherein: It includes n gRNA probes, where n is an integer greater than or equal to 1; The total length of the genomic regions that can be identified by the spacer sequences of all gRNAs in the gRNA probe library is between 5 and 100 kb. The number of target gene sequences targeted by the spacer region sequences of gRNAs in the gRNA probe library is at least 5, and the distance between the two target gene loci identified by any two gRNA spacer region sequences in the gRNA probe library is at least 5 nucleotides. The GC content of the spacer region sequence of any gRNA in the gRNA probe library is 35%–85%; and The spacer region sequence of any gRNA in the gRNA probe library is 10 to 100 nucleotides in length.

2. The gRNA probe pool of claim 1, wherein, gRNA probe libraries can form functional ribonucleoprotein complexes with nucleases; The gRNA probe is a crRNA probe, a tracrRNA probe, or a sgRNA probe.

3. The gRNA probe library according to claim 2, wherein the nuclease is a nuclease of Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB or TnpB or a variant thereof with a site mutation, including nicked enzymes and variants that retain binding ability without nuclease activity, preferably a nuclease of Cas9 or a variant thereof with a site mutation, preferably a variant of the nuclease of Cas9 with a site mutation including nCas9(D10A), nCas9(H840A) or dCas9(D10A,H840A).

4. The gRNA probe library according to claim 2, wherein, The crRNA probe, tracrRNA probe, or sgRNA probe also includes an elongated stem-loop structure and a nucleic acid aptamer.

5. The gRNA probe library according to claim 4, wherein the extended stem-loop structure and nucleic acid aptamer domain are selected from one or more of MS2, PP7, xrRNA and eQ1.

6. The gRNA probe library according to claim 2, wherein, The crRNA probe, tracrRNA, or sgRNA probe contains a modifying group.

7. The gRNA probe library according to any one of claims 2 to 6, wherein, The sequence of the tracrRNA probe is GGAACCAUUCAAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGU UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU; or, The sequence of the crRNA probe is N1N2N3...N m-1 N m GUUUAAGAGCUAUGCUGUUUUG, wherein m is an integer from 10 to 20; or, The sequence of the sgRNA probe is N1N2N3...N m-1 N m GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU UUU, wherein m is an integer from 10 to 20.

8. The gRNA probe library according to claim 6, wherein, The gRNA probe has non-natural bases, and the modification group is located on the non-natural bases. Preferably, the modification site is a site that does not participate in pairing with the target gene sequence.

9. The probe library according to claim 8, wherein, The non-natural base is located on the gRNA backbone sequence, preferably at the 3' or 5' end and / or stem loop of the backbone sequence, more preferably at the 3' or 5' end and stem loop of the backbone sequence.

10. The probe library according to claim 9, wherein, The sequence of the tracrRNA probe is as follows: Wherein, when the gRNA probe is a tracrRNA probe, the non-natural bases are located at the bold underlined positions; or, The sequence of the crRNA probe is as follows: Where m is an integer from 10 to 20, and when the gRNA probe is a crRNA probe, the non-natural base is located at the bold underlined position; or the sequence of the sgRNA probe is Where m is an integer from 10 to 20, and when the gRNA probe is an sgRNA probe, the non-natural bases are located at the bold underlined positions; preferably, the sequence of the sgRNA probe is as follows:

11. The gRNA probe library according to claim 6, wherein, The modifying group is selected from any one or more of the following: fluorescent groups, quantum dots, nanoparticles, therapeutic drugs, affinity tags, photocage groups, lipid molecules, peptides, metal complexes, and antibody fragments.

12. The gRNA probe library according to claim 6, wherein, The method for preparing the gRNA probe library containing modified groups includes the following steps: A chemically synthesized crRNA library containing modified groups is annealed and assembled with universal tracrRNA to form a gRNA probe library; or A gRNA probe library is formed by annealing a crRNA library synthesized through in vitro transcription with chemically synthesized tracrRNA containing modified groups; or Non-natural base pairs are bound to designated sites in the DNA transcription template library of the gRNA probe library. The DNA transcription template library is then transcribed in vitro to synthesize a gRNA probe library containing non-natural bases. Modifying groups are introduced at the positions of the non-natural bases to obtain a gRNA probe library containing modifying groups.

13. The gRNA probe library according to claim 12, wherein, By introducing modifying groups at the positions of the non-natural bases through a linker chemical reaction, a gRNA probe library containing the modified groups is obtained.

14. The gRNA probe library according to claim 8, wherein, The non-natural bases are selected from one or more of the following: CNMO, TAT1, 5FM, NaM, TPT3, 5SICS, MMO2, PICS, Pa, Ds, Px, isoG, isoC, P, Z and their derivatives.

15. A method for preparing a gRNA probe library, comprising the following steps: A chemically synthesized crRNA library containing modified groups is annealed and assembled with universal tracrRNA to form a gRNA probe library; or A gRNA probe library is formed by annealing a crRNA library synthesized through in vitro transcription with tracrRNA containing modified groups; or Non-natural base pairs are bound to designated sites in the DNA transcription template library of the gRNA probe library. The DNA transcription template library is then transcribed in vitro to synthesize a gRNA probe library containing non-natural bases. Modifying groups are introduced at the positions of the non-natural bases to obtain a gRNA probe library containing modifying groups. Preferably, the non-natural bases are selected from one or more of the following: CNMO, TAT1, 5FM, NaM, TPT3, 5SICS, MMO2, PICS, Pa, Ds, Px, isoG, isoC, P, Z and their derivatives.

16. A method for designing a gRNA probe library, comprising designing the gRNA probe library according to the following principles: The gRNA probe library contains n gRNA probes, where n is an integer greater than or equal to 1; The total length of the genomic regions that can be identified by the spacer sequences of all gRNAs in the gRNA probe library is between 5 and 100 kb. The number of target gene sequences targeted by the spacer region sequences of the gRNAs in the gRNA probe library is at least 5, and the distance between the two target gene loci recognized by any two gRNA spacer region sequences is at least 5 nucleotides; and The GC content of the spacer region sequence of any gRNA in the gRNA probe library is 35%–85%; the length of the spacer region sequence of any gRNA in the gRNA probe library is 10–100 nucleotides.

17. A method for targeting a gene, comprising: Nuclease and RNA are assembled to obtain a ribonucleoprotein complex, and the ribonucleoprotein complex is delivered into a cell containing nucleic acid of the target gene; The RNA is the gRNA probe library described in any one of claims 1 to 14.

18. The method according to claim 17, wherein, The nuclease is a nuclease of Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB or TnpB or a variant thereof with a site mutation, including nicked enzymes and variants that retain binding capacity but lack nuclease activity. Preferably, it is a nuclease of Cas9 or a variant thereof with a site mutation. Preferably, the variants of the Cas9 nuclease with a site mutation include nCas9(D10A), nCas9(H840A) or dCas9(D10A,H840A).

19. A nucleic acid imaging method, comprising: Nucleases and RNA are assembled to obtain ribonucleoprotein complexes, which are then delivered into cells containing nucleic acids. Nucleic acids are imaged by detecting signals generated by the ribonucleoprotein complexes. The RNA is the gRNA probe library described in any one of claims 1 to 14; Preferably, the nuclease is a nuclease of Cas9, Cas10, Cas12, Cas13, CasX, CasMINI, IscB or TnpB or a variant thereof with a site mutation, including nicked enzymes and variants that retain binding capacity but lack nuclease activity. Preferably, it is a nuclease of Cas9 or a variant thereof with a site mutation. More preferably, the variants of the Cas9 nuclease with a site mutation include nCas9(D10A), nCas9(H840A) or dCas9(D10A,H840A).

20. The application of the gRNA probe library of any one of claims 1 to 14, the gRNA probe library prepared by the preparation method of claim 15, the gRNA probe library designed by the design method of claim 16, the method for targeting target genes as described in claim 17 or 18, or the nucleic acid imaging method as described in claim 19 in cell imaging, gene editing, gene targeting, and delivery systems.

Images