A nucleic acid fragment, nanoliposome and application thereof in preparing CAR-T cells in vivo

By constructing CAR-T cells that activate and induce the secretion of IL-4 or IL-10 and nanoliposomes modified with hyaluronidase PH20 and CD44, the problems of CAR-T cell depletion and poor nanoliposome permeability were solved, achieving efficient in vivo preparation and anti-tumor effects.

CN122303272APending Publication Date: 2026-06-30SHENZHEN LAIMANG BIOTECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHENZHEN LAIMANG BIOTECHNOLOGY CO LTD
Filing Date
2024-12-30
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing CAR-T cell therapies face the problem of CAR-T cell depletion in the treatment of solid tumors. Furthermore, traditional in vitro preparation methods are cumbersome, costly, and susceptible to contamination, while nanoliposomes have poor permeability in solid tumors.

Method used

CAR-T cells that can be activated and induced to secrete IL-4 or IL-10 were constructed. CAR-T cells were prepared in vivo by expressing CAR nucleic acid fragments that can be activated and induced to secrete IL-4 or IL-10 and combining them with hyaluronidase PH20 and CD44-modified nanoliposomes.

Benefits of technology

It improves the anti-tumor activity of CAR-T cells, reduces preparation costs and complexity, and enhances the permeability of nanoliposomes in solid tumors and the efficiency of T cell transduction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303272A_ABST
    Figure CN122303272A_ABST
Patent Text Reader

Abstract

This invention discloses a nucleic acid fragment, nanoliposomes, and their application in the in vivo preparation of CAR-T cells, belonging to the field of immunocellular therapy technology. This invention constructs a CAR nucleic acid fragment that can be delivered in vivo via various methods to obtain in vivo activated and induced enhanced CAR-T cells that secrete IL-4 or IL-10. These CAR-T cells do not secrete IL-4 or IL-10 in a resting state, thus avoiding the inhibitory effects of IL-4 or IL-10 on their proliferative capacity and effector function. When the CAR-T cells are specifically activated by tumor cells, they can secrete IL-4 or IL-10, thereby restoring the vitality of CAR-T cells and enhancing their long-term anti-tumor activity through metabolic reprogramming of IL-4 or IL-10. This invention achieves in vivo induced CAR-T cell generation, with the advantages of simple operation and low cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of immune cell therapy technology, and in particular to a nucleic acid fragment, nanoliposomes, and their application in the in vivo preparation of CAR-T cells. Background Technology

[0002] CAR-T cells are normal T cells that have been genetically modified to carry receptors targeting specific targets, thus giving them specific recognition and killing functions. They can be used to treat cancer, autoimmune diseases, and infectious diseases. CAR-T cell therapy, as a revolutionary immunotherapy method, has shown great potential in the field of cancer treatment. However, the application of CAR-T therapy in the treatment of solid tumors still faces significant challenges. CAR-T cells in the tumor microenvironment exhibit a loss of effector function and proliferative capacity, defined as T cell "exhaustion," which may be caused by continuous antigen stimulation and other metabolic stresses in the tumor microenvironment (PMID: 27521269; 30923193). Delaying CAR-T cell exhaustion and improving its persistence are key to improving the efficacy of CAR-T cell therapy.

[0003] Interleukin-4 (IL-4) and interleukin-10 (IL-10) are both type II cytokines with complex biological functions and a significantly dual mechanism of action. On the one hand, IL-4 and IL-10 can inhibit the production of inflammatory cytokines by Th1 cells and suppress T cell-specific proliferation by reducing the expression of major histocompatibility complex II (MHC-II), thus playing a negative regulatory role in the inflammatory response. On the other hand, recent studies have reported that IL-4 and IL-10 play an active role in the tumor microenvironment. Specifically, IL-4 and IL-10 can promote the number and function of tumor-infiltrating lymphocytes (TILs), especially in terminally exhausted T cells, where IL-10 can restore their vitality through metabolic reprogramming, thereby enhancing the response to cancer immunotherapy (PMID: 34031618, 39322664, 39322665). Given the dual role of IL-4 and IL-10 in immune regulation, their secretion needs precise regulation to fully leverage their role in promoting T-cell immune function. Specifically, IL-4 and IL-10 should be released only when T cells are highly activated, which helps enhance the anti-tumor function of T cells.

[0004] Traditional CAR-T cell preparation methods require drawing blood from patients and expanding and culturing them in vitro. This process is not only cumbersome and costly, but also requires highly specialized equipment and technicians, limiting its accessibility to many patients. Furthermore, the preparation process is susceptible to contamination by exogenous bacteria or viruses, further increasing the risks and uncertainties of treatment. In vitro CAR-T cell preparation also requires patients to wait a long time, potentially causing them to miss the treatment window for those with rapidly progressing diseases. Developing a simple, in vivo CAR-T cell preparation method that does not require blood draws is of great significance. In vivo CAR-T cell preparation can transform personalized CAR-T cell therapy products into readily available and universal treatment products, significantly reducing costs and prices, and improving patient accessibility.

[0005] Currently, various nanoliposomes are used for in vivo CAR-T cell preparation. However, the application of nanoliposomes in the treatment of malignant solid tumors still faces the problem of poor permeability. Most solid tumors form a dense extracellular matrix containing a large amount of hyaluronic acid (HA). HA is a non-sulfated glycosaminoglycan and an important component of the extracellular matrix. It has extremely high water-holding capacity, which can increase the hydrostatic pressure of solid tumor tissue, blocking liposomes from entering the tumor stroma and making it difficult for nanoliposomes to transduce tumor-infiltrating T cells into CAR-T cells. Hyaluronic acid can bind to receptors on the cell surface, with CD44 being one of the main receptors for hyaluronic acid binding. PH20 is a hyaluronidase, a glycosylphosphatidylinositol (GPI)-anchored single-chain membrane glycoprotein. PH20 has important applications in drug formulation and gene therapy because it can increase tissue permeability, thereby promoting drug distribution. CN102307993A discloses an extended soluble PH20 polypeptide and its uses; however, this method cannot specifically degrade hyaluronic acid at the target site. Modifying nanoliposomes with CD44 and PH20 is expected to enhance their ability to infiltrate solid tumors, thereby improving the anti-tumor efficacy of nanoliposomes in the preparation of CAR-T cells. Summary of the Invention

[0006] The purpose of this invention is to provide a nucleic acid fragment, nanoliposomes, and their application in the in vivo preparation of CAR-T cells, thereby addressing the problems existing in the prior art. This invention constructs an enhanced CAR-T cell that is activated and induced to secrete IL-4 or IL-10. This CAR-T cell does not secrete IL-4 or IL-10 in a resting state, thus avoiding the inhibitory effect of IL-4 or IL-10 on its proliferative capacity and effector function. When the CAR-T cell is specifically activated by tumor cells, it can secrete IL-4 or IL-10, thereby allowing IL-4 or IL-10 to restore the vitality of the CAR-T cell and enhance its long-term anti-tumor activity through metabolic reprogramming.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides a CAR nucleic acid fragment for expressing activation-inducible IL-4 or IL-10. The CAR nucleic acid fragment can be obtained by cloning a nucleic acid fragment into an expression vector or by in vitro synthesis. The CAR nucleic acid fragment comprises the following three parts:

[0009] (1) Activation of the inducible promoter;

[0010] (2) Either IL-4 or IL-10 gene;

[0011] (3) CAR gene;

[0012] The activation-inducible promoter comprises 3-6 NFAT binding motifs and an interleukin-2 core promoter sequence, and the nucleotide sequence is any one of the sequences shown in SEQ ID NO. 1-4; the nucleotide sequence of IL-4 is shown in SEQ ID NO. 6, and the nucleotide sequence of IL-10 is any one of the sequences shown in SEQ ID NO. 7 or SEQ ID NO. 29-36.

[0013] The CAR gene includes the scFv gene sequence, transmembrane region, co-stimulatory structure, and intracellular signal transduction structure.

[0014] Optionally, the scFv gene sequence includes an scFv gene sequence targeting EGFRvIII, an scFv gene sequence targeting MSLN, and an scFv gene sequence targeting CD19.

[0015] The transmembrane region includes any one or a combination of at least two of the following: the α chain of the T cell receptor, the β chain of the T cell receptor, CD3ζ, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or the GITR transmembrane region.

[0016] The co-stimulatory structures include any one or a combination of at least two of 4-1BB, CD28, CD137, OX-40, or ICOS;

[0017] The intracellular signal transduction structures include any one or a combination of at least two of CD3ζ, BCR, NKp30, NKp44, NKp46, FcαR, FcRγ, CD16, or CD32.

[0018] Optionally, the scFv gene sequence targeting EGFRvIII has the nucleotide sequence shown in SEQ ID NO.14; the scFv gene sequence targeting MSLN has the nucleotide sequence shown in SEQ ID NO.15; and the scFv gene sequence targeting CD19 has the nucleotide sequence shown in SEQ ID NO.16.

[0019] The transmembrane region is the CD8 transmembrane region, and its nucleotide sequence is shown in SEQ ID NO.17;

[0020] Preferably, the co-stimulatory structure is 4-1BB, and the nucleotide sequence is shown in SEQ ID NO.18;

[0021] The intracellular signal transduction structure is CD3ζ, and its nucleotide sequence is shown in SEQ ID NO.19.

[0022] Optionally, the CAR nucleic acid fragment further includes an EF-1α promoter and a transcription termination sequence, wherein the nucleotide sequence of the EF-1α promoter is shown in SEQ ID NO.5 and the nucleotide sequence of the transcription termination sequence is shown in SEQ ID NO.20;

[0023] The CAR nucleic acid fragment also includes a signal peptide, the nucleotide sequence of which is any one of the sequences shown in SEQ ID NO.8 and SEQ ID NO.9-13;

[0024] The CAR gene is linked to IL-4 or IL-10 by a nucleotide sequence encoding a 2A peptide, the nucleotide sequence encoding the 2A peptide being shown in any one of SEQ ID NO.21 or SEQ ID NO.37-39.

[0025] The present invention also provides a vector comprising the aforementioned nucleic acid fragment, wherein the vector includes a retroviral vector, an adeno-associated virus vector, a lentiviral vector, an adenovirus vector, or a liposome. The present invention is not limited to the above-mentioned vectors, and may also include other vectors capable of delivering the nucleic acid fragment to cells in vivo or in vitro.

[0026] The present invention also provides an in vivo delivery type lentiviral capsid plasmid, which is obtained by cloning the scFv sequence, CD44 extracellular segment and PH20 extracellular segment of an anti-CD3 antibody into the plasmid, wherein the nucleotide sequences of the scFv sequence, CD44 extracellular segment and PH20 extracellular segment of the anti-CD3 antibody are shown in SEQ ID NO.24, SEQ ID NO.25 and SEQ ID NO.26, respectively.

[0027] The present invention also provides a CAR-T cell or a nanoliposome containing a CAR gene, wherein the nanoliposome is modified with hyaluronidase PH20, CD44, and anti-CD3 antibody, and the nanoliposome encapsulates the CAR nucleic acid fragment.

[0028] This invention also provides a method for preparing nanoliposomes containing CAR nucleic acid fragments, comprising the following steps:

[0029] Dipalmitoylphosphatidylethanolamine-polyethylene glycol-succinimide ester was dissolved and then added dropwise to hyaluronidase PH20, CD44, and anti-CD3 antibody. The mixture was stirred and reacted, and then dialyzed and freeze-dried to obtain nanoliposomes I modified with hyaluronidase PH20, CD44, and anti-CD3 antibody.

[0030] 4-(N,N-dimethylamino)butyrate (dilinoleyl) methyl ester, dioleoylphosphatidylethanolamine, cholesterol, dimyristoylglycerol-polyethylene glycol 2000, (2,3-dioleoyl-propyl)-trimethylammonium chloride, (2,3-dioleoyl-propyl)-trimethylammonium chloride, and distearate-phosphatidylethanolamine-microtubule-associated-nucleus-localization peptide were dissolved in an organic solvent to prepare a lipid oil phase solution. The CAR nucleic acid fragment was dissolved to prepare an aqueous phase solution. The aqueous phase solution and the lipid oil phase solution were mixed and hydrated, and then extruded using an extruder to obtain a liposome suspension.

[0031] The liposome suspension was ultrafiltered and then mixed with nanoliposome I overnight to obtain nanoliposomes containing CAR nucleic acid fragments.

[0032] Optionally, the ratio of dipalmitoylphosphatidylethanolamine-polyethylene glycol-succinimide ester, hyaluronidase PH20, CD44 and anti-CD3 antibody is (1-3) mol∶(1-2) mg∶(0.1-0.5) mg∶(0.1-0.5) mg; the stirring reaction conditions are: stirring reaction at room temperature for 3-5 hours;

[0033] The molar ratio of 4-(N,N-dimethylamino)butyrate (dilinoleyl) methyl ester, dioleoylphosphatidylethanolamine, cholesterol, dimyristoylglycerol-polyethylene glycol 2000, (2,3-dioleoyl-propyl)-trimethylammonium chloride, (2,3-dioleoyl-propyl)-trimethylammonium chloride and distearate-phosphatidylethanolamine-microtubule-associated-nuclear-localization peptide is 6:3:10:1:6:1;

[0034] The total amount of 4-(N,N-dimethylamino)butyrate (dilinoleyl) methyl ester, dioleoylphosphatidylethanolamine, cholesterol, dimyristoylglycerol-polyethylene glycol 2000, (2,3-dioleoyl-propyl)-trimethylammonium chloride, (2,3-dioleoyl-propyl)-trimethylammonium chloride, and distearate-phosphatidylethanolamine-microtubule-associated-nuclear-localization peptide is in a mass ratio of (8-10):1 to the CAR nucleic acid fragment.

[0035] The molar ratio of the nanoliposome I to the CAR nucleic acid fragment is 1:(3-5).

[0036] This invention also provides the use of the CAR nucleic acid fragment, the vector, the lentiviral capsid plasmid, the CAR-T cells, or nanoliposomes containing the CAR gene in any of the following:

[0037] (1) Application in the preparation of drugs that activate and induce the secretion of IL-4 or IL-10 in vivo;

[0038] (2) Use in the preparation of antitumor drugs, wherein the tumors include hematologic malignancies, gliomas, mesotheliomas, pancreatic cancers and ovarian cancers.

[0039] The present invention discloses the following technical effects:

[0040] (1) The present invention constructs an activation-induced CAR-T cell that secretes IL-4 or IL-10. IL-4 or IL-10 is only secreted after the CAR-T cell is specifically activated by tumor cells, thereby exerting the metabolic reprogramming effect of IL-4 or IL-10 on CAR-T cells, promoting the vitality of CAR-T cells in the activated state, while avoiding the immunosuppressive effect of IL-4 or IL-10 on CAR-T cells in the resting state.

[0041] (2) Compared with existing CAR-T technology, the CAR-T cells provided by this invention can have better long-term anti-tumor effects under the action of IL-4 or IL-10.

[0042] (3) Compared with existing nanoliposomes, the nanoliposomes provided by the present invention are modified by T cell surface antibodies, human CD44 and hyaluronidase PH20, which can better enter solid tumor tissues and efficiently transduce T cells infiltrating solid tumor tissues into CAR-T cells.

[0043] (4) Compared with existing viral vectors, the viral vector capsid provided by the present invention is modified by T cell surface antibody, human CD44 and hyaluronidase PH20, which can better enter solid tumor tissue and efficiently transduce T cells infiltrating solid tumor tissue into CAR-T cells.

[0044] (5) Compared with in vitro CAR-T preparation technology, the enhanced CAR nucleic acid fragment provided by this invention can be delivered in vivo through multiple routes, and T cells can be genetically modified in vivo to become enhanced CAR-T cells that secrete IL-4 or IL-10. The operation is simple and the cost is lower than that of traditional CAR-T preparation methods. This invention realizes the preparation of CAR-T cells directly in vivo, reducing the difficulty and cost of CAR-T cell preparation. Attached Figure Description

[0045] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0046] Figure 1 Structural intent for expressing CAR nucleic acid fragments that induce activation of IL-4 or IL-10;

[0047] Figure 2 A map containing a capsid plasmid expressing anti-CD3 antibody scFv, CD44, and PH20;

[0048] Figure 3 Results of infection efficiency assay for activation-inducible IL-4 or IL-10 anti-CD19 CAR-T cells;

[0049] Figure 4 To detect cytokine secretion levels in different CAR-T cells using ELISA;

[0050] Figure 5In vitro proliferation curves of different CAR-T cells;

[0051] Figure 6 Results of antiMSLN iCAR-T cell transduction efficiency assay;

[0052] Figure 7 Results of transfection efficiency assay for T cells transfected with nanoliposomes containing the CAR gene;

[0053] Figure 8 To detect the in vivo delivery efficiency of anti-CD3 antibody, CD44 and PH20 modified liposomes;

[0054] Figure 9 The statistical results show the number of CAR-T cells per gram of tumor. Detailed Implementation

[0055] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0056] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0057] The term "nucleic acid" refers to polymers of deoxynucleotides (such as DNA, cDNA) or nucleotides (such as RNA, mRNA), or combinations of deoxynucleotides and nucleotides (such as DNA / RNA), including linear or circular structures, and single-stranded or double-stranded forms. This term should not be construed as a limitation on polymer length and can include known natural nucleotide analogs, as well as nucleotides modified at the base, sugar, and / or phosphate moieties (such as thio groups). Generally, analogs of a particular nucleotide have the same base pair specificity, such as the A and T base pairs.

[0058] The term "vector" refers to a tool or system that can deliver nucleic acids into cells, including liposomes or viral vectors or nucleic acid (DNA or RNA) molecules such as plasmids or circular RNA, containing one or more different nucleic acid sequences, for the purpose of transformation and / or amplification between different host cells. The term "expression vector" refers to any vector that efficiently fuses and expresses one or more nucleic acids of the present invention in cells, preferably under promoter regulation.

[0059] Any vector known in this technology can be used in this invention. A vector refers to a tool or system that can deliver nucleic acids to cells, including liposomes or viral vectors, such as retroviral vectors (e.g., MSGV, MMLV), adeno-associated virus vectors (AAV), lentiviral vectors (e.g., pwPxld, pLV), and adenovirus vectors (AD).

[0060] The term “treatment” means the use of any composition, pharmaceutical composition, therapeutic agent, compound, etc. disclosed to a party for the purpose of: (1) suppressing disease, i.e. preventing the development of clinical symptoms; and / or (2) alleviating disease, even if clinical symptoms subside.

[0061] The term "prevention" refers to the disclosure to a party of any composition, pharmaceutical composition, therapeutic agent, compound, etc., even if the clinical symptoms of a disease do not develop.

[0062] The immune cells of the present invention can be used alone or as a pharmaceutical composition. The pharmaceutical compositions of the present invention can be combined with one or more drugs or physiologically acceptable carriers or diluents, including the immune cells described in the present invention, such as CAR-T cells. The composition may include buffers, such as neutral buffered saline, phosphate buffer, etc.; carbohydrates, such as glucose, mannose, sucrose, or dextran, mannitol; proteins; peptides or amino acids, such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (such as aluminum hydroxide); and preservatives. The compositions of the present invention are preferably formulated for intravenous administration.

[0063] The pharmaceutical compositions of the present invention may further include at least one additional therapeutic agent or therapy. A variety of other additional therapeutic agents may be used in combination with the compositions of the present invention. Preferably, the at least one additional therapeutic agent or therapy is an anticancer agent or anticancer therapy useful for treating cancer, preferably hematologic malignancies. Preferably, one or more anticancer therapies will be selected from combinations of radiotherapy, chemotherapy, immune checkpoint inhibitors, immunotherapy, and hormone therapy, or a combination thereof.

[0064] Methods for treating and / or preventing cancer in patients or research subjects include: (1) removing and isolating immune cells, such as mononuclear cells, from the patient or research subject; (2) genetically engineering the immune cells with a recombinant structure encoding activation-inducible IL-4 or IL-10 to construct CAR-T cells expressing activation-inducible IL-4 or IL-10; (3) an in vivo delivery system containing a CAR vector of activation-inducible IL-4 or IL-10; and (4) reinfusing the in vivo delivery system containing the CAR vector of activation-inducible IL-4 or IL-10 into the patient or research subject. Upon in vivo delivery of the CAR vector containing activation-inducible IL-4 or IL-10 into the patient or research subject, the T cells will be converted into CAR-T cells expressing activation-inducible IL-4 or IL-10 and mediate a cellular immune response against the tumor.

[0065] To further illustrate the technical means and effects of the present invention, the following detailed embodiments will be used in conjunction with the accompanying drawings to further explain the technical solution of the present invention. However, the present invention is not limited to the scope of the embodiments.

[0066] For any techniques or conditions not specified in the examples, the procedures should be followed according to the technical conditions described in the literature in this field or the product instructions. All reagents or instruments without a specified manufacturer are standard products that can be purchased through legitimate channels.

[0067] Example 1: Construction of CAR plasmids expressing activation-inducible IL-4 or IL-10

[0068] The following sequences were obtained from the NCBI database: activation-inducible promoter sequence containing 3-6 NFAT binding motifs and IL-2 core promoter sequence, EF-1α promoter sequence, IL-4 gene sequence, IL-10 gene sequence, signal peptide sequence, antiEGFRvIII scFv gene sequence, antiMSLN scFv gene sequence, antiCD19 scFv gene sequence, CD8 transmembrane region gene sequence, 4-1BB co-stimulatory structure gene sequence, CD3ζ gene sequence, and transcription termination sequence.

[0069] IL-4 DNA sequences containing 3-6 NFAT motifs of a hypoxia-inducible promoter (e.g., nucleotide sequence containing 6 NFAT motifs, as shown in SEQ ID NO.4):

[0070] IL-2 core promoter sequences containing 3-6 NFAT motifs:

[0071] SEQ ID NO.1 (IL-2 core promoter DNA sequence containing 3 NFAT motifs):

[0072] aattgggaggaaaaactgtttcatacagaaggcgt caattg ggaggaaaaactgtttcatacagaagg cgt caattg ggaggaaaaactgtttcatacagaag gcgt caattgcattttgacacccccataatatttttccagaattaacagtataaattgcatctcttgttcaagagttccctatcactctctttaatcactactcacagtaacctcaactcctgc (The underlined part is the NFAT motif).

[0073] SEQ ID NO.2 (IL-2 core promoter DNA sequence containing 4 NFAT motifs):

[0074] aattg ggaggaaaaactgtttcatacagaaggcgt caattg ggaggaaaaactgtttcatacagaagg cgt caattg ggaggaaaaactgtttcatacagaag gcgt caattg ggaggaaaaactgtttcatacagaaggcgt caattgcattttgacacccccataatatttttccagaattaacagtataaattgcatctcttgttcaagagttc cctatcactctctttaatcactactcacagtaacctcaactcctgc.

[0075] SEQ ID NO.3 (IL-2 core promoter DNA sequence containing 5 NFAT motifs):

[0076] aattg ggaggaaaaactgtttcatacagaaggcgt caattg ggaggaaaaactgtttcatacagaagg cgt caattg ggaggaaaaactgtttcatacagaag gcgt caattg ggaggaaaaactgtttcatacagaaggcgt caattg ggaggaaaaactgtttcatacagaaggcgt caattgcattttgacacccccataatatttttcca gaattaacagtataaattgcatctcttgttcaagagttccctatcactctctttaatcactactcacagtaacctcaactcctgc.

[0077] SEQ ID NO.4 (IL-2 core promoter DNA sequence containing 6 NFAT motifs):

[0078] aatta ggaggaaaaactgtttcatacagaaggcgt caattg ggaggaaaaactgtttcatacagaagg cgt caattg ggaggaaaaactgtttcatacagaaggcgt caattg ggaggaaaaactgtttcatacagaaggcgt caattgggaggaaaaactgtttcatacagaaggcgt caattg ggaggaaaaactgtttcatacagaaggcgt caattgcattttgacacccccataatatttttccagaattaacagtataaattgcatctcttgttcaagagttccctatcactctctttaatcactactcacagtaacctcaactcctgc。

[0079] SEQ ID NO.5 (EF-1α promoter DNA sequence):

[0080]

[0081] SEQ ID NO. 6 (IL-4 DNA sequence):

[0082] cacaagtgcgatatcaccttacaggagatcatcaaaactttgaacagcctcacagagcagaagactctgtgcaccgagttgaccgtaacagacatctttgctgcctccaagaacacaactgagaaggaaaccttctgcagggctgcgactgtgctccggcagttctacagccaccatgagaaggacactcgctgcctgggtgcgactgcacagcagttccacaggcacaagcagctgatccgattcctgaaacggctcgacaggaacctctggggcctggcgggcttgaatagctgtcctgtgaaggaagccaaccagagtacgttggaaaacttcttggaaaggctaaagacgatcatgagagagaaatattcaaagtgttcgagctaa。

[0083] SEQ ID NO. 7 (IL-10 DNA sequence):

[0084] ggccagggcacccagtctgagaacagctgcacccacttcccaggcaacctgcctaacatgcttcgagatctccgagatgccttcagcagagtgaagactttctttcaaatgaaggatcagctggacaacttgttgttaaaggagtccttgctggaggactttaagggttacctgggttgccaagccttgtctgagatgatccagttttacctggaggaggtgatgccccaagctgagaaccaagacccagacatcaaggcgcatgtgaactccctgggggagaacctgaagaccctcaggctgaggctacggcgctgtcatcgatttcttccctgtgaaaacaagagcaaggccgtggagcaggtgaagaatgcctttaataagctccaagagaaaggcatctacaaagccatgagtgagtttgacatcttcatcaactacatagaagcctacatgacaatgaagatacgaaactga。

[0085] The IL-10 DNA sequence is not limited to the above sequence and can also be the following sequences: (1) SEQ ID NO.29: tcaccaggacaaggaacccaat ccgaaaacagctgcactcattttccaggttggctgcctaatatgctgagggatcttagagatgcttttagtagagtgaagactttcttccagatgaaagatcagttggacaacttgcttctgaaagaatctctgctcgaggatttcaaagggtaccttgggtgccaggccctgtctgagatgatccagttctatctggaggaggtcatgccccaggcagaaaaccaggacccggacatcaaagcccatgtgaatagcctgggggaaaatttgtttactcttagattgagactgcgcagatgtcataggtttctcccctgtgaaaacaagagtaaggctgttgagcaggtcaagaatgcgtttaacaagctgcaggagaaaggaatatacaaggccatgtccgagtttgacatattcatcaactatattgaagcctacatgaccatgaagatacgcaatacaacaaccccagcaccgcggccaccaactccagcccctaccatcgctagccaacctttgtctcttaggccagaagcttgtcggcctgccgctggaggagccgtccatacacgaggactggattttgcttgcgatatttacatatgggccccactggctggcacctgtggcgttctcctgctttccctggtcatcacactctattgc; (2) SEQ ID NO.30:tcacctggacaaggaacccagtccgaaaactcatgcactcatttcccaggctggctgcccaatatgctccgagatct gagggatgccttcagtagggtcaagacgttttttcagatgaaggaccagctcgacaatctgcttctgaaggaatcactgctcgaggacttcaagggctacctgggttgccaagctttgtctgagatgattcagttttatctggaggaagttatgcctcaggccgagaatcaggatcctgacattaaggcccacgttaacagtctgggtgaaaacctctttactttgcgatggcggctgcggaggtgccacagattcctgccttgcgagaacaaaagtaaggcggtcgagcaggtgaagaatgctttcaataagctccaggagaaggggatctacaaagcaatgtccgaattcgatatattcattaattacatcgaggcctatatgaccatgaagatccgcaatacaacaactccagccccacggcctcctacccctgctccgacaatcgcgtcccaaccgttgagcctccggccagaggcgtgcagacctgctgccgggggagctgtccatactagagggttggacttcgcctgcgacatctatatttgggctcccctcgcaggaacatgtggcgtgcttctgctgagcttggttatcacactctattgt;(3)SEQ ID NO.31:tcaccaggacagggaactc aatctgaaaattcttgcacgcacttccccggttggcttcccatgatgctgagggatctgagggatgcattttctcgggtgaagacattcttccagatgaaggatcagctcgataacctccttctgaaagagtcattgctcgaggacttcaaggggtatttgggctgccaggccctctctgaaatgattcagttctatctggaggaggttatgccacaagcagagaatcaggaccccgacatcaaagcacatgtgaactcacttggcgagaatctttttactctgcgcttgcgactccgcaggtgtcatagatttcttccctgtgagaacaagagtaaagccgtcgaacaggtgaaaaatgccttcaacaagctgcaggagaaggggatctataaagcaatgagcgagtttgacatatttatcaactacatcgaggcctacatgacaatgaagattcggaatacaactactcctgctcctcggccccctacacctgccccaactattgcttctcagccattgagccttaggcccgaggcatgcaggcctgcggctggcggcgcggtccatacaaggggactggattttgcatgcgacatctatatttgggcacccctcgccggcacatgtggtgtcctgctgttgagcctggttatcacactctactgc;(4)SEQ ID NO.32:tccccaggacaaggtactcaaagtgaaaacagctgcacccattttcccggctggctgcccaacatgctgagag acctccgcgatgcgttcagccgcgtgaagactttcttccagatgaaagaccagctcgacaacctgctgctgaaggaatccttgctcgaagacttcaaaggttacctcggctgccaggctctgagcgagatgatccagttctatctcgaggaggtgatgccccaggcggagaatcaggaccccgacatcaaagcacacgtgatgtccctgggcgaaaacctgtttaccctcagacttaggctgcgccgatgccatcgattcctcccatgcgaaaacaaatctaaggctgttgagcaggttaagaatgctttcaacaagctccaggagaaaggcatctacaaggctatgagtgagtttgacattttcatcaactacattgaggcctacatgacgatgaagattcggaacacaactacccctgccccaaggccgcctactcccgcaccaactattgcttcacagccgctgtctctgcggcctgaggcatgcaggccagcagccgggggcgcagtgcacactagaggccttgattttgcgtgcgatatttacatctgggcacccctggccggaacatgcggggttttgctcttgagtctcgtgataaccctctactgc;(5)SEQ IDNO.33:tcccctggacagg gcacgcaatccgaaaattcttgtacacactttccaggatggttgcctaatatgctgcgagacctgagagatgctttcagcagggttaagacctttttccagatgaaagatcagctggataatttgttgctgaaggaatcactgctggaggactttaagggatatcttggctgccaggccctgtctgagatgattcaattctacctcgaggaagtgatgcctcaggctgagaaccaggatcctgacatcaaagcacatgtcaacagcctgggtgagaacctgatgacccttcggctcagactcagaaggtgtcacagattcctgccttgcgaaaacaaatcaaaagccgttgagcaggtcaagaatgcattcaataagctgcaggagaagggcatctacaaggctatgagtgagttcgacatctttatcaattacatcgaggcctacatgaccatgaagattcgcaatacgaccacacctgcgccccggccaccaacgcctgctcccaccattgccagccagcctctttcactgagaccggaggcttgtcggccagccgctgggggagcagtgcatacgaggggcctggattttgcttgcgatatttatatatgggcccctctggccggcacttgtggagtgttgctgctgtcactggtcataacactgtattgc;(6)SEQ ID NO.34:tcacctggccagggcactcaatccgaaaattcatgtactcactttcccggatggctgcccaacatg ctgcgcgatttgagagatgcattctctcgagtgaagaccttcttccagatgaaagatcagctcgataacctcctcctcaaggaaagtttgctggaagacttcaaaggttacctcggatgccaggccctgtcagagatgatccagttttatctggaggaagttatgccacaggccgaaaaccaggaccctgacataaaggcacacgtgaattcactgggcgagaacttgtacacactgcggctgcgactgagacggtgtcacaggtttcttccatgtgagaacaagagcaaagctgtggagcaggttaaaaacgccttcaataagctccaggagaaggggatttataaagccatgtcagaattcgacatcttcatcaattatatcgaagcctatatgacaatgaagatcagaaataccactacgcccgctccccgaccaccaacccctgctcctactatcgcatcccaacctctgtctctgagacctgaggcctgtcgaccagctgcggggggcgccgttcacacaagaggattggacttcgcttgcgatatttatatatgggccccgttggctggaacttgtggcgtcctgctgctgtccctggttatcactctctactgc;(7)SEQ ID NO.35:tctccaggac aaggcacacagtccgaaaactcatgcacttttttccccggctggctgcccaacatgctgcgggatttgcgggatgctttttctcgcgtgaagacattcttccagatgaaggaccagttggataatctccttttgaaagagagcctccttgaggatttcaagggctacctgggttgccaggcactgtcagaaatgatccagttctatctcgaagaggttatgccccaggcagaaaatcaggatccagacatcaaggctcatgtaaattcactcggcgagaatttgtatacgctgaggctcagactgagacgatgtcatcggttcctcccttgtgagaacaaatccaaggccgtcgagcaggttaaaaatgccttcaataagctccaggagaaaggcatctacaaggctatgtccgagttcgacatcttcattaattacatcgaggcttatatgacgatgaagattagaaatacaaccacccctgcaccgagacctccaactcccgcacccaccatcgcttcccagcctctgagtcttagacctgaggcctgtagacctgctgctggtggggccgttcatactcggggcttggactttgcttgcgacatctacatttgggcgccacttgccggcacctgcggcgtgctcctgctgtctctggttataactctctattgc;(8)SEQ ID NO.36: tccccaggacaaggtacgcaatccgagaactcctgttggcacttccctggttggctgcctaacatgct tagggatctgcgggacgccttcagccgcgtgaaaacctttttccagatgaaagatcagctggacaatctgctgctcaaggaatctctgctggaagatttcaagggatacctgggctgtcaggccctgtcagaaatgatccaattctatcttgaggaggtcatgcctcaggctgagaaccaggaccccgacatcaaggcacacgtcctgagtctgggtgaaaaccttaaaaccctgcggctcaggctgcgcagatgtcacagattcctgccctgtgagaataagtcaaaagctgtggaacaggtgaaaaatgcattcaacaaactgcaggaaaagggcatctataaagcgatgtcagagtttgatatctttatcaactacattgaggcctacatgaccatgaagattaggaacaccacgacgccggcaccaagacctccaacccccgcccctactatcgcatcacagccccttagcctgagaccggaggcttgcagaccagccgcaggaggcgctgtccatactaggggcctggattttgcatgcgacatctacatatgggctccattggccggtacttgtggtgtactgctgctttctctcgtcattaccttgtactgc。.

[0086] SEQ ID NO.8 (GMCSF signal peptide sequence):

[0087] atggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccg。

[0088] The signal peptide sequence can also be as shown in SEQ ID NOs: 9 - 13:

[0089] SEQ ID NO.9:

[0090] atgcactccagtgctctcctttgctgtttggtgctcctgacaggagtcagagcc。

[0091] SEQ ID NO.10:

[0092] atgtaccgcatgcagctgctttcatgtatcgctctgtccttggcgttggtcacaaattcc。

[0093] SEQ ID NO.11:

[0094] atgtatcggatgcagttgctgtcctgcattgcacttagtctggctctcgtcaccaacagcatctcagct。

[0095] SEQ ID NO.12:

[0096] atgggcgctgctaggagccctcctagcgcagttcctggtcctctcctgggcttgctgctgctgctgctgggggtacttgcacccggaggtgcctcc。

[0097] SEQ ID NO.13:

[0098] atgctctgttgcatgcgaaggactaagcaagtcgagaagaacgacgaagaccagaagatt。

[0099] SEQ ID NO.14 (anti-EGFRvIII scFv gene sequence):

[0100] gaaatccagctggtgcagtcaggcgccgaggtcaagaagccgggagagtcgctgagaatctcgtgcaagggctcggggttcaacatcgaggactactacattcactgggtcaggcagatgccgggaaagggactggaatggatgggccggatcgacccagaaaatgacgaaaccaaatacgggccgatttttcaaggccacgtgactatcagcgcagacacgagcatcaacactgtctacctccagtggtcctcgcttaaggccagcgataccgctatgtactactgcgcattcagaggcggggtgtactggggacaaggaaccactgtgaccgtgagcagcggaggtggcggctcgggaggaggtgggagcggaggaggaggttccggcggtggaggatcagatgtcgtgatgacccagtccccggactccctcgctgtctcactgggcgagcgcgcgaccatcaactgcaaatcgagccagtcgctgttggactccgatggaaagacttatctgaattggctgcaacagaaaccaggacaacctcccaagcggctcatctcgcttgtgtcaaaactcgattcgggagtgccagaccgcttctcggggtccgggagcggaactgactttactttgaccatttcctcactgcaagcggaggatgtggccgtgtattactgttggcagggcacgcatttccctggaaccttcggtggcggaactaaggtggaaatcaag。

[0101] SEQ ID NO.15 (anti-MSLN scFv gene sequence):

[0102] agccaggtacagctgcagcagtcaggtccaggactcgtgacgccctcgcagaccctctcactcacctgtgtcatctccggggacagtgtctctagcaacagtgctacttggaactggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtccaagtggtataacgactatgcagtatctgtgaaaagtcgaatgagcatcaacccagacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggctgtgtattactgtgcaagaggaatgatgacttactattacggtatggacgtctggggccaagggaccacggtcaccgtctcctcaggaattctaggatccggtggcggtggcagcggcggtggtggttccggaggcggcggttctcagcctgtgctgactcagtcgtcttccctctctgcatctcctggagcatcagccagtctcacctgcaccttgcgcagtggcatcaatgttggtccctacaggatatactggtaccagcagaagccagggagtcctccccagtatctcctgaactacaaatcagactcagataagcagcagggctctggagtccccagccgcttctctggatccaaagatgcttcggccaatgcaggggttttactcatctctgggctccggtctgaggatgaggctgactattactgtatgatttggcacagcagcgctgctgtgttcggaggaggcacccaactgaccgtcctctccggaattctagaacaacagggt。

[0103] SEQ ID NO.16 (anti-CD19 scFv gene sequence):

[0104] tgaggagacggtgactgaggttccttggccccagtagtccatagcatagctaccaccgtagtaataatgtttggcacagtagtaaatggctgtgtcatcagtttgcagactgttcatttttaagaaaacttggctcttggagttgtccttgatgatggtcagtctggatttgagagctgaattatagtatgtggtttcactaccccatattactcccagccactccagaccctttcgtggaggctggcgaatccagcttacaccatagtcgggtaatgagacccctgagacagtgcatgtgacggacaggctctgtgagggcgccaccaggccaggtcctgactcctgcagtttcacctcagatccgccgccacccgacccaccaccgcccgagccaccgccacctgtgatctccagcttggtcccccctccgaacgtgtacggaagcgtattaccctgttggcaaaagtaagtggcaatatcttcttgctccaggttgctaatggtgagagaataatctgttccagacccactgccactgaaccttgatgggactcctgagtgtaatcttgatgtatggtagatcaggagtttaacagttccatctggtttctgctgataccaatttaaatatttactaatgtcctgacttgccctgcaactgatggtgactctgtctcccagagaggcagacagggaggatgtagtctgtgtcatctggatgtc。

[0105] SEQ ID NO.17 (CD8 transmembrane region gene sequence):

[0106] accacgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggg gcgcagtgcacacgagggggctggacttcgcctgtgatatctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactggttatcaccctttactgc。

[0107] SEQ ID NO.18 (4-1BB costimulatory structure gene sequence):

[0108] aaacggggcagaaagaaactcctgtatatattcaaacaaccatttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttccagaag aagaagaaggaggatgtgaactg。

[0109] SEQ ID NO.19 (CD3ζ gene sequence):

[0110] agagtgaagttcagcaggagcgcagacgcccccgcgtaccaacagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgc。

[0111] SEQ ID NO.20 (Transcription termination sequence):

[0112] aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgc。

[0113] SEQ ID NO.21 (2A peptide gene sequence):

[0114] gagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggacct。

[0115] The gene sequence of peptide 2A is not limited to this, and may also be the following sequences: (1) SEQ ID NO.37: gctacgaacttctccctcctgaaacaggc cggggatgttgaggagaatcctggtcca; (2) SEQ ID NO.38: cagtgcaccaactacgctctgctgaagcttgctggagacgtggagtcaaatcctg gaccc; (3) SEQ ID NO.39: gtgaagcagaccctgaactttgacctgctgaaactcgctggggacgttgaatctaatccaggccct.

[0116] The above component sequences are arranged according to Figure 1 The sequence was linked to obtain the full-length fragment of the target gene, and the sequence was submitted to Boteng Biotechnology for gene synthesis.

[0117] The DNA fragments from the above regions were integrated into the backbone vector pLVH-EF1A-BRD3R (brand: Addgene, catalog number: #130696) as needed to construct a structure containing... Figure 1 The CAR plasmid for the gene shown is constructed using the following steps:

[0118] (1) Obtain the full-length fragment containing the desired gene.

[0119] The DNA sequence of the full-length fragment of the target gene is input into the DNA synthesizer program, and then processed by the Unique DNA synthesizer. 600) Synthesize the full-length fragment of the desired gene. After obtaining the full-length fragment of the target gene, perform PCR amplification on the target gene fragment. The target gene fragments are: antiEGFRvIII-IL-10iCAR, antiCD19-IL-10iCAR, antiMSLN-IL-10iCAR, antiEGFRvIII-IL-4iCAR, antiCD19-IL-10iCAR, antiMSLN-IL-10iCAR, antiMSLN-IL-4iCAR, antiMSLN-IL-4iCAR, antiMSLN-IL-4iCAR, antiMSLN-IL-4iCAR, antiMSLN-IL-4iCAR, antiMSLN-IL-10pCAR, antiMSLN-IL-4iCAR, and antiMSLN-nCAR.

[0120] Using the full-length target gene fragment as a template, primers were designed to amplify the DNA fragments in the above-mentioned regions by PCR. The primers used are as follows:

[0121] Forward primer (SEQ ID NO.22):

[0122] 5'-agagatccagtttatcgatgtgcccgtcagtgggcagagcgcacatcgcccacag-3'.

[0123] Reverse primer: (SEQ ID NO.23):

[0124] 5'-cttaaaggtaccaattaggaggaaaaactgtttc-3'.

[0125] PCR reaction system: 100ng of the full-length target gene fragment synthesized by the DNA synthesis instrument, 25μL of KOD One™ PCRMaster Mix, 2μL each of 10μM forward and reverse primers, and ultrapure water to make up to 50μL.

[0126] PCR reaction conditions: 98℃ for 60s, 1 cycle; 98℃ for 10s, 60℃ for 5s, 68℃ for 10s, 35 cycles; 16℃ for 60s, 1 cycle.

[0127] PCR amplification was first performed using the synthesized antiEGFRvIII-IL-10iCAR as a template. Amplification primers SEQ ID NO.22 and SEQ ID NO.23 were selected, and the PCR amplification reaction was completed under the above conditions to obtain the antiEGFRvIII-IL-10iCAR DNA fragment. After the sequencing verification was successful, the same method was continued to obtain DNA fragments of antiCD19-IL-10iCAR, antiMSLN-IL-10iCAR, antiEGFRvIII-IL-4iCAR, antiCD19-IL-4iCAR, and antiMSLN-IL-4iCAR, respectively.

[0128] (2) Enzyme digestion

[0129] The pLVH-EF1A-BRD3R vector (Brand: Addgene, Catalog No.: #130696) was treated with Thermo's FastDigest Bsu15I (catalog number: FD0144) and FastDigest KpnI (catalog number: FD0524). The enzyme digestion system was as follows: 2 μg pLVH-EF1A-BRD3R vector, 1 μL FD Bsu15I, 1 μL FD KpnI, 2 μL 10×FD Buffer, and ddH2O to a final volume of 20 μL.

[0130] After 2 hours of enzyme digestion, 20 μL of the vector digestion product was subjected to agarose gel electrophoresis. A fragment of approximately 10,000 bp was extracted and recovered using Magen's HiPure Gel DNA Micro Kit (catalog number: D2110).

[0131] (3) Homologous recombination

[0132] Homologous recombination reaction was performed using the ClonExpress Homologous Recombination Kit (catalog number: C112-01 / 02) from Vazyme Biotech. The reaction system consisted of: 200 ng of linearized vector, 80 ng of PCR product obtained in step (1), 10 μL of 2×ExnaseBuffer, 2 μL of Exnase, and ddH2O to bring the total to 20 μL.

[0133] After incubating at 37°C for 30 min, the cells were quickly placed on ice for 5 min. Then, 20 μL of Trans1-T1 competent cells were added and allowed to stand for 30 min. After heat shock at 42°C for 90 s, the cells were coated onto a plate.

[0134] After 16 hours, a single colony was picked from the plate and incubated in 25 mL of LB medium at 37°C in a shaker for 16 hours. The plasmid was then extracted using a plasmid extraction kit (supplier: Magen, catalog number: P1156), and DNA sequencing was used to verify successful plasmid construction. The plasmid with correct sequencing was selected as the plasmid expressing the anti-EGFRvIII-IL-10iCAR gene. Similarly, plasmids expressing antiCD19-IL-10iCAR, antiMSLN-IL-10iCAR, antiEGFRvIII-IL-4iCAR, antiCD19-IL-4iCAR, antiMSLN-IL-4iCAR, antiMSLN-IL-10pCAR, antiMSLN-IL-4iCAR, and antiMSLN nCAR could be constructed.

[0135] Example 2: Construction of in vivo delivery lentiviral capsid plasmid

[0136] The following sequences were obtained from the NCBI database: the scFv amino acid sequence of the anti-CD3 antibody, which was converted into a nucleic acid sequence after codon optimization (nucleic acid sequence as shown in SEQ ID NO.24); the extracellular amino acid sequence of CD44, which was converted into a nucleic acid sequence after codon optimization (nucleic acid sequence as shown in SEQ ID NO.25); and the extracellular amino acid sequence of PH20, which was converted into a nucleic acid sequence after codon optimization (nucleic acid sequence as shown in SEQ ID NO.26).

[0137] SEQ ID NO.24 (scFv gene sequence of anti-CD3 antibody)

[0138]

[0139] SEQ ID NO.25 (CD44 extracellular segment gene sequence)

[0140]

[0141] SEQ ID NO.26 (PH20 extracellular gene sequence)

[0142]

[0143] The above component sequences are arranged according to Figure 2 The sequence was sequentially ligated to obtain the full-length recombinant lentiviral capsid gene, and the sequence was submitted to Boteng Biotechnology for gene synthesis. The synthesized gene fragment was integrated into plasmid pMD2.G (brand: Addgene, catalog number: #12259) to construct the lentiviral capsid plasmid. The specific construction steps are as follows:

[0144] (1) Obtain the full-length fragment of the recombinant lentiviral capsid gene.

[0145] The DNA sequences of SEQ ID NO.24-SEQ ID NO.26 above were arranged according to... Figure 2 The sequence of elements is connected and input into the DNA synthesizer program, and then processed by the DNA automated synthesizer (Unique). 600) Synthesize the full-length fragment of the recombinant lentiviral capsid gene. After obtaining the full-length fragment of the recombinant lentiviral capsid gene, perform PCR amplification on the target gene fragment.

[0146] Using the full-length target gene fragment as a template, primers were designed to amplify the DNA fragments in the above-mentioned regions by PCR. The primers used are as follows:

[0147] Forward primer: (SEQ ID NO.27): 5'-catcactttggcaaagcacatgggatggagctgtatcatc-3'.

[0148] Reverse primer: (SEQ ID NO.28): 5'-ggctaagtacaaaaggcacttcataggtccaggattctcctcg-3'.

[0149] PCR reaction system: 100ng of the full-length target gene fragment synthesized by the DNA synthesis instrument, 25μL of KOD One™ PCRMaster Mix, 2μL each of 10μM forward and reverse primers, and ultrapure water to make up to 50μL.

[0150] PCR reaction conditions: 98℃ for 60s, 1 cycle; 98℃ for 10s, 60℃ for 5s, 68℃ for 10s, 35 cycles; 16℃ for 60s, 1 cycle.

[0151] PCR amplification was performed using the full-length recombinant lentiviral capsid gene synthesized as a template. Primers SEQ ID NO.27 and SEQ ID NO.28 were selected, and the PCR amplification reaction was completed under the conditions described above to obtain the recombinant lentiviral capsid gene DNA fragment.

[0152] (2) Enzyme digestion

[0153] The pMD2.G plasmid (brand: Addgene, catalog number: #12259) was treated with Thermo's FastDigest Eco72 I (catalog number: FD0364). The digestion system was as follows: 2 μg pMD2.G vector, 1 μL FD Eco72 I, 2 μL 10×FD Buffer, and ddH2O to bring the total volume to 20 μL.

[0154] After 2 hours of enzyme digestion, 20 μL of the vector digestion product was subjected to agarose gel electrophoresis. A fragment of approximately 6000 bp was extracted and recovered using Magen's HiPure Gel DNA Micro Kit (catalog number: D2110).

[0155] (3) Homologous recombination

[0156] Homologous recombination reaction was performed using the ClonExpress Homologous Recombination Kit (catalog number: C112-01 / 02) from Vazyme Biotech. The reaction system consisted of: 200 ng of linearized vector, 80 ng of PCR product obtained in step (1), 10 μL of 2×ExnaseBuffer, 2 μL of Exnase, and ddH2O to bring the total volume to 20 μL.

[0157] After incubating at 37°C for 30 min, the cells were quickly placed on ice for 5 min, followed by the addition of 20 μL of Trans1-T1 competent cells. After standing for 30 min, the cells were heat-shocked at 42°C for 90 s and then plated.

[0158] After 16 hours, a single colony was picked from the plate and incubated in 25 mL of LB medium at 37°C in a shaker for 16 hours. The plasmid was then extracted using a plasmid extraction kit (supplier: Magen, catalog number: P1156), and DNA sequencing was used to verify successful plasmid construction. The plasmid with correct sequencing results was selected as the lentiviral capsid plasmid.

[0159] Example 3: Preparation of lentiviruses delivering CAR genes for activation-inducible IL-4 or IL-10 and detection of T-cell infection efficiency.

[0160] 1. Lentiviral preparation

[0161] Prepare a 10cm culture dish and inoculate 5×10⁶ cells / year. 6293T cells were cultured overnight at 37°C in a 5% CO2 incubator. Complete culture medium (DMEM containing 4500 mg / L glucose, 10% FBS, 1% ampicillin, and 1% streptomycin) was added. 100 μM PEI and lentiviral packaging plasmids were removed from the freezer, thawed at room temperature, and thoroughly mixed by pipetting. PBS buffer was then removed and warmed to room temperature. Add 2 mL of PBS to one well of a 6-well plate. Add the packaging plasmid, the helper plasmid containing anti-CD3 antibody scFv, CD44, and PH20 (see Example 2), and the CAR expression plasmid containing activation-inducible IL-4 or IL-10 against CD19 (see Example 1). Mix thoroughly by pipetting. Add 18 μL of 100 μM polyetherimide (PEI) and immediately mix by pipetting. Let stand at room temperature for 10 minutes. Add the DNA / PEI complex dropwise to a 15 cm culture dish, gently shaking to mix thoroughly. Incubate the dish at 37°C with 5% CO2 for 6–8 hours. Remove the culture medium containing the transfection reagent and replace with fresh complete culture medium. After 48–72 hours of continuous incubation, collect the virus-containing supernatant from the culture dish, filter through a 0.45 μm filter, transfer to a centrifuge tube, balance, and centrifuge at 20,000 g, 4°C for 2 hours. After centrifugation, carefully aspirate the liquid from the centrifuge tube in a biosafety cabinet, add 500 μL of PBS buffer to resuspend the precipitate, take 50 μL of lentivirus to infect T cells and detect the lentivirus titer, aliquot the remaining virus and store it at -80°C.

[0162] 2. T-cell infection efficiency detection

[0163] Take 5×10 6 T cells activated for 24 hours were resuspended in 5 mL of T cell culture medium (formulation: X-VIVO15 + 10% inactivated plasma + 1% penicillin / streptomycin + 5 ng / mL IL-7 + 5 ng / mL IL-15). The cell suspension was added to 6-well plates, and 50 μL of lentivirus was added and mixed thoroughly. The plates were placed in an incubator, and the CAR positivity rate was measured after 72 hours.

[0164] Flow cytometry was used to detect CAR molecules expressed by T cells. Anti-G4S tags specifically recognize the GGGGSGGGGSGGGGS tag on the scFv of CAR molecules to detect the CAR-T cell positivity rate. The detection steps are as follows: Take 5 × 10⁻⁶ saturated CAR cells... 5The cell suspension was transferred to 1.5 mL centrifuge tubes. After centrifugation at 500 g for 3 min, the supernatant was discarded, and the cells were resuspended in 1 mL of PBS. After centrifugation at 500 g for 3 min at 4 °C, the supernatant was discarded. 0.5 μL of anti-G4S-tagged antibody (ACRO Biosystems, clone number 016) was added to 50 μL of PBS, and the cells were incubated at 4 °C for 30 min. After centrifugation at 500 g for 3 min at 4 °C, the supernatant was discarded. Each tube was resuspended in 500 μL of PBS, and the cells were analyzed by flow cytometry.

[0165] The results are as follows Figure 3 As shown, after 72 hours, the positive rate of activated inducible IL-4 CAR-T cells was 32.7%, and the positive rate of activated inducible IL-10 CAR-T cells was 45.0%, indicating that CAR-T cell preparation was successful.

[0166] Example 4: Functional verification of CAR-T cells expressing activation-inducible IL-4 or IL-10

[0167] 1. ELISA detection of cytokines

[0168] The following CAR-T cells were prepared according to the method in Example 3: CAR-T cells expressing activation-inducible IL-4 or IL-10 (antiMSLN-IL-4iCAR-T or antiMSLN-IL-10iCAR-T), CAR-T cells continuously expressing IL-4 or IL-10 (antiMSLN-IL-4pCAR-T or antiMSLN-IL-10pCAR-T), and CAR-T cells without exogenous IL-4 and IL-10 genes (antiMSLN nCAR-T).

[0169] Prepare a suspension of target cells (OVCAR3 cells) with a density of 1×10⁻⁶. 6 CAR-T cell suspension was added to each well at a ratio of 1:1 to target cells / mL. CAR-T cell suspension targeting MSLN was added at a ratio of 1:1. Each experimental group had 3 replicates, with 100 μL of CAR-T cell suspension added to each well. After incubating CAR-T cells and target cells for 24 hours, the supernatant was collected, and the secretion levels of IL-4 and IL-10 were detected.

[0170] Experimental results are as follows Figure 4As shown, after co-culturing with target cells (+OVCAR3), CAR-T cells expressing activation-inducible IL-4 or IL-10 (antiMSLN-IL-4iCAR-T or antiMSLN-IL-10iCAR-T) and CAR-T cells continuously expressing IL-4 or IL-10 (antiMSLN-IL-4pCAR-T or antiMSLN-IL-10pCAR-T) produced large amounts of IL-4 or IL-10. However, CAR-T cells without exogenous IL-4 and IL-10 genes (antiMSLN nCAR-T) and CAR-T cells not co-cultured with target cells (-OVCAR3) secreted small amounts of IL-4 and IL-10, indicating that CAR-T cells with activation-inducible IL-4 or IL-10 have the function of secreting IL-4 or IL-10 after activation.

[0171] 2. Cell counting

[0172] Cryopreserved untransduced CAR gene T cells (MOCK-T), CAR-T cells without exogenous IL-4 and IL-10 genes (antiMSLN nCAR-T), CAR-T cells continuously expressing IL-4 or IL-10 (antiMSLN-IL4 pCAR-T or antiMSLN-IL10 pCAR-T), and CAR-T cells expressing activation-inducible IL-4 or IL-10 (antiMSLN-IL4 iCAR-T or antiMSLN-IL10 iCAR-T) were thawed and cultured in vitro, with an initial cell number of 1×10⁻⁶ cells. 6 Cells were cultured continuously for 12 days. Cell counts were performed every 2 days, and the cells were passaged according to their proliferation.

[0173] The results are as follows Figure 5 As shown, in the absence of tumor antigen stimulation, the number of antiMSLN iCAR-T cells expanded in vitro was comparable to that of MOCK-T and antiMSLN nCAR-T cells and higher than that of antiMSLN pCAR-T cells, demonstrating that the proliferation rate of antiMSLN iCAR-T cells in the unactivated state was superior to that of antiMSLN pCAR-T cells.

[0174] Example 5: In vivo delivery of lentivirus and detection of antiMSLN iCAR-T transduction efficiency

[0175] Human T cells activated 24 hours prior were resuspended in PBS at a density of 1×10⁻⁶. 7T cell suspension was injected into the tail vein of immunodeficient mice at a rate of 1 cell / mL. 200 μL of T cell suspension was injected into the tail vein of the mice. 24 hours after T cell injection, 50 μL of lentivirus containing the CAR gene targeting MSLN was injected into the tail vein of the mice. 14 days later, orbital venous blood was collected from the mice. 500 μL of erythrocyte lysis buffer was added to 50 μL of the blood sample for erythrocyte lysis. After 5 minutes, the sample was centrifuged at room temperature (300 rcf, 5 minutes), the supernatant was discarded, and the cells were resuspended in 50 μL of PBS. Add 1 μL of anti-G4S-tagged antibody (ACROBiosystems, clone 016), 1 μL of human CD3 antibody (Biolegend, clone UCTH1), and 1 μL of mouse CD45 antibody (Biolegend, clone 30-F11) to each sample. After incubation at 4°C for 30 minutes, add 500 μL of PBS and centrifuge at room temperature (300 rcf, 5 minutes). Discard the supernatant and resuspend the sample in 200 μL of PBS. Then, use flow cytometry to detect the proportion of antiMSLN iCAR-T cells in mouse peripheral blood.

[0176] like Figure 6 As shown, antiMSLN iCAR-T cells could be detected in the peripheral blood of mice on day 14 after lentivirus infusion, proving that the lentiviral vector was successfully delivered to generate CAR-T cells in vivo.

[0177] Example 6: Synthesis of Nanoliposomes Containing the CAR Gene

[0178] 0.4 mg of anti-human CD3 antibody (Biolegend, 317302), 0.44 mg of human CD44 protein (SinoBiological, catalog number: 12211-HNAH), and 1.32 mg of PH20 protein (Acro BIOSYSTEMS, PH0-H5225) were dissolved in 1 mL of NaHCO3 solution (pH = 7.8). 2 mol of DSPE-PEG2000-NHS (dispalmitoylphosphatidylethanolamine-polyethylene glycol-succinimide ester) was dissolved in DMSO. DSPE-PEG2000-NHS was slowly added dropwise to the CD3 / CD44 / PH20 mixed solution and stirred for 4 hours. After the reaction was complete, the solution was dialyzed against ultrapure water for 1 day (cutoff molecular weight 3.5 kDa) and then freeze-dried to obtain anti-CD3 antibody and human CD44 / PH20 modified nanoliposomes.

[0179] The following ingredients were accurately weighed using an analytical balance: DlinMC3 (4-(N,N-dimethylamino)butyrate (dilinoleyl)methyl ester), DOPE (dioleoylphosphatidylethanolamine), Chol (cholesterol), PEG-DMG (dimyristicoglycerol-polyethylene glycol 2000), DOTAP ((2,3-dioleoyl-propyl)-trimethylammonium chloride; (2,3-dioleoyl-propyl)-trimethylammonium chloride), and DSPE-MTAS-NLS (distearate-phosphatidylethanolamine-microtubule-associated-nuclear-targeting peptide) (molar ratio 6:3:10:1:6:1). All of these materials were dissolved in 2 mL of chloroform as a lipid oil phase solution. The chloroform was gradually removed using a rotary evaporator to obtain a uniform membrane. A 25 mM sodium acetate solution (pH 4) was prepared as the aqueous solvent to dissolve the plasmid containing the EGFRvIII-targeting CAR gene, with a plasmid-to-phospholipid ratio of 1:10. The prepared aqueous solution was added to a lipid membrane (after removing chloroform) and hydrated for 90 minutes. The liposomes were then extruded sequentially through 400 nm and 200 nm nuclear pore membranes using a microextruder to obtain a liposome suspension. The liposome suspension was transferred to an ultrafiltration centrifuge tube (Mw = 10000), and 4 volumes of PBS solution were added. The tube was centrifuged for 1 hour, and the liposome suspension was replaced with PBS. Subsequently, anti-CD3 antibody / CD44 / PH20 modified nanoliposomes (molar ratio to plasmid 1:5) were added to the above solution and incubated overnight at 4°C. The suspension was collected to obtain nanoliposomes containing the EGFRvIII-targeting CAR gene and stored at 4°C. 1 × 10⁻⁶ ppm of the solution was added to each well of a 6-well plate. 6 Activated T cells were collected and resuspended in 1 mL of T cell culture medium. 100 μL of PBS (PBS group) and nanoliposomes containing the CAR gene targeting EGFRvIII (mLNP group) were added to 6-well plates, respectively. The CAR-T cell ratio was detected by flow cytometry after 72 hours, using the same method as in Example 3.

[0180] The results are as follows Figure 7 As shown, the efficiency of transfecting T cells with nanoliposomes containing the CAR gene was 25.5%, indicating that nanoliposomes containing the CAR gene could be successfully delivered to T cells.

[0181] Additionally, it should be noted that the anti-human CD3 antibody used in this embodiment is a humanized anti-human CD3 antibody with clone number OKT3, but it is not limited to this; other clone numbers or species-derived anti-human CD3 antibodies can be used. Furthermore, the anti-human CD3 antibody in this embodiment can also be replaced by other antibodies, such as anti-human CD4, CD8, or PD-1 antibodies. The human CD44 used in this embodiment is the CD44S subtype, but it is not limited to this; other CD44 subtypes can also be used. The PH20 used in this embodiment is human hyaluronidase, but it is not limited to this; other hyaluronidases from human or non-human sources and their mutants can also be used.

[0182] Example 7: In vivo delivery of nanoliposomes

[0183] NSG mice inoculated with U87 solid tumors were randomly divided into two groups of three. Each mouse was injected with 1×10⁻⁶ mcg of urealyticum. 6 Personal T cells were injected with nanoliposomes on the same day as the T cell injection. 200 μL of unmodified nanoliposomes containing a CAR gene expressing activation-inducible IL-10 (LNP, mice 1-3) and nanoliposomes modified with anti-CD3 antibody / CD44 / PH20 containing a CAR gene expressing IL-10 (mLNP, mice 4-6) were injected via tail vein. On day 14 after liposome injection, mice were dissected, tumor tissue was removed, weighed, and digested. The proportion of CAR-T cells in the tumor tissue was then detected by flow cytometry, using the same method as in Example 5, and the number of CAR-T cells per gram of tumor was calculated based on the tumor weight.

[0184] like Figure 8 and Figure 9 As shown, liposomes modified with anti-CD3 antibody, CD44 and PH20 can more efficiently transduce tumor-infiltrating T cells into CAR-T cells.

[0185] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An expression of an activation-inducible IL-4 or IL-10 CAR nucleic acid segment, characterized by, The CAR nucleic acid fragment comprises the following three parts: (1) Activation of the inducible promoter; (2) Either IL-4 or IL-10; (3) CAR gene; The activation-inducible promoter comprises 3-6 NFAT binding motifs and an interleukin-2 core promoter sequence, and the nucleotide sequence is any one of the sequences shown in SEQ ID NO. 1-4; the nucleotide sequence of IL-4 is shown in SEQ ID NO. 6, and the nucleotide sequence of IL-10 is any one of the sequences shown in SEQ ID NO. 7 or SEQ ID NO. 29-36. The CAR gene includes the scFv gene sequence, transmembrane region, co-stimulatory structure, and intracellular signal transduction structure.

2. The CAR nucleic acid fragment as described in claim 1, characterized in that, The scFv gene sequences include scFv gene sequences targeting EGFRvIII, scFv gene sequences targeting MSLN, and scFv gene sequences targeting CD19. The transmembrane region includes any one or a combination of at least two of the following: the α chain of the T cell receptor, the β chain of the T cell receptor, CD3ζ, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or the GITR transmembrane region. The co-stimulatory structures include any one or a combination of at least two of 4-1BB, CD28, CD137, OX-40, or ICOS; The intracellular signal transduction structures include any one or a combination of at least two of CD3ζ, BCR, NKp30, NKp44, NKp46, FcαR, FcRγ, CD16, or CD32.

3. The CAR nucleic acid fragment as described in claim 2, characterized in that, The scFv gene sequence targeting EGFRvIII has the nucleotide sequence shown in SEQ ID NO.14; the scFv gene sequence targeting MSLN has the nucleotide sequence shown in SEQ ID NO.15; and the scFv gene sequence targeting CD19 has the nucleotide sequence shown in SEQ ID NO.

16. The transmembrane region is the CD8 transmembrane region, and its nucleotide sequence is shown in SEQ ID NO.17; The co-stimulatory structure is 4-1BB, and its nucleotide sequence is shown in SEQ ID NO.18; The intracellular signal transduction structure is CD3ζ, and its nucleotide sequence is shown in SEQ ID NO.

19.

4. The CAR nucleic acid fragment as described in claim 1, characterized in that, The CAR nucleic acid fragment also includes an EF-1α promoter and a transcription termination sequence, the nucleotide sequence of which is shown in SEQ ID NO.5 and the nucleotide sequence of which is shown in SEQ ID NO.20; The CAR nucleic acid fragment also includes a signal peptide, the nucleotide sequence of which is any one of the sequences shown in SEQ ID NO. 8-13; The CAR gene and IL-4 or IL-10 may be linked by a nucleotide sequence encoding a 2A peptide, as shown in any one of SEQ ID NO.21 or SEQ ID NO.37-39.

5. A vector comprising the nucleic acid fragment of claim 1, characterized in that, The vectors include retroviral vectors, adeno-associated virus vectors, lentiviral vectors, adenovirus vectors, or liposomes.

6. An in vivo delivery type lentiviral capsid plasmid, characterized in that, The scFv sequence, CD44 extracellular segment, and PH20 extracellular segment of the anti-CD3 antibody were cloned into a plasmid, wherein the nucleotide sequences of the scFv sequence, CD44 extracellular segment, and PH20 extracellular segment of the anti-CD3 antibody are shown in SEQ ID NO.24, SEQ ID NO.25, and SEQ ID NO.26, respectively.

7. A CAR-T cell or a nanoliposome containing a CAR gene, characterized in that, The nanoliposomes are modified with hyaluronidase PH20, CD44, and anti-CD3 antibody, and the nanoliposomes encapsulate the CAR nucleic acid fragment as described in any one of claims 1-4.

8. A method for preparing nanoliposomes containing CAR nucleic acid fragments, characterized in that, Includes the following steps: Dipalmitoylphosphatidylethanolamine-polyethylene glycol-succinimide ester was dissolved and then added dropwise to hyaluronidase PH20, CD44, and anti-CD3 antibody. The mixture was stirred and reacted, and then dialyzed and freeze-dried to obtain nanoliposomes I modified with hyaluronidase PH20, CD44, and anti-CD3 antibody. 4-(N,N-dimethylamino)butyrate (dilinoleyl) methyl ester, dioleoylphosphatidylethanolamine, cholesterol, dimyristoylglycerol-polyethylene glycol 2000, (2,3-dioleoyl-propyl)-trimethylammonium chloride, (2,3-dioleoyl-propyl)-trimethylammonium chloride, and distearate-phosphatidylethanolamine-microtubule-associated-nucleus-localized peptide were dissolved in an organic solvent to form a lipid oil phase solution. The CAR nucleic acid fragment according to any one of claims 1-5 was dissolved to form an aqueous phase solution. The aqueous phase solution and the lipid oil phase solution were mixed and hydrated, and then extruded using an extruder to obtain a liposome suspension. The liposome suspension was ultrafiltered and then mixed with nanoliposome I overnight to obtain nanoliposomes containing CAR nucleic acid fragments.

9. The preparation method according to claim 8, characterized in that, The ratio of dipalmitoylphosphatidylethanolamine-polyethylene glycol-succinimide ester, hyaluronidase PH20, CD44 and anti-CD3 antibody is (1-3) mol: (1-2) mg: (0.1-0.5) mg: (0.1-0.5) mg; the stirring reaction conditions are: stirring reaction at room temperature for 3-5 hours; The molar ratio of 4-(N,N-dimethylamino)butyrate (dilinoleyl) methyl ester, dioleoylphosphatidylethanolamine, cholesterol, dimyristoylglycerol-polyethylene glycol 2000, (2,3-dioleoyl-propyl)-trimethylammonium chloride, (2,3-dioleoyl-propyl)-trimethylammonium chloride and distearate-phosphatidylethanolamine-microtubule-associated-nuclear-localized peptide is 6:3:10:1:6:1; The total amount of 4-(N,N-dimethylamino)butyrate (dilinoleyl) methyl ester, dioleoylphosphatidylethanolamine, cholesterol, dimyristoylglycerol-polyethylene glycol 2000, (2,3-dioleoyl-propyl)-trimethylammonium chloride, (2,3-dioleoyl-propyl)-trimethylammonium chloride, and distearate-phosphatidylethanolamine-microtubule-associated-nuclear-localization peptide is in a mass ratio of (8-10):1 to the CAR nucleic acid fragment. The molar ratio of the nanoliposome I to the CAR nucleic acid fragment is 1:(3-5).

10. The use of the CAR nucleic acid fragment as described in any one of claims 1-4, the vector as described in claim 5, the lentiviral capsid plasmid as described in claim 6, the CAR-T cell as described in claim 7, or nanoliposomes containing the CAR gene, in any one of the following: (1) Application in the preparation of drugs that activate and induce the secretion of IL-4 or IL-10 in vivo; (2) Use in the preparation of antitumor drugs, wherein the tumors include hematologic malignancies, gliomas, mesotheliomas, pancreatic cancers and ovarian cancers.

Citation Information

Patent Citations

  • Extended soluble PH20 polypeptides and uses thereof

    CN102307993A