A method and engineered strain for synthesizing multiple types of retinyl esters using Yersinia lipolyticis

By overexpressing specific genes and optimizing metabolic pathways in Yersinia lipolytica, engineered strains were constructed, solving the problems of low efficiency and safety in the synthesis of multiple types of retinyl esters. This enabled the efficient synthesis of multiple types of retinyl esters, which are suitable for the cosmetics and food industries.

CN122303288APending Publication Date: 2026-06-30EAST CHINA UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
EAST CHINA UNIV OF SCI & TECH
Filing Date
2026-04-14
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In the existing technology, there are shortcomings in the research on the synthesis of retinyl esters by Yeast lipolyticis. The efficient and targeted synthesis of multiple types of retinyl esters has not been achieved. Furthermore, the overexpression of exogenous dehydrogenases in yeast can easily generate retinoic acid, which poses a safety risk.

Method used

By overexpressing the ybbO, LRAT, and PaGGPPS genes in Yersinia lipolytica and combining CRISPR/Cas9 gene editing technology, the LRAT gene was integrated into the F1-3 site, and the mevalonate (MVA) metabolic pathway was optimized. An engineered strain was constructed to achieve the esterification reaction of retinol with fatty acids of different chain lengths, and to efficiently synthesize multiple types of retinyl esters such as linoleic acid retinyl ester, oleic acid retinyl ester, and palmitic acid retinyl ester.

Benefits of technology

It significantly improves the total yield and stability of retinyl esters, and the product safety is superior to retinol. It is suitable for industrial production in the cosmetics and food industries and has antioxidant and anti-aging activities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303288A_ABST
    Figure CN122303288A_ABST
Patent Text Reader

Abstract

This invention discloses a method and engineered strain for synthesizing multiple types of retinyl esters using *Yarrowia lipolytica*, relating to the field of biotechnology. The method for constructing the engineered strain includes the steps of introducing key genes into a *Yarrowia lipolytica* starter strain, overexpressing the key genes, and obtaining the engineered strain. The key genes include the ybbO gene, the LRAT gene, and the PaGGPPS gene. The nucleotide sequence of the ybbO gene is shown in SEQ ID NO.1; the nucleotide sequence of the LRAT gene is shown in SEQ ID NO.2; and the nucleotide sequence of the PaGGPPS gene is shown in SEQ ID NO.3. The engineered strain constructed by this invention can utilize multiple carbon sources to achieve de novo synthesis of retinyl esters. The product exhibits superior stability and safety compared to retinol, and comparable antioxidant and anti-aging activities, making it suitable for industrial production in cosmetics, food, and other fields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method and engineered strain for synthesizing various types of retinyl esters using Yersinia lipolyticis. Background Technology

[0002] Retinoids (including vitamin A and its derivatives) are important raw materials in the food, feed, cosmetics, and pharmaceutical industries, possessing functions such as regulating vision, immunity, cell growth and differentiation, as well as antioxidant and anti-aging properties. Currently, retinoids are mainly produced through chemical synthesis, which has drawbacks such as high energy consumption, generation of chemical waste, and the need for additional purification steps. Developing green and sustainable biosynthetic methods has become a research hotspot.

[0003] Retinol is an important member of the retinol family, but it has poor chemical stability. Retinic acid has strong physiological activity, but its use in cosmetics is strictly limited due to safety concerns. Retinyl esters (such as retinyl linoleate, retinyl oleate, and retinyl palmitate) have antioxidant and anti-aging activities comparable to retinol, and their stability and safety are significantly improved, making them ideal alternative raw materials in the cosmetics and food industries.

[0004] Research on microbial synthesis of retinoids has largely focused on *Escherichia coli* and *Saccharomyces cerevisiae*. *Yersinia lipolytica*, as a GRAS (Generally Recognized As Safe) oil-producing yeast, possesses a rich cytoplasmic acetyl-CoA library, a natural MVA pathway, and broad-spectrum substrate adaptability, making it an excellent chassis strain for retinoid synthesis. However, current research on the synthesis of retinyl esters using *Yersinia lipolytica* remains insufficient. Furthermore, the characteristic of exogenous dehydrogenases readily generating retinoic acid when overexpressed in this yeast has not been discovered, and efficient, targeted synthesis of multiple types of retinyl esters has not yet been achieved. Summary of the Invention

[0005] The purpose of this invention is to provide a method and engineered strain for synthesizing various types of retinyl esters using *Yarrowia lipolytica*, thereby solving the problems existing in the prior art. The engineered strain provided by this invention can efficiently synthesize various types of retinyl esters, including linoleic acid retinyl ester, oleic acid retinyl ester, and palmitic acid retinyl ester.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a method for constructing an engineered bacterium for synthesizing retinyl esters, comprising the step of introducing a key gene into a Yersinia lipophila starting strain to overexpress it, thereby obtaining the engineered bacterium; The key genes include the ybbO gene, the LRAT gene, and the PaGGPPS gene. The nucleotide sequence of the ybbO gene is shown in SEQ ID NO.1; The nucleotide sequence of the LRAT gene is shown in SEQ ID NO.2; The nucleotide sequence of the PaGGPPS gene is shown in SEQ ID NO.3.

[0007] Furthermore, the key genes also include the MBP-ERG12 fusion gene and the HMG1 gene; The nucleotide sequence of the MBP-ERG12 fusion gene is shown in SEQ ID NO.4; The nucleotide sequence of the HMG1 gene is shown in SEQ ID NO.5.

[0008] Furthermore, the starting strain of the *Yersinia lipolytica* is *Yersinia lipolytica* XK17.

[0009] Furthermore, the ybbO gene and the PaGGPPS gene were overexpressed using recombinant plasmids; The LRAT gene was integrated into the F1-3 site of the Yersinia lipophila starting strain using the CRISPR / Cas9 gene editing method.

[0010] Furthermore, the MBP-ERG12 fusion gene and the HMG1 gene were overexpressed using recombinant plasmids.

[0011] The present invention also provides an engineered bacterium constructed according to the above-described construction method.

[0012] The present invention also provides the application of the above-mentioned engineered bacteria in the synthesis of retinyl esters, wherein the retinyl esters include at least one of linoleic retinyl ester, palmitic retinyl ester and oleic retinyl ester.

[0013] The present invention also provides a method for synthesizing retinyl esters using Yersinia lipolytica, wherein Yersinia lipolytica is the engineered strain described above; The method includes the step of fermenting and culturing the engineered bacteria to obtain the retinyl ester; The retinyl esters include at least one of linoleic retinyl ester, palmitic retinyl ester, and oleic retinyl ester.

[0014] Furthermore, the carbon source of the fermentation medium used in the fermentation culture is glucose or lignocellulose hydrolysate.

[0015] Furthermore, the fermentation medium used in the fermentation culture contains dodecane and butylated hydroxytoluene.

[0016] The present invention discloses the following technical effects: This invention is the first to discover that exogenous alcohol dehydrogenase, when overexpressed in *Yarrowia lipolytica*, possesses dual catalytic activity for both dehydrogenation and dehydration, readily catalyzing the production of retinoic acid. By overexpressing the lecithin-retinyl acyltransferase (LRAT) gene in this yeast, esterification reactions of retinol with fatty acids of different chain lengths can be achieved, efficiently synthesizing various types of retinyl esters, including retinyl linoleate, retinyl oleate, and retinyl palmitate. Simultaneously, the mevalonate (MVA) metabolic pathway is optimized and fermentation conditions are controlled, significantly increasing the total yield of retinyl esters. The engineered strain constructed in this invention can utilize glucose or non-grain lignocellulose hydrolysate as a carbon source to achieve de novo synthesis of retinyl esters. The product exhibits superior stability and safety compared to retinol, with comparable antioxidant and anti-aging activities, making it suitable for industrial production in cosmetics, food, and other fields. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Diagram of the biosynthetic pathway of retinyl esters in Yersinia lipophila; Figure 2 A comparison of retinyl ester yields from shake-flask fermentation using different engineered strains; Figure 3 A schematic diagram (A) and a fed-batch fermentation curve (B) of the fermentation process of engineered strain WL21 in a 5L bioreactor. Figure 4 A comparison of retinyl ester production by engineered strains using glucose and lignocellulose hydrolysate as carbon sources; Figure 5 A comparison of the antioxidant activities of synthetic retinyl esters and chemically synthesized retinol; Figure 6 The HPLC identification chromatogram for retinyl esters; Figure 7 This is the LC-MS identification spectrum of retinyl esters. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] This invention develops an engineered strain of *Yersinia lipolytica* for the synthesis of various types of retinyl esters. It is constructed from a β-carotene-producing *Yersinia lipolytica* strain through the following genetic engineering modifications: Overexpression of exogenous ybbO gene: The codon-optimized E. coli ybbO gene was integrated into the yeast chromosome; the alcohol dehydrogenase encoded by this gene has dual catalytic activity of dehydrogenation and dehydration in Yersinia lipolytica, which can catalyze the production of retinaldehyde to retinol, and at the same time, it is very easy to further catalyze the production of retinoic acid.

[0025] Overexpression of the LRAT gene: The LRAT gene was integrated into the F1-3 site of yeast using CRISPR / Cas9 technology to achieve stable overexpression; LRAT can catalyze the esterification reaction of retinol with different chain length fatty acids (linoleic acid, oleic acid, palmitic acid) in yeast cells to efficiently synthesize linoleic acid retinyl ester, oleic acid retinyl ester, and palmitic acid retinyl ester, while eliminating the safety risks of retinoic acid.

[0026] Optimize the MVA metabolic pathway: Overexpress the PaGGPPS gene derived from Pseudomonas alpina to increase the supply of gerany-gerany-pyrophosphate (GGPP); integrate the ERG12 gene with the MBP tag and an additional copy of the HMG1 gene to enhance the metabolic flux of the MVA pathway and further improve the efficiency of retinyl ester precursor synthesis.

[0027] Example 1 Construction of engineered strains of Yersinia lipophila This embodiment constructs an engineered strain of *Yersinia lipophila*, wherein the biosynthetic pathway diagram of retinyl esters is shown in [reference needed]. Figure 1 The key genes overexpressed or engineered in this invention are marked in red. The MVA pathway provides terpenoid precursors for retinyl ester synthesis. LRAT is a key enzyme that catalyzes the esterification of retinol with fatty acids of different chain lengths to produce retinyl esters. The alcohol dehydrogenase encoded by the exogenous ybbO gene mediates the conversion of retinaldehyde to retinol and retinoic acid.

[0028] 1. Experimental Materials Starting strain: Yersinia lipolyticis XK17, which produces β-carotene, has been disclosed in patent document with patent publication number CN111321087A and invention title "A genetically engineered Yersinia lipolyticis strain producing β-carotene and its application".

[0029] Gene synthesis and codon optimization: The *E. coli* ybbO gene (SEQ ID NO.1), LRAT gene (SEQ ID NO.2), and *Pseudomonas amygdalinus* PaGGPPS gene (SEQ ID NO.3) with codon optimization were synthesized by GenScript Biotech. The nucleotide sequence of the MBP-ERG12 fusion gene is shown in SEQ ID NO.4; the nucleotide sequence of the HMG1 gene is shown in SEQ ID NO.5.

[0030] Vectors: The pUC19-rDNA-HisG vector has been disclosed in invention patent application number 202011361363.X; pHR_F1-3_hrGFP was prepared using the method described in "Schwartz, C., Shabbir-Hussain, M., Frogue, K., Blenner, M. & Wheeldon, I. Standardized Markerless Gene Integration for Pathway Engineering in Yarrowia lipolytica. Acs Synth Biol 6, 402-409"; pINA1312 and pINA1269 were prepared using the method described in "Nicaud, JM, Madzak, C., van den Broek, P., Gysler, C., Duboc, P., Niederberger, P., Gaillardin, C. 2002. Protein expression and secretion in the yeast". Yarrowia lipolytica It was prepared by the method described in FEMS Yeast Res, 2(3), 371-379.

[0031] 2. Carrier Construction (1) Insert the ybbO gene into the EcoR I site of the pUC19-rDNA-HisG vector to construct the recombinant plasmid pUC19-rDNA-blh-ybbO; (2) Using the CRISPR / Cas9 system, the LRAT gene was inserted into the Nhe I and BssHII sites of the pHR_F1-3_hrGFP vector to construct the LRAT gene integration vector pHR_F1-3_LART (nucleotide sequence as shown in SEQ ID NO.6). (3) The PaGGPPS gene was inserted into the Pml I and BamH I sites of the pINA1312 vector to construct the recombinant plasmid pINA1312-PaGGPPS; (4) Insert the MBP-ERG12 fusion gene and HMG1 gene into the Pml I and BamH I sites of the pINA1269 vector to construct the recombinant plasmid pINA1269-MBP-ERG12-HMG1.

[0032] 3. Yeast transformation and screening (1) After linearizing the recombinant plasmid pUC19-rDNA-blh-ybbO, it was transformed into Yersinia lipolytica XK17, and positive transformants were screened on SD-Ura / -Leu medium to obtain strain WL12; (2) The LRAT gene integration vector pHR_F1-3_LART and the sgRNA / Cas9 expression vector (the nucleotide sequence of sgRNA is shown in SEQ ID NO.7) were co-transformed into strain WL12. The LRAT gene was integrated into the F1-3 site through homologous recombination, and strain WL19 was obtained by screening. (3) After linearizing the recombinant plasmid pINA1312-PaGGPPS, strain WL19 was transformed and strain WL20 was obtained by screening. (4) After linearizing the recombinant plasmid pINA1269-MBP-ERG12-HMG1, the strain WL20 was transformed. The URA selection marker was removed by 5-FOA screening to obtain the final engineered strain WL21.

[0033] Example 2: Shake-flask fermentation verification of retinyl ester synthesis by engineered strains Shake-flask fermentation experiments were conducted on engineered strains WL19, WL20, and WL21, respectively, using the following methods: The engineered strain was inoculated into an EP tube containing 2 mL of YPD medium (containing 5% v / v dodecane and 2% v / v dibutylhydroxytoluene) and cultured overnight at 30°C and 220 rpm to obtain the seed culture. Dilute the seed culture to OD 600 =0.01, inoculated into 50mL YPD medium (containing 5% v / v dodecane and 2% v / v dibutylhydroxytoluene), and cultured at 30℃ and 220rpm for 3 days to obtain fermentation broth.

[0034] Product extraction and detection: (1) Collection of cell culture: Take 1 mL of fermentation broth and centrifuge to obtain cell precipitate; (2) Cell disruption extraction: The bacterial cell precipitate was resuspended in 1 mL of acetone containing 0.5 mm zirconium oxide beads, ground at low temperature for 30 min, centrifuged again, and the supernatant was taken and filtered through a 0.22 μm organic filter membrane; (3) Detection: The membrane filtrate was detected using a Shimadzu LC-20 HPLC system (C18 reversed-phase column). The mobile phase was acetonitrile:water:isopropanol:methanol = 9:1:4:6 (v / v / v / v), the flow rate was 1 mL / min, and the UV detection was performed at 350 nm. The product was qualitatively analyzed using an Agilent 1290 Infinity II–6460 LC-MS system (APCI positive ion source). Figure 6 ), confirming linoleic acid retinyl ester (m / z=549.5 [M+H])+ The formation of retinyl palmitate (m / z=525.5) and retinyl oleate (m / z=551.5) Figure 7 ).

[0035] Test results are shown Figure 2 The results showed that WL21 had the highest total yield of linoleic acid retinyl ester and oleic acid / palmitic acid retinyl ester, and the total content of retinol, retinaldehyde and retinoic acid was less than 10 mg / L, achieving near-complete conversion.

[0036] Example 3: Feed-fed fermentation synthesis of retinyl esters in a 5L bioreactor 1. Seed liquid preparation (1) Pick a single colony of engineered strain WL21 from a glycerol tube or selective agar plate, inoculate it into a 10 mL EP tube containing 2 mL YPD medium, and incubate overnight at 30 °C and 220 rpm to obtain a primary seed culture. (2) Inoculate the primary seed culture into a shake flask containing 50 mL of YPD medium at a 2% inoculation rate, and incubate at 30 °C and 220 rpm for 24 h to obtain the secondary seed culture; (3) Inoculate the secondary seed solution into 6 parallel 50mL YPD shake flasks at a 2% inoculation rate, and culture at 30℃ and 220rpm for 20h. Combine the two to obtain the tertiary seed solution.

[0037] All of the above YPD culture media were supplemented with 5% v / v dodecane and 2% v / v butylated hydroxytoluene to prevent product oxidation and increase yield.

[0038] 2. Fermentation culture (1) The third-stage seed culture was inoculated into a 5L bioreactor at a 10% inoculation rate. The reactor contained 3L of 2×YPD fermentation medium (containing 5% v / v dodecane and 2% v / v dibutylhydroxytoluene), and 4g / L soybean oil was added. (2) Fermentation conditions control: pH maintained at 5.5 (adjusted with 2M NaOH), temperature at 30℃, aeration rate at 3L / min, and dissolved oxygen maintained at 30-60% by adjusting the stirring speed; (3) Feeding strategy: The initial glucose concentration was 40 g / L. After the initial glucose was depleted, a 600 g / L glucose feed solution was used for fed-batch culture to maintain a residual glucose concentration of approximately 5 g / L. The total fermentation time was 120 h. During fermentation, the fermentation broth was collected for product extraction and detection, using the same method as in Example 2. The fed-batch fermentation curve of engineered strain WL21 in a 5 L bioreactor is shown below. Figure 3 As shown.

[0039] Using the above method, the engineered strain WL21 was fermented in a 5L bioreactor for 120 hours, and the yield of linoleic acid retinyl ester reached 1020.58 mg / L, while the total yield of oleic acid retinyl ester and palmitic acid retinyl ester reached 986.52 mg / L.

[0040] Example 4: Synthesis of retinyl esters using lignocellulose hydrolysate as a carbon source Preparation of lignocellulose hydrolysate: Lignocellulose hydrolysate was obtained from corn stalks via enzymatic hydrolysis, containing 86.2 wt% glucose and 13.8 wt% xylose, with an initial total sugar concentration of 40 g / L. No detoxification treatment was required. The lignocellulose hydrolysate was provided by Suzhou Juyuanchuang Biotechnology Co., Ltd.

[0041] Fermentation culture: The method is the same as in Example 3, except that the glucose in the fermentation medium is replaced with lignocellulose hydrolysate; the fermentation time is 96 hours.

[0042] After 96 hours of fermentation, the fermentation broth was taken for product extraction and testing, using the same method as in Example 2.

[0043] Product analysis showed that after 96 hours of fermentation using lignocellulose hydrolysate as the carbon source, the yield of linoleic retinyl ester was 606.60 mg / L, and the total yield of oleic and palmitic retinyl esters was 750.87 mg / L. These results indicate that this engineered strain can achieve efficient synthesis of retinyl esters using inexpensive, non-grain carbon sources.

[0044] Experimental Example 1 The initial glucose concentration of the fermentation medium in Example 3 was adjusted to 20 g / L, and the remaining operations were the same as in Example 3.

[0045] The initial total sugar concentration of the fermentation medium in Example 4 was adjusted to 20 g / L, and the remaining operations were the same as in Example 4.

[0046] The yield of retinyl esters was statistically analyzed using different types and concentrations of carbon sources at different fermentation times. The results are shown in [Figure Number]. Figure 4 The results showed that the engineered strain WL21 has the potential to synthesize retinyl esters using non-grain lignocellulose hydrolysate as an inexpensive carbon source.

[0047] Example 5: Verification of the antioxidant activity of synthesized retinyl esters The retinol standard used in this embodiment has CAS number 11103-57-4 and was purchased from Shanghai Boka Chemical Technology Co., Ltd.

[0048] The fermentation broth from Example 3 was extracted and purified using semi-preparative high-performance liquid chromatography (HPLC) to obtain a mixed sample of retinyl esters. The specific extraction and purification method is as follows: First, the supernatant was removed from 1 L of fermentation broth by centrifugation, and the cell pellet was collected. Then, the cells were mortared and pounded to lyse the cells and release intracellular retinyl esters. Intracellular retinyl esters were extracted in fractions using 100 mL of acetone to ensure complete extraction. After extraction, the acetone phase was concentrated by rotary evaporation to remove the solvent. Finally, the concentrated sample was filtered through a 0.22 µm filter membrane, and the resulting filtrate was used as the pre-preparative sample for subsequent semi-preparative separation. The semi-preparative separation was performed using an ESIL LP-C18 column under the following conditions: mobile phase: tetrahydrofuran and 1% formic acid aqueous solution, volume ratio 3:1; flow rate: 3.5 mL / min; detection wavelength: 350 nm.

[0049] Using human immortalized keratinocytes (HaCaT) as a model, the following groups were set up: blank group, UVA irradiation group, UVA + chemically synthesized retinol group, and UVA + retinyl ester synthesized in this invention group.

[0050] Weigh 0.3 g of retinol standard and 0.3 g of retinyl ester mixed sample, and dissolve them separately in 1 mL of dimethyl sulfoxide (DMSO) to prepare stock solutions. Use DMEM medium to serially dilute the stock solutions to obtain retinol / DMEM solutions and retinyl ester mixed sample / DMEM solutions with final concentrations of 0.003-30 μg / mL.

[0051] Keratinocytes in the logarithmic growth phase grow at a rate of 1×10 5 Cells / mL were seeded in 96-well cell culture plates. The UVA + chemically synthesized retinol group was treated with retinol / DMEM solution, and the UVA + retinyl ester group was treated with a retinyl ester mixture / DMEM solution. The blank group and UVA irradiation group were treated with equal volumes of DMEM (containing DMSO). Each group had three replicates. After culturing for 24 h, the UVA irradiation group, UVA + chemically synthesized retinol group, and UVA + retinyl ester group were induced to undergo UVA senescence. A 10% CCK-8 solution was prepared using DMEM medium, and the medium was changed in the experimental plates. The plates were incubated in a 37°C oven in the dark for 1.5 h. Finally, the absorbance of each well was measured at 450 nm using a microplate reader. OD 450 ).

[0052] Intracellular ROS assay: Reactive oxygen species (ROS) were detected using standard cell culture methods. The specific procedures were as follows: Cells in the growth phase were digested with trypsin, counted using a hemocytometer, and the cell suspension density was adjusted to 1.5 × 10⁻⁶. 5 cells / mL, seeded in 6-well culture plates.

[0053] ROS assay was performed using the DCFH-DA fluorescent probe. A 10 μM working solution (using serum-free DMEM as the solvent) was prepared according to the kit instructions. After 12 h of drug intervention, the culture supernatant was discarded, and 1 mL of DCFH-DA working solution was added to each well. Cells were incubated at 37°C in the dark for 20 min. After incubation, cells were washed three times with serum-free DMEM. Subsequently, fluorescence microscopy was used for image acquisition with 488 nm excitation and 525 nm emission. Cells were then collected by trypsin digestion and the density was adjusted to 5 × 10⁶ cells / well. 4 Cells / mL were seeded in black 96-well plates for subsequent quantitative fluorescence detection.

[0054] result( Figure 5 The results showed that the ROS level in the UVA irradiation group was significantly increased, while the ROS levels in the retinol group and the retinyl ester group were reduced to about 67% of those in the irradiation group, and there was no significant difference between the two. This proves that the retinyl ester synthesized in this invention has antioxidant activity comparable to that of chemically synthesized retinol.

[0055] SEQ ID NO.1:ATGACCCACAAGGCTACCGAGATCCTCACCGGAAAGGTGATGCAGAAGTCTGTGCTCATTACAGGGTGCTCTTCCGGAATTGGCCTTGAGTCCGCCCTGGAGCTGAAGCGACAGGGATTCCACGTCCTGGCTGGTTGCCGAAAGCCTGACGACGTGGAGCGAATGAACTCTATGGGTTTCACCGGCGTGCTCATTGACCTCGACTCCCCTGAGTCCGTGGACCGAGCCGCCGACGAGGTGATCGCTCTCACCGACAACTGCCTGTACGGCATCTTCAACAACGCTGGTTTCGGTATGTACGGTCCTCTGTCTACCATTTCCCGTGCCCAGATGGAGCAGCAGTTCTCCGCTAACTTCTTCGGCGCCCACCAGCTGACCATGCGACTGCTGCCCGCCATGCTGCCCCACGGAGAGGGACGAATCGTCATGACCTCTTCCGTCATGGGACTGATTTCTACCCCCGGACGAGGCGCTTACGCCGCTTCTAAGTACGCTCTGGAGGCTTGGTCTGACGCCCTGCGAATGGAGCTGCGACACTCCGGTATTAAGGTGTCTCTCATTGAGCCTGGCCCTATTCGAACCCGATTCACCGACAACGTGAACCAGACCCAGTCTGACAAGCCTGTCGAGAACCCCGGCATCGCCGCTCGATTCACCCTCGGTCCTGAGGCTGTCGTGGACAAGGTGCGACACGCTTTCATCTCTGAGAAGCCTAAGATGCGATACCCCGTCACCCTCGTCACCTGGGCCGTGATGGTGCTCAAGCGACTCCTCCCCGGTCGAGTGATGGACAAGATCCTCCAGGGATAA。

[0056] SEQ ID NO.2:ATGAAGAACCCCATGCTCGAGGTGGTCTCTCTCCTTCTGGAGAAGCTTCTCCTCATCTCTAACTTCACTCTGTTCTCTTCCGGCGCAGCCGGCGAGGATAAGGGACGAAACTCCTTCTACGAAACCTCGTCGTTTCACCGGGGAGACGTGCTCGAGGTTCCACGAACCCATCTGACCCACTACGGAATTTACCTGGGAGATAACCGGGTCGCCCACATGATGCCCGACATCCTGCTGGCCCTCACTGACGACATGGGTCGAACCCAGAAGGTGGTGTCCAACAAGCGACTGATTCTGGGAGTCATCGTTAAGGTCGCTTCCATTAGAGTGGACACCGTCGAGGACTTTGCTTATGGCGCCAATATCCTGGTGAACCACCTCGACGAGTCTCTGCAGAAGAAAGCTCTGCTTAACGAGGAAGTGGCCAGACGAGCTGAGAAGCTTCTTGGCTTCACACCCTACTCCCTGCTTTGGAACAACTGTGAGCACTTCGTGACTTACTGTCGATACGGTACACCTATTTCGCCTCAGTCGGATAAGTTCTGCGAGACCGTCAAGATTATCATCCGAGACCAGAGATCGGTCCTGGCATCTGCTGTGCTCGGCCTGGCCTCCATTGTTTGCACTGGCCTCGTCTCCTACACCACATTGCCTGCCATCTTCATCCCTTTCTTCCTGTGGATGGCAGGTTAG。

[0057] SEQ ID NO.3:ATGACTGTCTGCGCTGAACAGCATGTCAACTTCATCCACTCGGATGCAGCCTCATTGCTCAACGACATTGAGCAACGCCTCGACCAGCTTTTGCCGGTTGAATCCGAGCGAGATCTCGTTGGAGCCGCCATGCGAGACGGAGCTCTTGCCCCAGGCAAGCGAATCAGACCTCTGCTGCTGTTGTTGGCAGCCCGTGACCTTGGTTGCAACGCCACCCCTGCTGGTCTTCTCGATCTGGCCTGTGCGGTGGAGATGGTACATGCCGCGTCTCTGATTCTGGATGACATGCCCTGCATGGACGACGCCCAGCTGCGACGAGGCCGACCCACCATTCACTGCCAGTACGGCGAGCACGTCGCCATCCTCGCTGCTGTCGCGCTGCTCTCCAAGGCCTTTGGAGTCGTGGCTGCTGCCGAAGGTCTGACTGCCACAGCACGGGCGGATGCTGTAGCTGAATTGAGCCATGCGGTGGGCATGCAGGGACTAGTCCAGGGCCAGTTCAAGGACCTTTCAGAGGGCGACAAACCTAGATCTGCAGACGCCATTCTCATGACCAACCACTACAAGACGTCTACTCTGTTCTGTGCTTCTCTGCAGATGGCTTCCATCGTTGCCGAGGCCTCCGGAGAGGCTCGGGAGCAGCTCCACCGGTTCAGCCTCAATCTCGGACAGGCTTTCCAACTTCTGGATGATCTGACCGACGGTATGGCCGACACTGGTAAGGATGCCCACCAGGACGACGGCAAATCGACACTGGTGAACCTGCTCGGGCCCCAAGCTGTTGAGACCCGTCTAAGAGACCATCTTCGATGTGCCTCGGAGCATCTCCTGAGTGCTTGTCAAGATGGTTATGCAACGCACCACTTTGTGCAGGCCTGGTTTGAGAAGAAGCTGGCAGCTGTGAGTTGA。

[0058] SEQ ID NO.4:

[0059] SEQ ID NO.5:

[0060] SEQ ID NO.6:

[0061] SEQ ID NO.7: cttgagaggagccaggggga.

[0062] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing engineered bacteria for synthesizing retinyl esters, characterized in that, The process includes the step of introducing a key gene into a Yersinia lipophila starter strain to overexpress it, thereby obtaining the engineered strain. The key genes include the ybbO gene, the LRAT gene, and the PaGGPPS gene. The nucleotide sequence of the ybbO gene is shown in SEQ ID NO.1; The nucleotide sequence of the LRAT gene is shown in SEQ ID NO.2; The nucleotide sequence of the PaGGPPS gene is shown in SEQ ID NO.

3.

2. The construction method according to claim 1, characterized in that, The key genes also include the MBP-ERG12 fusion gene and the HMG1 gene; The nucleotide sequence of the MBP-ERG12 fusion gene is shown in SEQ ID NO.4; The nucleotide sequence of the HMG1 gene is shown in SEQ ID NO.

5.

3. The construction method according to claim 1 or 2, characterized in that, The starting strain of Yersinia lipolytica was Yersinia lipolytica XK17.

4. The construction method according to claim 1, characterized in that, The ybbO gene and the PaGGPPS gene were overexpressed using recombinant plasmids; The LRAT gene was integrated into the F1-3 site of the Yersinia lipophila starting strain using the CRISPR / Cas9 gene editing method.

5. The construction method according to claim 2, characterized in that, The MBP-ERG12 fusion gene and the HMG1 gene were overexpressed using recombinant plasmids.

6. An engineered bacterium constructed according to any one of claims 1-5.

7. The application of the engineered bacteria as described in claim 6 in the synthesis of retinyl esters, characterized in that, The retinyl esters include at least one of linoleic retinyl ester, palmitic retinyl ester, and oleic retinyl ester.

8. A method for synthesizing retinyl esters using Yersinia lipolytica, characterized in that, The *Yersinia lipophila* strain is the engineered strain described in claim 6; The method includes the step of fermenting and culturing the engineered bacteria to obtain the retinyl ester; The retinyl esters include at least one of linoleic retinyl ester, palmitic retinyl ester, and oleic retinyl ester.

9. The method according to claim 8, characterized in that, The carbon source for the fermentation culture medium used in the fermentation culture is glucose or lignocellulose hydrolysate.

10. The method according to claim 8, characterized in that, The fermentation culture medium used in the fermentation culture contains dodecane and butylated hydroxytoluene.

Citation Information

Patent Citations

  • Yarrowia lipolytica genetic engineering bacterium for producing beta-carotene and application of yarrowia lipolytica genetic engineering bacterium

    CN111321087A

  • Yarrowia lipolytica genetically engineered bacterium for producing alpha-pinene, and application of yarrowia lipolytica genetically engineered bacterium

    CN112300952A