TaSCF, a protein related to wheat grain protein content GPC-3A Its encoding genes and applications

Abstract

This invention relates to the field of plant molecular breeding technology, and discloses TaSCF, a protein related to the protein content of wheat grains. GPC‑3A Its encoding gene and applications. This invention reveals for the first time the wheat protein TaSCF. GPC‑3A A comparison of wheat grain protein content between transgenic knockout lines and transgenic overexpression lines revealed that, compared to wild-type Fielder, the grain protein content of transgenic knockout lines was significantly increased, while the grain protein content of transgenic overexpression lines was significantly decreased. These results indicate that... TaSCF GPC Genes can negatively regulate the protein content of wheat grains. This invention provides theoretical clues for molecular genetic research on wheat grain protein content and offers important genetic resources for molecular breeding of wheat quality.

Description

Technical Field

[0001] This invention relates to the field of plant molecular breeding technology, and more specifically, to TaSCF, a protein related to wheat grain protein content. GPC-3A Its encoding genes and applications. Background Technology

[0002] Ensuring the security of wheat supply and improving its nutritional quality are core tasks supporting the national food security strategy and meeting the needs of people's dietary upgrading. Currently, my country's wheat industry faces structural contradictions: on the one hand, market demand for high-quality specialty wheat (strong gluten and weak gluten, meeting the national standard GB / T 17892-2024) is growing rapidly, but domestic production capacity is insufficient, leading to long-term reliance on imports and potential risks to the supply chain; on the other hand, the main domestic varieties are still medium-gluten, high-yield wheat, which generally exhibits genetic antagonism, with high yield but low quality, and high quality but low yield. Traditional breeding methods largely rely on aggregating positively correlated genes related to yield and quality, making it difficult to overcome the breeding bottleneck of a negative correlation between yield and quality at the genetic mechanism level.

[0003] Grain protein content (GPC) is a key quantitative trait determining the nutritional and processing quality of wheat. It is regulated by multiple genes and environmental interactions and is generally negatively correlated with yield. However, existing research has demonstrated that by targeting and modifying the negative regulators of key traits such as grain size and protein content, the genetic antagonism between yield and quality can be effectively broken, improving both grain nutritional and processing quality while ensuring stable or increased yield. Therefore, in-depth exploration of the negative regulators of wheat GPC and the creation of non-GMO breeding materials through gene editing and backcrossing can provide important genetic resources for the breeding of high-quality, high-yield wheat varieties. Summary of the Invention

[0004] The purpose of this invention is to provide TaSCF, a protein related to the protein content of wheat grains. GPC-3A Its encoding genes and applications.

[0005] To achieve the objectives of this invention, in a first aspect, this invention provides TaSCF, a protein related to the protein content of wheat grains. GPC-3A , which is: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2; or, (b) A protein derived from (a) with the sequence shown in SEQ ID NO:2 substituted, deleted or added with one or more amino acids and having the same function.

[0006] Secondly, the present invention provides a protein encoding TaSCF. GPC-3A The genes are: A1), the nucleotide sequence shown in SEQ ID NO:1; A2) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:1 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; A3) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE or 0.1×SSC solution containing 0.1% SDS, followed by washing the membrane with the solution. A4) nucleotide sequences that have more than 90% homology with the nucleotide sequences of A1), A2), or A3) and express the same functional protein; or, A5) is a nucleotide sequence that is completely complementary to the nucleotide sequences of A1), A2), A3) or A4).

[0007] Thirdly, the present invention provides biological materials containing the gene, including but not limited to expression cassettes, expression vectors, cloning vectors, or engineered bacteria.

[0008] Fourthly, the present invention provides the protein TaSCF. GPC-3A The application of the gene or the biological material in regulating the protein content of wheat grains; The regulation mentioned is negative regulation.

[0009] Furthermore, the protein content of wheat grains can be increased by inhibiting the expression or function of the protein or gene.

[0010] Preferably, the inhibition is achieved by knocking out or mutating endogenous TaSCF in wheat using gene editing technology. GPC-3A The gene and / or its homolog TaSCF GPC-3B TaSCF GPC-3D It was achieved.

[0011] Fifthly, this invention provides the application of a gene-editing target in the preparation of wheat with high grain protein content, wherein the target is located in wheat TaSCF. GPC-3A Genes, TaSCF GPC-3B Gene or TaSCF GPC-3D In terms of genes, it is used to guide gene editing systems to reduce or eliminate the function of target genes; The TaSCF GPC-3B The genes are: B1), the nucleotide sequence shown in SEQ ID NO:3; B2) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:3 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; B3) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE or 0.1×SSC solution containing 0.1% SDS, followed by washing the membrane with the solution. B4) nucleotide sequences that have more than 90% homology with B1), B2) or B3) and express the same functional protein; or, A nucleotide sequence that is completely complementary to the nucleotide sequences of B5, B1, B2, B3, or B4.

[0012] The TaSCF GPC-3D The genes are: D1), the nucleotide sequence shown in SEQ ID NO:5; D2) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:5 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; D3) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:5 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE or 0.1×SSC solution containing 0.1% SDS, followed by washing the membrane with the solution. D4) nucleotide sequences that have more than 90% homology with D1), D2) or D3) and express the same functional protein; or, A nucleotide sequence that is completely complementary to the nucleotide sequences of D5, D1, D2, D3, or D4.

[0013] TaSCF GPC-3B TaSCF GPC-3D The amino acid sequences of the proteins encoded by the genes are shown in SEQ ID NO:4 and SEQ ID NO:6, respectively.

[0014] Furthermore, the target is sgRNA1 and / or sgRNA2; The nucleotide sequence of the sgRNA1 action site is: 5'-GTTTCTGGTGGCGGTGAGAG-3'; The nucleotide sequence of the sgRNA2 action site is: 5'-GGTGGCGTGATGCACTAGGA-3'.

[0015] Sixthly, the present invention provides a method for increasing the protein content of wheat grains, the method comprising: reducing the protein TaSCF in wheat plants. GPC-3A or the expression level or biological activity of its homologous proteins.

[0016] In a seventh aspect, the present invention provides the application of transgenic wheat obtained according to the method in plant breeding.

[0017] Furthermore, breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0018] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention reveals wheat protein TaSCF for the first time. GPC-3A A comparison of wheat grain protein content between transgenic knockout lines and transgenic overexpression lines revealed that, compared to wild-type Fielder, the grain protein content of transgenic knockout lines was significantly increased, while the grain protein content of transgenic overexpression lines was significantly decreased. These results indicate that... TaSCF GPC Genes negatively regulate the protein content of wheat grains.

[0019] Grain protein content (GPC) is a key trait determining the nutritional and processing quality of wheat, but its genetic regulation is extremely complex, controlled by multiple genes and significantly interacting with the environment, especially showing a prevalent negative correlation with yield. In this complex regulatory network, negative regulators act as "brakes" or "limiters," profoundly affecting the upper limit of GPC expression, stability, and the quality-yield balance. Systematic analysis and utilization of negative regulators are of irreplaceable importance for breaking genetic antagonism and achieving synergistic improvement in quality and yield. The protein TaSCF provided in this invention... GPC-3A It is a negative regulator of wheat grain protein content, providing theoretical clues for molecular genetic research on wheat grain protein content and providing important genetic resources for molecular breeding of wheat quality. Attached Figure Description

[0020] Figure 1 In a preferred embodiment of the present invention, GWAS is used to discover genes controlling wheat GPC. TaSCF GPC-3A Among them, A: Manhattan plot of GPC association analysis; B: Gene expression heatmap of candidate regions; CE: Haplotype analysis of candidate genes Gene1, Gene2 and Gene3; F: GPC statistical analysis of wheat wild-type J411 and mutant 168 (both purchased from Shijiazhuang Borui Biotechnology Co., Ltd.); P<0.01, T-test.

[0021] Figure 2 In a preferred embodiment of the present invention TaSCF GPC-3A Knockout editing type of genetically modified wheat.

[0022] Figure 3 This is a preferred embodiment of the identification of overexpressed transgenic wheat. Wherein, A: genomic level identification; B: transcriptome level identification; P<0.001, T -test.

[0023] Figure 4 The protein content of the seeds of the transgenic strain and the wild type was determined in a preferred embodiment of the present invention. P <0.05, P <0.01, P <0.001, T -test. Detailed Implementation

[0024] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0025] The wild-type wheat Fielder used in the following examples is from the Wheat Research Center of China Agricultural University.

[0026] Example 1: TaSCF, a protein related to wheat grain protein content GPC-3A Discovery and cloning of the coding gene This embodiment used a natural population containing 195 representative winter wheat varieties as material and performed GWAS analysis on wheat GPC under three different environments. The results identified a stable QTL (647.4–653.4 Mb) regulating GPC on chromosome 3A. Combining gene expression data from public databases and haplotype analysis, the E3 ubiquitin ligase gene was finally identified. TaSCF GPC-3A Candidate genes ( Figure 1 ).

[0027] Example 2 TaSCF GPC Obtaining knockout genetically modified wheat 1. TaSCFGPC-3A The gene's CDS sequence was entered into the E-crisp website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) to design gRNA targets. Then, the specificity of the targets was detected using the Ensemble Plant website (http: / / plants.ensembl.org / index.html), yielding two gRNAs: sgRNA1 (5'-GTTTCTGGTGGCGGTGAGAG-3') and sgRNA2 (5'-GGTGGCGTGATGCACTAGGA-3'). TaSCF GPC -3A / 3B / 3D ( TaSCF GPC-3A , TaSCF GPC-3B , TaSCF GPC-3D The target site (a conserved homologous gene) was used to construct sgRNA into the pCBC-MT1T2 vector (provided by the Wheat Research Center of China Agricultural University; the pCBC-MT1T2 vector can be found in Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. (2014), ACRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 14:327) via PCR. The PCR product was then purified and used for enzyme digestion and ligation.

[0028] 2. Perform enzyme digestion and ligation of the PCR products. The total reaction volume is 15 µL: 2 µL of PCR product from step 1, 2 µL of pBUE414, 1.5 µL of 10×NEB T4 buffer, 1.5 µL of CutSmart buffer, and 20,000 U / mL enzyme. Bsa I 1 µL, 400,000 U / mL T4 DNA ligase 1 µL, ddH2O 6 µL. Reaction conditions: 37℃ for 5 h, 50℃ for 5 min, 80℃ for 10 min, and then cooled on ice after the reaction.

[0029] 3. Following the instructions for E. coli transformation from Beijing Bomaide Gene Technology Co., Ltd., the enzyme digestion and ligation products were transformed into DH5α, and evenly spread on LB agar plates containing 50 mg / ml Kana. The plates were incubated overnight at 37°C with the plates inverted. Colony PCR was performed using the detection primers (414-seq-F: 5'-TTTCCCAGTCACGACGTTGT-3'; 414-seq-R: 5'-ATCTCTAGAGAGGGGCACGA-3'). Positive products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The plasmid with the correct sequence was extracted and transformed into Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria.

[0030] 4. The recombinant bacteria were sent to the transgenic platform of the Wheat Research Center of China Agricultural University to transform the recipient wheat Fielder, obtaining T0 generation plants. The plant DNA was extracted using the CTAB method, and the target sites were sequenced and identified using primers (Table 1), yielding homozygous transgene knockout positive lines. KO-2 , KO-4 Homozygous knockout transgenic double mutant lines were obtained through multiple generations, and their gene editing types are as follows: Figure 2 As shown. Figure 2 The deletion of a medium-to-large fragment refers to the deletion of 5′-GGCGGTGAGAGTGGACAGACACAGAATGGTGGCACGGACACCACCTTGTCAGGTTGGAAGGACCTCCCCATGGAGCTTCTGCTGAGGATCATATCAGTAGCTGGAGATGACAGGATGGCCATTGTAGCCTCCGGTGTTTGTACCGGGTGGCGTGATGCAC-3′ (SEQ ID NO:7), and the deletion of 30 bases refers to the deletion of 5′-GAGTGGACAGCCACAGAATGGTGGCACAGA-3′ (SEQ ID NO:8).

[0031] The primers for detecting the target of knockout transgenic wheat are shown in Table 1.

[0032] Table 1 Primers for detecting the target site of knockout transgenic wheat

[0033] Example 3 TaSCF GPC-3A Obtaining transgenic wheat with overexpression 1. Amplification was performed using adapter primers (F: 5'-AGGTCGACTCTAGAGGATCCATGGTCAATGCACAGATGGT-3'; R: 5'-AGCTCGGTACCCGGGGATCCGTAGGCATGGTTTGACAGGA-3'). TaSCFGPC-3A The CDS sequence was used to purify the PCR product for enzyme digestion and ligation reactions.

[0034] 2. The expression vector pWMB110 (provided by the Wheat Research Center of China Agricultural University; pWMB110 can be found in the reference Symbagua ED, Zhang Z, Tripathi JN, Ntui VO, Kang M, George OO, Edward NK, Wang K, Yang B, Tripathi L. A CRISPR / Cas9-based genome-editing system for yam (Dioscorea spp.). (2021), Plant Biotechnol J. 19(4):645-647), with the restriction site BamHI I, was used. The total reaction volume was 50 µL: 1 µg of pWMB110 vector plasmid, 5 µL of 10×NE buffer, and 1 µL of 20,000 U / mL BamHI-HFv2, which was then brought to 50 µL with Nuclease-free water. Reaction conditions: 37℃ for 3 h, and cooled on ice after the reaction.

[0035] 3. Homologous recombination of the products from steps 1 and 2 was performed using the homologous recombinase from Beijing Bomed Gene Technology Co., Ltd. The total reaction volume was 10 µL: 5 µL of 2×Seamless Cloning Mix homologous recombinase, 3 µL of vector fragment, and 2 µL of PCR product. Reaction conditions: 50℃, 30 min. After the reaction, the product was placed on ice for later use.

[0036] 4. Following the E. coli transformation instructions from Beijing Bomeide Gene Technology Co., Ltd., the product from step 3 was transformed into DH5α, evenly spread on LB agar plates containing 50 mg / ml Kana, and incubated overnight at 37°C inverted. Colony PCR was performed using detection primers (110-seq-F: 5'-TAGCCCTGCCTTCATACGCT-3'; 110-seq-R: 5'-AAGACCGGCAACAGGATTCA-3'). Positive products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The correctly sequenced cloning plasmid was extracted and transformed into Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria.

[0037] 5. The recombinant bacteria were sent to the transgenic platform of the Wheat Research Center of China Agricultural University to transform the recipient wheat Fielder, obtaining T0 generation plants. DNA and RNA were extracted from the plants using the CTAB method and the Trizol method, respectively, and identified at the genomic and transcriptomic levels using primers (OE-F: 5'-TAGCCCTGCCTTCATACGCT-3'; OE-R: 5'-AGGACCGATCACTAAGCCTG-3'; qPCR-F: 5'-CAGATGAGAGCGTGGTTGC-3'; qPCR-R: 5'-TCCTGATGCGGCTGTTCTC-3'). After two generations of screening and identification, overexpression transgenic positive lines were obtained. OE-1 and OE-2 ( Figure 3 ).

[0038] Example 4 TaSCF GPC Determination of grain protein content in transgenic knockout and overexpression wheat lines Harvest TaSCF GPC Transgenic knockout lines ( KO-2 and KO-4 ), transgenic overexpression lines ( OE-1 and OE-2 The study included mature grains of wild-type Fielder wheat. Protein content in wheat grains of different strains was determined using a Broadcom DA7200 near-infrared grain analyzer. Three biological replicates were performed, and the mean values ​​were used for data analysis.

[0039] Results analysis: Through analysis of wild-type Fielder, TaSCF GPC Transgenic knockout lines ( KO-2 and KO-4 ), transgenic overexpression lines ( OE-1 and OE-2 A comparison of grain protein content revealed that, compared to the wild-type Fielder, the two knockout lines... KO-2 and KO-4 The grain protein content was significantly increased in the two overexpression lines OE-1 and OE-2, while the grain protein content was significantly decreased. Figure 4 This result indicates that TaSCF GPC Genes can negatively regulate the protein content of wheat grains.

[0040] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. TaSCF, a protein related to wheat grain protein content GPC-3A Its characteristics are, It is: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:2; or, (b) A protein derived from (a) with the sequence shown in SEQ ID NO:2 substituted, deleted or added with one or more amino acids and having the same function.

2. A gene encoding the protein of claim 1, characterized in that, It is: A1), the nucleotide sequence shown in SEQ ID NO:1; A2) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:1 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; A3) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE or 0.1×SSC solution containing 0.1% SDS, followed by washing the membrane with the solution. A4) nucleotide sequences that have more than 90% homology with the nucleotide sequences of A1), A2), or A3) and express the same functional protein; or, A5) is a nucleotide sequence that is completely complementary to the nucleotide sequences of A1), A2), A3) or A4).

3. A biomaterial containing the gene of claim 2, characterized in that, The biological material is an expression cassette, expression vector, cloning vector, or engineered bacteria.

4. The application of the protein of claim 1, the gene of claim 2, or the biomaterial of claim 3 in regulating the protein content of wheat grains; The regulation mentioned is negative regulation.

5. The application according to claim 4, characterized in that, Increase the protein content of wheat grains by inhibiting the expression or function of the protein or gene.

6. The application according to claim 5, characterized in that, The inhibition is achieved by knocking out or mutating the endogenous TaSCF in wheat through gene editing technology GPC-3A gene and / or its homologous gene TaSCF GPC-3B , TaSCF GPC-3D achieved; Wherein, the TaSCF GPC-3A The gene is the same as the gene described in claim 2.

7. The application of a gene editing target in the preparation of wheat with high grain protein content, characterized in that, The target point is located in wheat TaSCF. GPC-3A Genes, TaSCF GPC-3B Gene or TaSCF GPC-3D In terms of genes, it is used to guide gene editing systems to reduce or eliminate the function of target genes; Wherein, the TaSCF GPC-3A The gene is the same as the gene described in claim 2; The TaSCF GPC-3B The genes are: B1), the nucleotide sequence shown in SEQ ID NO:3; B2) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:3 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; B3) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE or 0.1×SSC solution containing 0.1% SDS, followed by washing the membrane with the solution. B4) nucleotide sequences that have more than 90% homology with B1), B2) or B3) and express the same functional protein; or, B5) is a nucleotide sequence that is completely complementary to the nucleotide sequences of B1), B2), B3) or B4); The TaSCF GPC-3D The genes are: D1), the nucleotide sequence shown in SEQ ID NO:5; D2) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:5 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; D3) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:5 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE or 0.1×SSC solution containing 0.1% SDS, followed by washing the membrane with the solution. D4) nucleotide sequences that have more than 90% homology with D1), D2) or D3) and express the same functional protein; or, A nucleotide sequence that is completely complementary to the nucleotide sequences of D5, D1, D2, D3, or D4.

8. The application according to claim 7, characterized in that, The target is sgRNA1 and / or sgRNA2; The nucleotide sequence of the sgRNA1 action site is: 5'-GTTTCTGGTGGCGGTGAGAG-3'; The nucleotide sequence of the sgRNA2 action site is: 5'-GGTGGCGTGATGCACTAGGA-3'.

9. A method for increasing the protein content of wheat grains, characterized in that, The method includes: reducing the expression level or biological activity of the protein or its homologous protein as described in claim 1 in wheat plants.

10. The application of the transgenic wheat obtained according to the method of claim 9 in plant breeding; Breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

Images