A method for constructing a transgenic silkworm strain with improved triple helix structure of recombinant full-length human collagen type Ⅲ by using a two-hybrid strategy and application thereof

Abstract

This invention discloses a method and application for constructing transgenic silkworm lines that enhance the triple-helix structure of recombinant full-length human type III collagen using a binary hybridization strategy. First, this invention constructs a transgenic silkworm line co-expressing human prolyl 4-hydroxylase (hP4H) α and β subunits, and a transgenic silkworm line expressing recombinant full-length human type III collagen (rhCOLⅢ). Then, the two lines are genetically hybridized using a binary hybridization strategy, and double-positive offspring co-expressing rhCOLⅢ and hP4H are selected, achieving post-translational hydroxylation modification of rhCOLⅢ by hP4H. The modified recombinant full-length human type III collagen (rhCOLⅢ-Hyp) triple-helix structure content is significantly increased. This invention provides a key modification tool and technical pathway for producing full-length recombinant human collagen with a complete triple-helix structure using a silkworm bioreactor.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method and application for constructing transgenic silkworm strains that utilize a binary hybridization strategy to enhance the recombinant full-length human type III collagen triple helix structure. Background Technology

[0002] Collagen is the most abundant structural protein in the human body, accounting for approximately 30% of total protein. It plays a crucial role in tissue repair, extracellular matrix construction, and maintaining skin elasticity. Human type III collagen is a fibrous collagen composed of α1 chains forming a homotrimer, with its core feature being a highly repeating (Gly-XY)n tripeptide unit. The correct folding and thermal stability of this triple helix structure are highly dependent on the hydroxylation modification of the proline residue (Pro) at the Y position. Prolyl-4-hydroxylase (P4H) is the core enzyme catalyzing this crucial post-translational modification (Essays in Biochemistry, 2019, 63, 325-335). P4H is an α2β2 heterotetramer composed of α and β subunits, where the α subunit is the catalytic active center, and the β subunit participates in maintaining the non-aggregated conformation of the α subunit and ensuring the stability of the enzyme complex. Only when the α and β subunits are co-expressed and correctly assembled can the P4H holoenzyme with full catalytic activity be formed.

[0003] Currently, the expression of recombinant human type III collagen mainly relies on microbial systems such as *Escherichia coli* and *Pichia pastoris*. However, these systems have significant limitations when expressing high-molecular-weight, highly repetitive structural proteins: prokaryotic systems (such as *E. coli*) face problems such as premature translation termination and inclusion body formation due to long peptide chains with highly repetitive sequences, resulting in small molecular weight products with low hydroxylation levels; while yeast systems can achieve full-length expression, their triple-helix active structure has not been strongly confirmed, and the glycosylation modification pattern of recombinant proteins differs significantly from that in humans. Currently, in yeast expression systems, studies have achieved proline hydroxylation modification of recombinant collagen by co-expressing P4Hα and β subunits, but this system suffers from uneven hydroxylation modification and significant differences in high-mannose glycosylation modification compared to humans (*Protein Expression and Purification*, 2023, 201, 106184). Therefore, there is an urgent need to develop novel bioreactor platforms capable of simultaneously achieving complete expression of high-molecular-weight, full-length human type III collagen and efficient post-translational hydroxylation modification.

[0004] The posterior silk gland of the silkworm is one of the most efficient protein synthesis organs in nature, serving as a key site for the synthesis of fibroin, a typical structural protein. Fibrin heavy chain protein (FibH) has a molecular weight of approximately 350 kDa and is composed of highly repetitive dipeptide units (Gly-X)n (Proteins, 2001, 44, 119-122). In posterior silk gland cells, the mRNA abundance of a single FibH gene can reach over 50% of the total. At the translational level, FibH protein is efficiently synthesized on membrane-bound polyribosomes, ensuring that newly formed peptide chains directly enter the endoplasmic reticulum for processing and secretion. This series of adaptive evolutionary processes gives the posterior silk gland of the silkworm a superior expression efficiency and capacity compared to microorganisms when expressing high-molecular-weight, highly repetitive structural proteins. Furthermore, the silk gland itself possesses eukaryotic post-translational modification capabilities, providing a foundation for the functional modification and correct folding of structural proteins; simultaneously, exogenous modifying elements can be introduced through transgenic technology to further enhance its post-translational modification capabilities. Therefore, the silkworm silk gland bioreactor is an ideal platform for expressing full-length human type III collagen and performing post-translational modifications.

[0005] However, the activity of endogenous P4H in the posterior silk gland of silkworm is severely insufficient, mainly due to the extremely low expression level of its α subunit (Journal of Biotechnology, 2006, 126, 205-219). This results in insufficient proline hydroxylation modification after the synthesis of exogenous recombinant collagen in the posterior silk gland of silkworm, making it difficult to form a stable natural triple helix structure and limiting its biological activities and other functions. Therefore, establishing a co-expression system of hP4Hα and β subunits in the posterior silk gland of silkworm and performing binary hybridization with a recombinant full-length human type III collagen expression line is expected to simultaneously achieve efficient expression and post-translational functionalization modification of recombinant full-length human type III collagen, thereby improving its triple helix structure stability. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a method and application for constructing a transgenic silkworm strain that enhances the triple helix structure of recombinant full-length human type III collagen using a binary hybridization strategy. First, a gene encoding the α and β subunits of human prolyl 4-hydroxylase (hP4H) and its corresponding transgenic silkworm strain are provided. Second, a transgenic silkworm strain expressing recombinant full-length human type III collagen is provided. Then, the two strains are hybridized using a binary hybridization strategy. By raising the double-positive silkworm strain until it spins its cocoon, collagen is extracted from the posterior silk gland or the cocoon, yielding recombinant full-length human type III collagen containing a triple helix structure.

[0007] To address the problems in the existing technology, the technical solution adopted by this invention is as follows: A method for constructing a transgenic silkworm strain that enhances the recombinant full-length human type III collagen triple helix structure using a binary hybridization strategy, wherein the transgenic silkworm strain is obtained through a binary hybridization strategy, and includes the following steps: Step 1, Preparation of parent strains: Provides first-parent silkworm strains and second-parent silkworm strains; The first parent silkworm strain is a transgenic silkworm strain that expresses human prolyl 4-hydroxylase hP4H and carries the first fluorescent marker gene, specifically co-expressing hP4H α and β subunits in the posterior silk gland of the silkworm. The second parent silkworm strain is a transgenic silkworm strain that expresses recombinant full-length human type III collagen and carries a second fluorescent marker gene that is different from the first fluorescent marker. It specifically expresses recombinant full-length human type III collagen in the posterior silk gland of the silkworm. Step 2, Parental Seed Production and Hybridization: Virgin female moths of the first parent silkworm line and male moths of the second parent silkworm line, or male moths of the first parent silkworm line and virgin female moths of the second parent silkworm line, were selected for directional single-pair mating. This allowed the genetic information of the parents carrying exogenous expression elements to be integrated into the same offspring through sexual reproduction. After the female moths laid eggs, hybrid F1 generation silkworm eggs were obtained. Step 3, screening of double-positive hybrid offspring: After the F1 generation silkworm eggs obtained in step 2 were hatched into ant-like silkworms, each silkworm was screened individually using a fluorescence stereomicroscope to select double-positive individuals that simultaneously expressed the first and second fluorescent markers; that is, the double-positive individuals were the target transgenic silkworm strains that simultaneously integrated the P4H expression element and the full-length human type III collagen expression element.

[0008] As an improvement, the transgenic silkworm strain expressing human prolyl 4-hydroxylase is obtained by genetic transformation of silkworms using a transgenic plasmid expressing human prolyl 4-hydroxylase hP4H.

[0009] A further improvement is that the transgenic plasmid expressing human prolyl 4-hydroxylase contains the gene encoding human prolyl 4-hydroxylase and the silkworm fibroin heavy chain gene (…). FibH Promoter and terminator sequences, as well as fluorescently labeled gene expression elements.

[0010] A further improvement is that the nucleotide sequence of the gene encoding the human prolyl 4-hydroxylase is shown in SEQ ID NO. 1.

[0011] As an improvement, the transgenic silkworm strain expressing recombinant full-length human type III collagen is obtained by genetic transformation of silkworms using the transgenic plasmid expressing recombinant full-length human type III collagen.

[0012] A further improvement is that the transgenic plasmid expressing recombinant full-length human type III collagen contains the coding gene for the aforementioned recombinant full-length human type III collagen and the silkworm fibroin heavy chain gene (…). FibH Promoter and terminator sequences, as well as fluorescently labeled gene expression elements.

[0013] A further improvement is that the nucleotide sequence of the recombinant full-length human type III collagen is shown in SEQ ID NO.3, and its amino acid sequence is derived from the full-length coding sequence (1466 amino acid residues) of human collagen alpha-1(Ⅲ) chain preproprotein (accession number NP_000081.2).

[0014] As an improvement, the specific operation of the directional single-pair mating in step 2 is as follows: the virgin female moths that have not mated after emergence are placed alone in the mating container, a single target male moth is introduced, and mating is carried out for 4-6 hours under the conditions of 25±1℃ and relative humidity of 60-80%. Then the female moths are transferred to the oviposition paper to lay eggs. The screening of double-positive individuals in step 3 further includes self-crossing and propagation of the double-positive individuals obtained by screening to verify the stable inheritance of the double gene loci.

[0015] Preferably, the first fluorescent label is enhanced green fluorescent protein EGFP, and the second fluorescent label is red fluorescent protein DsRed2; the screening in step 3 involves sequentially examining the same ant-like insect under EGFP excitation wavelength of 480 nm and DsRed2 excitation wavelength of 554 nm, with individuals exhibiting both green and red fluorescence being identified as double-positive individuals.

[0016] The transgenic silkworm strain constructed using the above method is applied to the production of recombinant full-length human type III collagen containing a triple helix structure. Specifically, this strain co-expresses P4H and recombinant full-length human type III collagen in the posterior silk gland. The expressed recombinant full-length human type III collagen undergoes proline hydroxylation modification catalyzed by P4H in vivo, forming recombinant full-length human type III collagen with a triple helix structure. Beneficial effects

[0017] Compared with existing technologies, the present invention provides a method and application for constructing and improving transgenic silkworm strains with recombinant full-length human type III collagen triple helix structure using a binary hybridization strategy, which has the following advantages: This invention marks the first time that a transgenic silkworm strain co-expressing human prolyl 4-hydroxylase (hP4H) α and β subunits has been constructed in the posterior silk gland. Choosing human P4H for co-expression results in higher species homology, better meeting the structural modification requirements of human type III collagen, and reducing structural deviations that may arise from differences in heterologous modification systems. Furthermore, this invention fully utilizes the natural advantage of the silkworm's posterior silk gland in synthesizing high-molecular-weight, highly repetitive, and complex structural proteins, thus constructing a transgenic silkworm strain expressing recombinant full-length human type III collagen.

[0018] Secondly, this invention employs a binary hybridization strategy, cross-crossing a human P4H strain with a collagen strain to obtain recombinant human type III collagen modified with human P4H and containing a triple-helix structure. This strategy avoids the technical difficulties and genetic instability associated with constructing ultra-large co-expression vectors. The two parental strains are stably inherited, and independent fluorescent labeling ensures efficient and accurate identification of double-positive hybrid offspring. This strategy is universally applicable to triple-helix modification of different types of recombinant collagen, including types I and II, and exhibits high operational feasibility and genetic stability.

[0019] Finally, the recombinant full-length human type III collagen modified by the system of this invention showed a significantly enhanced proline hydroxylation level and a markedly improved triple helix structure integrity, exhibiting superior cell proliferation and migration activity, thus providing a key raw material for the development of highly active collagen-based biomedical materials. Attached Figure Description

[0020] Figure 1 A schematic diagram of the transgenic plasmid expressing human P4H; Figure 2 A schematic diagram of the transgenic plasmid expressing recombinant full-length human type III collagen; Figure 3 This is a schematic diagram of a binary hybridization strategy; Figure 4 Quantitative analysis of recombinant full-length human type III collagen in transgenic silkworm cocoons Figure 5 Purification and Analysis of Recombinant Full-Length Human Type III Collagen from Transgenic Silkworm Cocoons Figure 6 Analysis of proline hydroxylation in recombinant full-length human type III collagen modified with human P4H; Figure 7 Analysis of the triple helix structure of recombinant full-length human type III collagen before and after human P4H modification. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be noted that the reagents and biological materials used in this invention are all commercially available products.

[0023] This invention is based on piggyBac The mediated transgenic technology utilizes the FibH promoter of silkworms to drive the specific co-expression of the fusion gene of human prolyl 4-hydroxylase (hP4H) α and β subunits in the posterior silk gland of silkworms. On the other hand, it utilizes the FibH expression system to achieve efficient expression of recombinant full-length human type III collagen in the posterior silk gland. Then, through a binary hybridization strategy, the two lines are genetically integrated to obtain a double-positive transgenic silkworm line that co-expresses recombinant full-length human type III collagen and P4H in the posterior silk gland of silkworms. This achieves the goal of in vivo functionalization modification of recombinant human type III collagen and enhancement of its triple helix structure stability.

[0024] Example 1: Design and synthesis of human prolyl 4-hydroxylase (hP4H) fusion gene The coding sequences of the hP4Hα subunit (accession number NP_000908.2) and β subunit (accession number NP_000909.2) were retrieved from the NCBI database. The coding sequences of P4Hα and β subunits were concatenated using the sequence encoding the self-cleaving peptide P2A (GSGATNFSLLKQAGDVEENPGP) to obtain the hP4H fusion gene.

[0025] The fusion gene was optimized based on the codon bias of the silkworm genome, and the optimized fusion gene was synthesized by Shanghai Sangon Biotech Co., Ltd. and cloned into the pUC57 plasmid.

[0026] The optimized nucleotide sequence of the hP4H fusion gene is shown in SEQ ID NO.1: The optimized amino acid sequence of the human P4H fusion gene is shown in SEQ ID NO.2: Example 2: Codon optimization and synthesis of the full-length human type III collagen encoding gene The complete coding sequence of human type III collagen α1 chain, COL3A1 (accession number NP_000081.2), was retrieved from the NCBI database. Based on the codon bias of the silkworm genome, the sequence of this open reading frame was optimized, and the optimized COL3A1 sequence was synthesized by Shanghai Sangon Biotech Co., Ltd. and cloned into the pUC57 plasmid.

[0027] The optimized nucleotide sequence of full-length human type III collagen is shown in SEQ ID NO.3: The optimized amino acid sequence of full-length human type III collagen is shown in SEQ ID NO.4: Example 3 Construction of transgenic plasmids The vector used in this embodiment is pXL-BacII-IE1-EGFP / DsRed2-FibH-P (based on the commercial plasmid pBac-IE1-EGFP / DsRed2, pXL-BacII-IE1-EGFP / DsRed2 was constructed by adding FibH-P, NTD, 3×Flag tag sequence, and CTD sequence using conventional techniques in the art). It is derived from... piggyBac Transposon. This vector contains the silkworm fibroin heavy chain gene promoter FibH-P, the N-terminal domain (NTD) of the fibroin heavy chain protein, and the C-terminal domain (CTD) of the fibroin heavy chain protein.

[0028] Primers FH-P4H_F and FH-P4H_R, containing homologous arm sequences, were designed for the human P4H fusion gene. The nucleotide sequences are shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively. The target fragment of the human P4H fusion gene was amplified from the pUC57 plasmid containing the gene sequence synthesized in Example 1. Primers FH-COL_F and FH-COL_R, containing homologous arm sequences, were designed for the full-length human type III collagen. The nucleotide sequences are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively. The target fragment of the full-length human type III collagen was amplified from the pUC57 plasmid containing the gene sequence synthesized in Example 2.

[0029] FH-P4H_F:GAAAACCCAGGACCTTCGCGAATGATCTGGTACATCCTGATCATCG FH-P4H_R:TCCGTAACTGACGCTTCGCGATTACTTATCGTCGTCATCCTTGTAATCGATC FH-COL_F:GAAAACCCAGGACCTTCGCGAATGATGTCATTCGTACAGAAGGGC FH-COL_R:GTCATCCTTGTAATCTCGCGATAAAAAGCACACGGGCCCG The pXL-BacII-IE1-EGFP / DsRed2-FibH-P vector was linearized using the restriction endonuclease Nru I, and the linearized vector was purified using a gel extraction kit. The human P4H fusion gene or a full-length human type III collagen fragment was inserted into the cloning site between the NTD and Flag tags using homologous recombinase. The ligation product was transformed into competent *E. coli* cells, and single colonies were picked for sequencing verification, thus constructing the FH-P4H transgenic plasmid (pBac-IE1-EGFP-FibH-NTD-P4H-Flag-CTD) and the FH-COL transgenic plasmid (pBac-IE1-DsRed2-FibH-NTD-COL3A1-Flag-CTD). A schematic diagram of the transgenic plasmid structure is shown below. Figure 1 and Figure 2 .

[0030] Example 4: Establishment of Transgenic Silkworm Lines In this embodiment, the helper plasmid expressing the transposase was the pBac-A3-TP recombinant plasmid, constructed from the silkworm actin5C gene promoter sequence and the transposase gene sequence derived from the white-spotted armyworm. Diapause eggs from the bipolar strain Qiufeng were selected, immediately acid-treated, and then placed in a low-temperature incubator in the dark for 30 days to induce larval development. The larvae were fed fresh mulberry leaves until adulthood. Non-diapause eggs laid by mating female moths were used for genetic manipulation. Within 8 hours of the female moths laying non-diapause eggs, the FH-P4H or FH-COL transgenic plasmid obtained in Example 3 and the helper plasmid were mixed at a mass ratio of 1:1 and injected into silkworm embryos using a microinjection apparatus. The injected silkworm eggs were then allowed to develop at room temperature. The hatched G0 generation silkworm larvae were collected and reared at 25 ± 1℃ and 60-80% relative humidity until adulthood. G1 generation silkworm eggs were then obtained through self-pollination or hybridization with wild-type silkworms. During the silkworm egg development to the greening stage, G1 generation positive transformants with fluorescent markers are screened using stereofluorescence microscopy to obtain transgenic silkworm strains expressing human P4H or recombinant full-length human type III collagen.

[0031] Example 5: Obtaining a double-positive strain co-expressing human P4H and recombinant full-length human type III collagen through binary hybridization. Using the FH-P4H strain carrying the green fluorescent marker (EGFP) obtained in Example 4 as the first parent and the FH-COL strain carrying the red fluorescent marker (DsRed2) obtained in Example 4 as the second parent, genetic hybridization was performed, see [link to details]. Figure 3 .

[0032] Hybrid offspring silkworm eggs were collected, and after hatching into ant-like silkworms, double-positive individuals exhibiting both green and red fluorescence were screened using a stereofluorescence microscope at excitation wavelengths of 480 nm and 554 nm, respectively. This yielded the double-positive strain FH-P4H / COL, which co-expresses human P4H and recombinant full-length human type III collagen.

[0033] Example 6: Quantitative and Purification Analysis of Recombinant Full-Length Human Type III Collagen FH-COL silkworm cocoons were cut into small pieces, and 1 g of cocoon pieces were weighed and added to 50 mL of 9 M lithium bromide solution to extract silk protein from the cocoons (dissolved in a shaker at 28℃ for 4 h). Dialysis with PBS buffer was performed, repeated 3-5 times to remove lithium bromide. A standard curve was plotted using recombinant human type III collagen peptide standards for protein quantification analysis. The calculated content of recombinant full-length human type III collagen in 1 gram of transgenic silkworm cocoon shell was 7.73 ± 0.61 mg (n = 3). Data are expressed as mean ± standard deviation. The standard deviation was calculated using the sample standard deviation formula. See [link to sample standard deviation formula]. Figure 4 Protein purification was performed using flag-tagged magnetic beads to obtain recombinant full-length human type III collagen (rhCOLⅢ). SDS-PAGE and Western blot analysis revealed a single band at approximately 180 kDa (see [link to SDS-PAGE]). Figure 5 ).

[0034] Example 7: Hydroxylation level and triple helix structure analysis of recombinant full-length human type III collagen modified with human P4H in double-positive strains. Proteins from FH-P4H / COL double-positive silkworm cocoons were purified according to the method in Example 6 to obtain recombinant full-length human type III collagen (rhCOLⅢ-Hyp) modified with human P4H. Amino acid type analysis of the peptides of rhCOLⅢ and rhCOLⅢ-Hyp was performed using LC-MS / MS. The results showed that 106 potential proline (Pro) modification sites located at the Y position of the (GXY)n repeat unit were identified in the triple helix region (aa 169-1196). Only 16 sites (15.09%) of rhCOLⅢ showed hydroxylation modification, while 91 sites (85.85%) of rhCOLⅢ-Hyp showed hydroxylation modification, significantly increasing the proline hydroxylation modification rate by 70.7%. p <0.001, χ 2 = 98.46, df = 1, chi-square test (R language 4.0.5), see Figure 6Subsequently, the secondary structure of rhCOLⅢ-Hyp was further analyzed using circular dichroism spectroscopy and FTIR. Circular dichroism spectroscopy results showed that rhCOLⅢ-Hyp had a higher abundance positive peak in the 220-225 nm range; FTIR spectroscopy showed that rhCOLⅢ-Hyp... A 1235 / A 1450 The ratio reached 0.993 ± 0.001, indicating that rhCOLⅢ-Hyp has a distinct triple-helix active structure (see...). Figure 7 ).

[0035] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications and improvements made by those skilled in the art without departing from the spirit of the present invention should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for constructing a transgenic silkworm strain with improved triple helix structure of recombinant full-length human collagen type III using a two-hybrid strategy, characterized by, The transgenic silkworm strain was obtained through a binary hybridization strategy, including the following steps: Step 1, Preparation of parent strains: Provides first-parent silkworm strains and second-parent silkworm strains; The first parent silkworm strain is a transgenic silkworm strain that expresses human prolyl 4-hydroxylase hP4H and carries the first fluorescent marker gene, specifically co-expressing hP4H α and β subunits in the posterior silk gland of the silkworm. The second parent silkworm strain is a transgenic silkworm strain that expresses recombinant full-length human type III collagen and carries a second fluorescent marker gene that is different from the first fluorescent marker. It specifically expresses recombinant full-length human type III collagen in the posterior silk gland of the silkworm. Step 2, Parental Seed Production and Hybridization: Virgin female moths of the first parent silkworm line and male moths of the second parent silkworm line, or male moths of the first parent silkworm line and virgin female moths of the second parent silkworm line, were selected for directional single-pair mating. This allowed the genetic information of the parents carrying exogenous expression elements to be integrated into the same offspring through sexual reproduction. After the female moths laid eggs, hybrid F1 generation silkworm eggs were obtained. Step 3, screening of double-positive hybrid offspring: After the F1 generation silkworm eggs obtained in step 2 were hatched into ant-like silkworms, each silkworm was screened individually using a fluorescence stereomicroscope to select double-positive individuals that simultaneously expressed the first and second fluorescent markers; that is, the double-positive individuals were the target transgenic silkworm strains that simultaneously integrated the P4H expression element and the full-length human type III collagen expression element.

2. The method for increasing the proportion of triple helix structure in recombinant full-length human type III collagen according to claim 1, characterized in that, The transgenic silkworm strain expressing human prolyl 4-hydroxylase was obtained through genetic transformation of silkworms using a transgenic plasmid expressing human prolyl 4-hydroxylase hP4H.

3. The method for increasing the proportion of triple helix structure in recombinant full-length human type III collagen according to claim 2, characterized in that, The transplasmid expressing human prolyl 4-hydroxylase comprises a gene coding for human prolyl 4-hydroxylase, a Bombyx mori silk fibroin heavy chain gene (BmFib-H) FibH ) promoter and terminator sequences, and a fluorescent marker gene expression element.

4. The method for increasing the proportion of triple helix structure in recombinant full-length human type III collagen according to claim 3, characterized in that, The nucleotide sequence of the encoding gene for the human prolyl 4-hydroxylase is shown in SEQ ID NO.

1.

5. The method for increasing the proportion of triple helix structure in recombinant full-length human type III collagen according to claim 1, characterized in that, The transgenic silkworm strain expressing recombinant full-length human type III collagen was obtained by genetic transformation of silkworms using the transgenic plasmid expressing recombinant full-length human type III collagen.

6. The method for increasing the proportion of triple helix structure in recombinant full-length human type III collagen according to claim 5, characterized in that, The transgenic plasmid expressing recombinant full-length human type III collagen contains the gene encoding the aforementioned recombinant full-length human type III collagen and the silk fibroin heavy chain gene (…). FibH Promoter and terminator sequences, as well as fluorescently labeled gene expression elements.

7. The method for increasing the proportion of triple helix structure in recombinant full-length human type III collagen according to claim 6, characterized in that, The nucleotide sequence of the recombinant full-length human type III collagen is shown in SEQ ID NO.

3. The amino acid sequence encoded by this sequence is derived from the full-length coding sequence of human collagen alpha-1(Ⅲ) chain preproprotein (accession number NP_000081.2).

8. The method for increasing the proportion of triple helix structure in recombinant full-length human type III collagen according to claim 1, characterized in that, The specific operation of the targeted single-pair mating in step 2 is as follows: place the virgin female moths that have not yet mated after emergence into a mating container, introduce a single target male moth, and mate for 4-6 hours under the conditions of 25±1℃ and relative humidity of 60-80%. Then, transfer the female moths to oviposition paper to lay eggs. The screening of double-positive individuals in step 3 further includes self-crossing and propagation of the selected double-positive individuals to verify the stable heritability of the two gene loci.

9. The method for increasing the proportion of triple helix structure in recombinant full-length human type III collagen according to claim 1, characterized in that, The first fluorescent label is enhanced green fluorescent protein EGFP, and the second fluorescent label is red fluorescent protein DsRed2. The screening in step 3 involves sequentially examining the same ant and silkworm at an excitation wavelength of 480 nm for EGFP and 554 nm for DsRed2, with individuals exhibiting both green and red fluorescence being identified as double-positive individuals.

10. The application of the transgenic silkworm strain constructed based on the construction method of any one of claims 1-9 in the production of recombinant full-length human type III collagen containing a triple helix structure.

Images