Use of specific molecular targets for burkholderia cenocepacia coconut palm pathovar

Abstract

This invention relates to the field of microbial testing technology, specifically to the application of a specific molecular target for *Burkholderia gladioli* cocovenenans pathogenic species. The specific molecular target for *Burkholderia gladioli* cocovenenans pathogenic species is used to detect *Burkholderia gladioli* cocovenenans pathogenic species. The nucleotide sequence of the specific molecular target for *Burkholderia gladioli* cocovenenans pathogenic species is shown in SEQ ID No. 1 or SEQ ID No. 2. In specificity evaluation, the specific molecular target for *Burkholderia gladioli* cocovenenans pathogenic species exhibits greater coverage of both target and non-target bacteria, enhancing reliability and accuracy.

Description

Technical Field

[0001] This invention relates to the field of microbial testing technology, specifically to the application of specific molecular targets of Burkholderia gladioli, a pathogenic species of cocovenenans. Background Technology

[0002] Gladiolus Burkholderia ( Burkholderia gladioli (This is a group of Gram-negative bacteria widely distributed in air, soil, and water environments.) Among them, Burkholderia gladioli, a species known for its cocovenenogenic pathogens (…), is… B. gladioli pv. cocovenenans This species, known domestically as *Burkholderia cocovenenans* subsp. *farinofermentans*, is a pathogen that can cause severe food poisoning, significantly more so than common foodborne pathogens such as Salmonella and Staphylococcus aureus. Therefore, it is crucial to achieve effective control of *Burkholderia gladioli* subsp. *farinofermentans*. B. gladioli pv. cocovenenans The accurate and sensitive identification of this bacterium is of great practical significance for effectively preventing food poisoning incidents caused by this bacterium and ensuring food safety.

[0003] Currently, the pathogenic species of Burkholderia gladioli (cocovenenans) are being targeted. B. gladioli pv. cocovenenans The detection technologies for microorganisms mainly include traditional culture methods, immunoassay methods, molecular biological detection methods, and mass spectrometry detection methods. Among them, molecular detection methods based on PCR technology have gradually become one of the most promising new detection technologies in the field of microbial detection due to their advantages of speed, accuracy, and ease of operation.

[0004] Specific molecular detection targets are a core element in ensuring the specificity and sensitivity of molecular biology detection methods. Currently, specific targets are needed for the pathogenic species of *Burkholderia gladioli* (cocovenenans). B. gladioli pv. cocovenenans For one-step PCR detection, the available molecular targets and matching primers are very limited, with commonly used targets restricted to 16S rRNA, 23S rRNA, and the 16S-23S rRNA region. These gene sequences show extremely high homology across different subtypes within the same bacterial species, and even in other species of the Burkholderia genus, effective differentiation using these conserved genes is difficult. It is known that the bongkrekic acid biosynthesis gene cluster contains… bonM Genes can serve as single detection targets for the detection of this pathogen. However, current research in this area is still insufficient. bonM Genes themselves exhibit diversity due to sequence variations. Relying solely on a positive gene test is insufficient to accurately determine whether the tested strain possesses the ability to synthesize bongkrekic acid toxin. Its specificity and sensitivity are both insufficient to meet the needs of practical rapid detection. Summary of the Invention

[0005] Based on this, the present invention provides the application of a specific molecular target of Burkholderia gladioli, which is a pathogenic species of cocovenenans, and solves at least one problem in the prior art.

[0006] In a first aspect, the present invention provides the application of a specific molecular target of *Burkholderia gladioli* cocovenenans pathogenic species, wherein the specific molecular target of *Burkholderia gladioli* cocovenenans pathogenic species is used to detect *Burkholderia gladioli* cocovenenans pathogenic species, and the nucleotide sequence of the specific molecular target of *Burkholderia gladioli* cocovenenans pathogenic species is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0007] In this invention, the specific molecular target of *Burkholderia gladioli* cocovenenans pathogenic species achieves 100% coverage of the target bacterium's genes and 0% coverage of non-target bacteria. The Latin name of *Burkholderia gladioli* cocovenenans pathogenic species is... B. gladioli pv. Cocovenenans

[0008] Understandably, the application described is for purposes other than disease diagnosis and treatment.

[0009] Secondly, the present invention provides a primer set for detecting the cocovenant pathogenic species of Burkholderia gladioli, comprising primers as shown in SEQ ID No. 3 and SEQ ID No. 4, or primers as shown in SEQ ID No. 7 and SEQ ID No. 8; wherein the primers as shown in SEQ ID No. 3 and SEQ ID No. 4 target specific molecular targets of the nucleotide sequence shown in SEQ ID No. 1, and the primers as shown in SEQ ID No. 7 and SEQ ID No. 8 target specific molecular targets of the nucleotide sequence shown in SEQ ID No. 2.

[0010] Among them, SEQ ID No. 3 is AAACCACCCGCAACCTGAT, SEQ ID No. 4 is GAAACGCAACACCTCCTCCA, SEQ ID No. 7 is GACCGCCTTCTTCTCCCTGC, and SEQ ID No. 8 is TGGATGATCGCGTGATTCGT.

[0011] In some optional embodiments, the primer set for detecting the cocovenant pathogenic species of Burkholderia gladioli includes primers as shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 7 and SEQ ID No. 8.

[0012] Thirdly, the present invention provides the application of the primer set for detecting the pathogenic species of Burkholderia gladioli in the preparation of products for detecting the pathogenic species of Burkholderia gladioli cocovenenans.

[0013] Fourthly, the present invention provides a product for detecting the cocovenenogenic strain of Burkholderia gladioli, comprising the primer set for detecting the cocovenenogenic strain of Burkholderia gladioli.

[0014] In some optional embodiments, the product for detecting the pathogenic species of Burkholderia gladioli also includes a probe.

[0015] In some optional embodiments, the product for detecting Burkholderia gladioli cocovenenans includes primers as shown in SEQ ID No. 3 and SEQ ID No. 4, and probes as shown in SEQ ID No. 5 and SEQ ID No. 6.

[0016] Among them, SEQ ID No. 5 is FITC-AAACCACCCGCAACCTGAT, and SEQ ID No. 6 is Biotin-GAAACGCAACACCTCCTCCA.

[0017] In some optional embodiments, the product for detecting Burkholderia gladioli cocovenenans includes primers as shown in SEQ ID No. 7 and SEQ ID No. 8, and probes as shown in SEQ ID No. 9 and SEQ ID No. 10.

[0018] Among them, SEQ ID No. 9 is FITC-GACCGCCTTCTTCTCCCTGC, and SEQ ID No. 10 is Biotin-TGGATGATCGCGTGATTCGT.

[0019] In some alternative embodiments, the product is a test kit.

[0020] Fifthly, the present invention provides a method for detecting the pathogenic species of Burkholderia gladioli, comprising the following steps: The primer set described above for detecting the pathogenic species of Burkholderia gladioli was used to amplify the genomic DNA of the test sample to obtain the amplification product; The presence of Burkholderia gladioli, a pathogenic species of cocovenenans, in the test sample is determined based on the amplification products.

[0021] In some optional embodiments, the amplification is PCR amplification, and the amplification products are subjected to gel electrophoresis to determine whether the sample contains Burkholderia gladioli cocoviride pathogenic species based on the presence or absence of the target band.

[0022] In some optional embodiments, the amplification is PCR amplification, and the amplification product is mixed with a diluent containing Au@PDA chromogenic probe, dropped onto a test strip, and the presence of Burkholderia gladioli var. cocovenenans pathogenic species in the sample is determined based on whether the test strip shows color development; wherein, the test strip contains anti-Biotin antibody.

[0023] In some optional embodiments, the PCR amplification system includes: 10 μL of 2× Premix Taq reaction solution, 0.5 μL each of 10 μmol / L forward and reverse primers, 1 μL of template DNA, and ddH2O to bring the volume to 20 μL. The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 1 min; denaturation, annealing, and extension were performed for a total of 35 cycles; and finally, 72℃ extension for 5 min.

[0024] In some optional embodiments, the amplification is qPCR amplification, and the content of Burkholderia gladioli var. cocovenenans pathogenic species in the test sample is determined by comparing the fluorescence signal value of the amplification product with a standard curve.

[0025] In some optional embodiments, the qPCR amplification system is: 10 μL of 2× TB Green Premix reaction solution, 0.5 μL each of 10 μmol / L forward and reverse primers, 1 μL of template DNA, and sterile ddH2O to bring the volume to 20 μL; The qPCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s; 60℃ annealing for 45 s; and a total of 40 cycles of denaturation and annealing were performed.

[0026] Because of the adoption of the above technical solutions, the embodiments of the present invention have at least the following beneficial effects: (1) In the specificity evaluation of Burkholderia gladiolus cocovenenans pathogenic species specific molecular targets, the coverage of target bacteria and non-target bacteria is greater, which enhances the reliability and accuracy; (2) The method for detecting the pathogenic species of Burkholderia gladioli has improved the identification efficiency and enhanced the practicality. It also has the advantages of high specificity, simple operation, intuitive result judgment, short detection time and low cost. Attached Figure Description

[0027] Figure 1 The image shows the electrophoresis results of the specificity evaluation of the PCR detection method for Burkholderia gladioli (Burkholderia cocovenenans subsp. cocovenenans) in Example 3. In the image, A is the electrophoresis result of the specificity evaluation using primer set 1, and B is the electrophoresis result of the specificity evaluation using primer set 3.

[0028] Figure 2 The figures show the amplification and melting curves of Burkholderia gladioli (Burkholderia cocovenenans subsp. foie gras) qPCR quantitative detection method in Example 5. In the figure, A is the amplification curve and B is the melting curve.

[0029] Figure 3The figure shows the sensitivity evaluation results of the artificially spiked wet rice flour qPCR quantitative detection method for Burkholderia gladioli (Burkholderia cocovenenans subsp. cocovenenans) in Example 6. In the figure, A is the standard curve for quantitative detection using primer set 1, and B is the standard curve for quantitative detection using primer set 3.

[0030] Figure 4 The image shows the detection results of the test strip method for detecting Burkholderia gladioli (Burkholderia cocovenenans subsp. foie gras) in Example 7.

[0031] Figure 5 The graph shows the sensitivity evaluation results of the semi-quantitative detection method of artificially spiked wet rice flour test strips for *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) in Example 8. In the graph, A is the standard curve for detection using primer set 2, and B is the standard curve for detection using primer set 4. Detailed Implementation

[0032] The following will provide a clear and complete description of the concept and technical effects of the present invention, so as to fully explain the purpose, solution and effects of the present invention.

[0033] Example 1: Screening for specific molecular targets of Burkholderia gladioli (Burkholderia cocovenenans subsp. *farinofermentans*). Based on the whole genome DNA sequence of Burkholderia gladioli in the NCBI database, pan-genome analysis was performed; a specific gene fragment of Burkholderia gladioli (Burkholderia cocovenenans subsp. foie gras) was screened and obtained. The nucleotide sequence of this specific gene fragment is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0034] The specific molecular targets of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) obtained through screening were all derived from the whole genome of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*), with the corresponding genome version number CP033430.1. The gene loci corresponding to the specific molecular targets were determined using the BLAST tool on the NCBI website, as shown in Table 1 below.

[0035] Table 1. Specific molecular marker gene loci of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*). Example 2: PCR method for identifying Burkholderia gladioli (Polymorphosum cocovenenans subsp. *farinofermentans*). Design specific PCR amplification primers (including forward and reverse primers) based on SEQ ID No. 1 or SEQ ID No. 2. The sequences of primer sets 1 to 4 are shown in Table 2 below.

[0036] Table 2 Primer set for specific PCR detection Identify Burkholderia gladioli (Burkholderia cocovenenans subsp. oryzae) using the following steps: S1. DNA template preparation: The bacterial strains to be tested were enriched and cultured in LB liquid medium, and their bacterial genomic DNA was extracted using the ordinary boiling method as the templates to be tested. S2. PCR Amplification: Primer set 1 and primer set 3 from Example 2 were used to perform PCR amplification on the DNA of the sample to be tested. The PCR detection system was as follows: The PCR amplification procedure is as follows: S3: Perform gel electrophoresis on the PCR amplification products and observe whether there is a single amplification band at the position of the product size corresponding to each primer set. If it is present, it indicates that the sample contains the target Burkholderia gladioli (Burkholderia cocovenenans subsp. foetida). If no corresponding single amplification band appears, the sample does not contain the target Burkholderia gladioli (Burkholderia cocovenenans subsp. foetida).

[0037] Example 3: Specificity evaluation of the PCR detection method for Burkholderia gladioli (Burkholderia cocovenenans subsp. *farinofermentans*). Thirteen strains of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) and 27 strains of non-*Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) were collected and subjected to PCR detection according to the method in Example 2. Genomic DNA was extracted from each bacterium, and primers used for PCR amplification were primer set 1 and primer set 3 from Example 2, respectively. A blank control was set up, with the template being an aqueous solution containing no genomic DNA from any of the bacteria. The bacterial strains used and the detection results are shown in Table 3 below. In the table, "+" indicates positive and "-" indicates negative in the detection result column. * This indicates strains isolated from food samples from Guangzhou, Meizhou, and other locations in Guangdong Province.

[0038] Table 3. Results of molecular marker specificity evaluation of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*). PCR product electrophoresis results are as follows Figure 1 As shown, where, Figure 1 In the diagram, A represents the electrophoresis result of the PCR product from primer set 1. Figure 1 B in the figure represents the electrophoresis result of the PCR product of primer set 3; Figure 1 Numbers 1 to 13 represent 13 strains of Burkholderia gladioli (Burkholderia cocovenenans subsp. foetida); numbers 14 to 40 represent 27 non-target Burkholderia gladioli (Burkholderia cocovenenans subsp. foetida); M is the DL5000 DNA marker, C is the negative control, and P is the positive control.

[0039] Example 4: Comparison of specific molecular markers for *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) with existing molecular markers. The specific molecular markers (SEQ ID No. 1 or SEQ ID No. 2) from Example 1 and existing Burkholderia gladioli (Burkholderia cocovenenans subsp. oryzae) specific molecular markers were used. bonM Based on the comparison results of the local BLAST gene database (501 bacterial genome sequences downloaded from the NCBI website), it was found that the two molecular markers in Example 1 had a 100% coverage rate for the target bacterial genes and a 0% coverage rate for non-target bacteria genes. However, the existing technology (Lin Z, Wang S, Cai J, et al. Establishment of Three Rapid Visual Detection Methods for Burkholderia gladioli pv. cocovenenans Based on Body Temperature Amplification[J]. FoodScience, 2024, 45(9): 219-225.) reported... bonM The molecular markers achieved 100% coverage of the target bacteria genes and 6% coverage of the non-target bacteria genes, as shown in Table 4 below.

[0040] Table 4 Comparison of the specific molecular markers in Example 1 with existing specific molecular markers Therefore, it can be seen that the specific molecular marker in Example 1 has higher accuracy and better specificity, and can accurately identify Burkholderia gladioli (Burkholderia cocovenenans subsp. cocovenenans) in actual samples, which has obvious advantages compared with existing specific molecular markers.

[0041] Example 5: qPCR quantitative detection method for Burkholderia gladioli (Burkholderia cocovenenans subsp. *farinofermentans*). The DNA samples to be tested were amplified by qPCR using primer sets 1 and 3 from Example 2, respectively. The specific steps are as follows: S1. DNA template preparation: Burkholderia gladioli (Polymorphosum cocovenenans subsp. cocovenenans) strains were enriched in LB liquid medium, and bacterial genomic DNA was extracted using a DNA extraction kit to serve as the template for testing; a blank control was set up, and the template for the blank control was an aqueous solution without the genomic DNA of each bacterium; S2, qPCR amplification: Primer set 1 and primer set 3 were used to perform qPCR amplification on the DNA of the sample to be tested. The qPCR detection system was as follows: The qPCR amplification program is as follows: The qPCR amplification system was used on a Bio-Rad CFX96 quantitative PCR instrument, and the amplification results were analyzed using Bio-Rad CFXManager software to determine if they met expectations. If a fluorescence amplification curve and a corresponding melting curve were generated in the blank control (where no signal was observed), it indicates the presence of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*). If no signal was generated, the sample did not contain *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*).

[0042] Fluorescence amplification curves and corresponding melting curves are as follows: Figure 2 As shown, when the sample contains Burkholderia gladioli (Burkholderia cocovenenans subsp. *farinofermentans*), the qPCR systems established based on primer sets 1 and 3 respectively show a distinct fluorescence amplification curve. Figure 2 A in the figure and the corresponding dissolution curve ( Figure 2 The blank control (B) did not show fluorescence curves or melting curves.

[0043] Example 6: Sensitivity Evaluation of qPCR Quantitative Detection Method for Artificially Spiked Wet Rice Flour of Burkholderia gladioli (Burkholderia cocovenenans subsp. oryzae) After ultraviolet sterilization, the wet rice flour samples were prepared into sterile samples by adding physiological saline. This was done in accordance with GB 4789.29. 2020 Operating Procedures: Prepare a homogenized sample solution. Incubate until a concentration of 4.1 × 10⁻⁶ is achieved. 8 Spiked wet rice flour samples of Burkholderia gladioli (Burkholderia cocovenenans subsp.) isolates at CFU / mL were prepared using 0.85% physiological saline and serially diluted 10-fold to obtain a final concentration of 10. 8 ~10 1CFU / g spiked samples of the strain were subjected to DNA template extraction of all mixtures according to the method in Example 5, resulting in different dilutions of spiked samples of Burkholderia gladioli (Burkholderia cocovenenans subsp. granatum) DNA templates. Following the method in Example 5, 1 μL of each of the above-mentioned spiked samples at different dilutions was used for qPCR reactions based on primer sets 1 and 3, with each template subjected to three parallel experiments. Results were analyzed according to the method in Example 5.

[0044] The standard curve for the quantification of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) in spiked wet rice flour samples was plotted on the x-axis and the corresponding real-time Ct value of qPCR on the y-axis. The standard curve is shown below. Figure 3 As shown, the quantitative range for primer sets 1 and 3 is 10. 2 ~10 8 CFU / g, detection limit for all values ​​was 4.1×10⁻⁶. 2 The standard curves for CFU / g of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) were y = -3.7933x + 45.284 and y = -3.4422x + 45.37, respectively, with correlation coefficients R0. 2 The values ​​are 0.9982 and 0.9910, respectively.

[0045] Example 7: Test strip detection method for Burkholderia gladioli (Burkholderia cocovenenans subsp. farinofermentans). Using the 5' end modified primer sets 2 and 4 from Example 2, and following the method described in Example 2, sample DNA template was extracted and PCR amplified to obtain the amplification product. The amplification product was mixed with the premixed Au@PDA chromogenic probe dilution solution, and the entire mixture was added to the spotting area of ​​the test strip and incubated at 25°C for 15 min. The test strip system consisted of: detection line T modified with anti-Biotin antibody (concentration 0.8 mg / mL), control line C modified with goat anti-mouse secondary antibody (concentration 1.2 mg / mL), 2 μL of Au@PDA chromogenic probe modified with 1 mg / mL anti-FITC antibody, 50 μL of dilution solution, and 10 μL of PCR amplification product.

[0046] The test results were analyzed using a CG READER colloidal gold reader to determine if they met expectations. Under the premise that there was no signal on the test line T and a signal on the control line C of the blank control strip, if signals appeared on both the test line T and the control line C of the test strip, it indicated the presence of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*). If there was no signal on the test line T and a signal on the control line C of the test strip, then the sample did not contain *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*).

[0047] Test strip results as follows Figure 4 As shown, when the sample contains Burkholderia gladioli (Burkholderia cocovenenans subsp. cocovenenans), the test strip system based on primer set 2 and primer set 4 shows black bands on both the detection line T and the control line C, respectively. However, the blank control test strip does not show a black band on the detection line T, but does show a black band on the control line C.

[0048] Example 8: Sensitivity Evaluation of a Semi-Quantitative Detection Method for Artificially Spiked Wet Rice Flour Test Strips for Gladiolus Burkholderia (Burkholderia cocovenenans subsp. oryzae) Using 10 in Example 6 8 ~10 1 CFU / g of bacterial strain spiked samples were analyzed using primer sets 2 and 4 (5' end modified) from Example 2, and the sample DNA template was extracted and PCR amplified using the method described in Example 2. Amplification products were obtained, and each template was analyzed in triplicate. The test strip method was followed as described in Example 7. The detection limit standard for the test strip is: the ratio of the gray values ​​of the T line to the C line of the negative control sample plus three times the standard deviation; a positive result is defined as a T line to C line gray value ratio greater than that of the negative control.

[0049] The standard curve for quantifying *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) is calculated by plotting the logarithm of the concentration of the pure culture of the standard strain as the x-axis and the ratio of the gray values ​​of the corresponding T-line to C-line on the test strip as the y-axis. The standard curve is shown below. Figure 5 As shown, the semi-quantitative range for primer sets 2 and 4 is 10. 3 ~10 8 CFU / g, detection limit for all values ​​was 4.1×10⁻⁶. 3 The standard curves for CFU / g and *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) were y = 0.1874x - 0.4342 and y = 0.1934x - 0.3989, respectively, with correlation coefficients R0. 2 The values ​​are 0.9808 and 0.9238, respectively.

[0050] Example 9: Detection results of Burkholderia gladioli (Burkholderia cocovenenans subsp. *farinofermentans*) in actual samples Ten samples of wet rice noodles and ten samples of wood ear mushrooms were collected from a farmers' market in Nanchang County, Nanchang City, Jiangxi Province. The samples were processed under aseptic conditions in a biosafety cabinet, following the procedures outlined in GB 4789.29. The experiment was conducted in 2020, and genomic DNA was extracted from all actual samples, specifically following Example 2 for DNA template extraction. Finally, qPCR and test strip experiments were performed according to Examples 6 and 8, respectively. To ensure the accuracy of the results, one sample each of wet rice flour and wood ear mushroom samples were spiked with *Burkholderia gladioli* (a known strain of *Burkholderia cocovenenans*), following GB 4789.29. The 2020 operating procedures were used for verification.

[0051] The test results are shown in Table 5. In the table, "+" indicates a positive test result and "-" indicates a negative test result.

[0052] Table 5. Detection results of Burkholderia gladioli (Burkholderia cocovenenans subsp. cocovenenans) in actual samples Therefore, compared with the national standard method, in the 20 real food samples tested, the accuracy of detecting Burkholderia gladioli (Burkholderia cocovenenans subsp. cocovenenans) in the actual samples using the qPCR method of this embodiment was 100%, and the accuracy of the two positive control samples was also 100%.

[0053] In the above embodiments, the manufacturers and models of the reagents and materials used are shown in Table 6.

[0054] Table 6. Manufacturers and models of reagents and materials used. The above description is merely a preferred embodiment of the present invention. The present invention is not limited to the above-described embodiments. Any embodiment that achieves the technical effects of the present invention by the same or equivalent means should fall within the protection scope of the present invention. Within the protection scope of the present invention, various modifications and variations can be made to the technical solutions and / or implementation methods.

Claims

1. Use of a Burkholderia cenocepacia cocovorans pathovar specific molecular target characterized in that, The specific molecular target of *Burkholderia gladioli* cocovenenans is used to detect *Burkholderia gladioli* cocovenenans. The nucleotide sequence of the specific molecular target of *Burkholderia gladioli* cocovenenans is shown in SEQ ID No. 1 or SEQ ID No.

2.

2. A primer set for detecting the pathogenic species of Burkholderia gladioli, characterized in that, Includes primers as shown in SEQ ID No. 3 and SEQ ID No. 4, or primers as shown in SEQ ID No. 7 and SEQ ID No. 8; wherein the primers as shown in SEQ ID No. 3 and SEQ ID No. 4 target specific molecular targets of the nucleotide sequence shown in SEQ ID No. 1, and the primers as shown in SEQ ID No. 7 and SEQ ID No. 8 target specific molecular targets of the nucleotide sequence shown in SEQ ID No.

2.

3. The primer set for detecting the pathogenic species of Burkholderia gladioli according to claim 2, characterized in that, The primer set for detecting Burkholderia gladioli cocovenenans includes primers as shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 7 and SEQ ID No.

8.

4. The application of the primer set according to claim 2 for detecting the cocovenenogenic strain of Burkholderia gladioli in the preparation of products for detecting the cocovenenogenic strain of Burkholderia gladioli.

5. A product for detecting pathogenic species of Burkholderia gladioli, characterized in that, Includes the primer set for detecting the cocovenenogenic species of Burkholderia gladioli as described in claim 2.

6. The product for detecting the pathogenic species of Burkholderia gladioli according to claim 5, characterized in that, The product for detecting the pathogenic species of Burkholderia gladioli also includes probes.

7. The product for detecting the pathogenic species of Burkholderia gladioli according to claim 5, characterized in that, The product for detecting Burkholderia gladioli cocovenenans includes primers as shown in SEQ ID No. 3 and SEQ ID No. 4, and probes as shown in SEQ ID No. 5 and SEQ ID No.

6.

8. The product for detecting the pathogenic species of Burkholderia gladioli according to claim 5, characterized in that, The product for detecting Burkholderia gladioli cocovenenans includes primers as shown in SEQ ID No. 7 and SEQ ID No. 8, and probes as shown in SEQ ID No. 9 and SEQ ID No.

10.

9. The product for detecting the pathogenic species of *Burkholderia gladioli* according to claim 5, characterized in that, The product in question is a test kit.

10. A method for detecting the pathogenic species of Burkholderia gladioli, characterized in that, Includes the following steps: The primer set for detecting the cocovenant pathogenic species of Burkholderia gladioli, as described in claim 2, was used to amplify the genomic DNA of the test sample to obtain the amplification product. The presence of Burkholderia gladioli, a pathogenic species of cocovenenans, in the test sample is determined based on the amplification products.

Images