A strain of robbiella from the rain forest and its use

Abstract

The application discloses a Robbauera fungus derived from a rainforest and an application thereof, and relates to the technical field of microorganisms. Robbauera albescens The Robbauera fungus is named 1-F6 and has a preservation number of CGMCC No.42326, and has antibacterial property. The Robbauera fungus provided by the application has significant inhibitory activity on various plant pathogenic fungi, and exhibits good prevention and control activity. Meanwhile, metabolites produced by the Robbauera fungus under the condition of industrial culture medium have a high efficient lethal effect on nematodes. In addition, the Robbauera fungus also has the effect of promoting the growth of cowpea root systems.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a Robbaurera fungus originating from the rainforest and its applications. Background Technology

[0002] Plant diseases and nematodes are significant factors affecting the production of cash crops such as vegetables and fruits. For a long time, the cultivation of cash crops has relied excessively on chemical pesticides for control, which not only easily leads to pesticide resistance in pathogens and nematodes but also easily causes a series of problems such as pesticide residues in agricultural products and soil microecological imbalance. Therefore, developing biological control strains and using microorganisms for control has become a major direction in green pest control.

[0003] In the existing technology, the biological control microbial resources developed and applied still have many shortcomings that need to be addressed: First, the antibacterial spectrum of the strains is narrow, and most strains can only inhibit a single plant pathogen, which is difficult to meet the control needs of complex disease environments in the field and cannot achieve simultaneous control of multiple diseases; Second, most biological control microorganisms are only focused on the control of plant diseases, especially on economic legumes such as cowpeas, and there is a lack of excellent strains that have the dual effects of disease control and growth promotion and yield increase.

[0004] Therefore, to solve the above problems, the present invention provides a Robbaurera fungus originating from the rainforest and its applications. Summary of the Invention

[0005] The purpose of this invention is to provide a Robbaurera fungus derived from the rainforest and its applications, in order to solve the problems mentioned in the background art.

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution: A Robbaudaera fungus originating from the rainforest, wherein the Robbaudaera fungus is Robbauera albescens Named 1-F6, deposited on November 27, 2025, with accession number CGMCC No.42326, deposited at the China General Microbiological Culture Collection Center, located at No.3, No.1 Beichen West Road, Chaoyang District, Beijing.

[0007] More optimally, the Robbaureera fungi are effective against the cowpea wilt pathogen (… Fusarium oxysporum Phytophthora infestans ( Phytophthora vignae ), Dioscorea opposita ( Lasiodiplodia theobromae Passion fruit rot pathogen ( Diaporthe passifloricola ) and anthrax of the capsicum ( Colletotrichum capsici It has antibacterial properties; The Robbaauera fungi, based on metabolites produced by PDA medium, millet medium, and industrial medium, target Phytophthora palmis (… Phytophthora palmivora ), cowpea wilt pathogen ( Fusarium oxysporum Passion fruit rot pathogen ( Diaporthe passifloricola ) and Fusarium equisetifolium ( Fusarium equiseti It has antibacterial properties.

[0008] More optimally, the Robbaureera fungi inhibit the growth of Fusarium wilt in cowpea (… Fusarium oxysporum Phytophthora infestans ( Phytophthora vignae ), Dioscorea opposita ( Lasiodiplodia theobromae Passion fruit rot pathogen ( Diaporthe passifloricola ) and anthrax of the capsicum ( Colletotrichum capsici Applications of activity.

[0009] A more optimized method for preparing the inhibitory bacterial solution is as follows: Step 1: Mix the air-dried Bawangling soil sample with sterile water, shake at room temperature for 20-40 minutes to obtain a suspension; Step 2: Dilute the suspension with sterile water to obtain a diluted solution, spread it on PDA medium, and incubate for 3-5 days; Step 3: Pick a single colony and add it to PDB medium. Shake and incubate for 4-6 days to obtain a bacterial solution with inhibited activity.

[0010] The mass ratio of the air-dried Bawangling soil sample to sterile water is (1~1.5):(10~15); the concentration of the diluent is 10. -1 10 -2 10 -3 .

[0011] The application of a Robbaurera fungus derived from the rainforest, whose metabolites inhibit Phytophthora palmatum (…). Phytophthora palmivora ), cowpea wilt pathogen ( Fusarium oxysporum Passion fruit rot pathogen ( Diaporthe passifloricola ) and Fusarium equisetifolium ( Fusarium equiseti Applications of activity.

[0012] Application of a Robbaudaera fungus derived from the rainforest for the control of plant nematodes.

[0013] The application of a Robbaurera fungus derived from the rainforest, which inhibits cowpea wilt pathogens while promoting cowpea root growth.

[0014] Compared with the prior art, the beneficial effects achieved by the present invention are: This invention provides a broad-spectrum, highly effective biocontrol strain of Robbaurera fungus 1-F6 that also promotes growth. This strain exhibits significant inhibitory activity against various plant pathogens, including Phytophthora indicum, Fusarium wilt of cowpea, Diplostomum cocovenenans, passion fruit rot pathogen, and Anthracnose of pepper. The inhibition rate against Phytophthora indicum reaches 92.08±4.59%, demonstrating excellent control activity. Furthermore, the metabolites produced by the fermentation of this strain under industrial culture conditions have a highly lethal effect on nematodes, with a nematode mortality rate of up to 94.80%. Moreover, its fermentation process can be adapted to low-cost industrial culture media. This reduces the difficulty and cost of large-scale production. In addition, in the application of cowpea disease control, this strain has both disease control and growth promotion effects. When 1-F6 is co-treated with pathogens, the cowpea wilt disease index can be reduced from 63.24% to 7.29%, with a control effect of 88.47%, significantly reducing the severity of the disease. At the same time, strain 1-F6 can also increase the chlorophyll content of cowpea leaves, promote root elongation and plant growth, maintain plant vigor, and has both control and growth promotion effects. Attached Figure Description

[0015] Figure 1 The colony morphology diagrams of Robbaureera fungi 1-F6 provided by this invention; Figure 2 This is a phylogenetic tree diagram of Robbaureera fungi 1-F6 based on ITS sequences provided by the present invention; Figure 3 The antibacterial effects of Robbaureera fungi 1-F6 provided by this invention against different pathogens are shown in the figure. Figure 4 The diagram shows the antibacterial effects of the metabolites produced by Robbaauera fungi 1-F6 on PDB, industrial, and millet culture media provided by this invention against different pathogens. Figure 5 High-performance liquid chromatography (HPLC) spectra of metabolites produced by Robbaureera fungi 1-F6 on PDB medium, as provided by this invention; Figure 6 High-performance liquid chromatography (HPLC) spectra of metabolites produced by Robbaureera fungi 1-F6 on industrial culture media, as provided by this invention; Figure 7 High-performance liquid chromatography (HPLC) spectra of metabolites produced by Robbaureera fungi 1-F6 on millet culture medium, as provided by this invention; Figure 8 The diagram shows the effect of Robbaureera fungi 1-F6 provided by this invention on cowpea root growth; Figure 9This is a comparison chart of the growth of potted cowpea plants under different treatment conditions in this invention. Detailed Implementation

[0016] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] It should be noted that there are no special restrictions on the suppliers of the raw materials involved in this invention; exemplarily, they include: PDA medium: 200g potato, 20g glucose, 16g agar; PDB medium: 200g potato, 20g glucose, 1000mL distilled water, pH=7.0; Industrial culture medium: 25g corn flour, 25g wheat bran, 50mL distilled water; Millet culture medium: 100g millet, 100mL distilled water; ddH2O is double-distilled water, which is highly purified water that has undergone two distillation processes.

[0018] Implementation Process 1: Screening and purification of Robbaureera fungi 1-F6, including the following steps: Step 1: Add 10g of air-dried Bawangling soil sample to 90mL of sterile water, shake at room temperature for 30 minutes to obtain a suspension; Step 2: Drain the suspension in sterile water to obtain 10 -1 10 -2 10 -3 Dilute the suspension by multiples; pipette 100 μL of each 10-fold dilution. -1 10 -2 10 -3 The diluted suspension was spread onto PDA medium and incubated for 4 days. Step 3: Select a single colony, purify it for 3 generations, then add it to PDB medium and incubate for 5 days to obtain a bacterial solution that inhibits plant pathogens; namely, Robbaureera fungus 1-F6.

[0019] Implementation Process 2: Morphological identification of Robbaureera fungi 1-F6: Robbaureera strain 1-F6, after activation and culture, was picked up with an inoculation loop and inoculated into the center of a PDA medium plate. The plate was then sealed with sealing film, inverted and placed in a 28°C incubator for static culture for 5 days. The colony morphology of strain 1-F6 was observed with the naked eye. The results are as followsFigure 1 As shown: Robbaureera fungi 1-F6 form circular colonies on PDA medium, exhibiting distinct partitions; the central area of ​​the colony is dense, dark brown, and firm; gradually transitioning outwards to grayish-white velvety hyphae, which are sparse and fluffy, growing radially towards the edge of the plate, with irregular colony edges, consistent with the characteristics of Robbaureera strains.

[0020] Implementation Process 3: Molecular biological identification of Robbaureera fungi 1-F6: The HyperMB fungal genome PCR direct amplification kit from Sangon Biotech was used, with fungal primers ITS1 / ITS4 for amplification. The PCR reaction volume was 50 μL, 25 μL of 2×Es Taq MasterMix (Dye), 2 μL of DNA template, 1.5 μL each of forward and reverse primers, and 20 μL of ddH2O. The amplification program was 94℃ pre-denaturation for 3 min, 94℃ denaturation for 45 s, 58℃ annealing for 45 s, 72℃ extension for 1 min, 35 cycles, and a final extension at 72℃ for 10 min. The amplified sequences were sent to Sangon Biotech Shanghai for sequencing. The obtained sequences were compared with those from NCBI, and sequences with high homology were downloaded and a phylogenetic tree was constructed using MEGA 11.0 with the nearest neighbor method to determine the species of the strain. Among them, ITS1 is as shown in SEQ ID NO.1: 5'-TCCGTAGGTGAACCTGCGG-3'; ITS4 is shown in SEQ ID NO.2: 5'-TCCTCCGCTTATTGATATGC-3'; The sequence obtained from the identification of strain 1-F6 is shown in SEQ ID NO.3: GGCCAGAGCATTGAATATGGTTTTCCGACGGGGCTGTAAGCAGACCAAGCAACCGAGTCCGGCCAGCAGGGGCGCACCCACAAGTGGGCTTGCCTCGCTGTCCTCAGCGAATGACTTATCACGCTGAGTGGAACCGGTTACAGGAAGGTC CAGCTAATGCATTTGGGGTGAGCCATACAAGATGGCAGGGCACCCACATCCAAACCCAAGCCCAGGCTTTTGTTTCAAAACCTGAGGGGTTTGAGGGATTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCGTGCGT TCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGGGAGAACCAAGAGATCCGTTGTCGAAAGTTGTGTTAGTTCTGCCAAAAAGGCAAGTATACACTGACATCCATATACT CAGGGTATGTGAAGATAGGCAGCAGAGGGAGCTCTATTACAAGCCCACCACCGGGTCACAGGTGTGTGTGGAAAGTGAAGGTTTTGGGGGCCACAGAGTGGCTACCCCGGTGATTCACTAATGATCCTTCCGCGTTTCACCTACGGAAACC The results are as follows Figure 2 The results showed that strain 1-F6 clustered with multiple strains of the genus Robbaureera. Based on morphological characteristics, strain 1-F6 was identified as a fungus of the genus Robbaureera.

[0021] Implementation Process 4: Detection of antibacterial activity of Robbaureera fungi 1-F6, the specific steps are as follows: Step 1: Infect cowpeas with Fusarium wilt (Fungi monoxide) Fusarium oxysporum Phytophthora infestans ( Phytophthora vignae ), Dioscorea opposita ( Lasiodiplodia theobromae Passion fruit rot pathogen ( Diaporthe passifloricola ) and anthrax of the capsicum ( Colletotrichum capsici ) Pathogen bacterial cakes with a diameter of 6 mm were prepared and used as the CK control group; Step 2: Inoculate the pathogenic fungal discs into the center of PDA plates. Inoculate Robbaureera fungi 1-F6 on both sides of the pathogenic fungus, as the 1-F6 treatment group. Incubate upside down at 28℃ for 6 days. Each treatment group is repeated 3 times. Observe the inhibition zone and calculate the inhibition rate. Inhibition rate (%) = (Diameter of pathogen in control group - Diameter of pathogen in treatment group) / Diameter of pathogen in control group × 100%; The results are shown in Table 1 and... Figure 3 As shown, Robbaureera fungi 1-F6 exhibited the highest inhibition rate against Phytophthora vinifera, at (92.08±4.59)%, and the lowest inhibition rate against Fusarium wilt, at (61.50±5.00)%. The inhibition rates against Diplosporium cocovenenans, the pathogen causing passion fruit rot, and Anthracnose of pepper were (70.83±7.62)%, (73.75±1.44)%, and (76.25±6.29)%, respectively. This indicates that Robbaureera fungi 1-F6 possess broad-spectrum and significant antibacterial activity against these pathogens, with significant interspecies differences in inhibitory effects against different pathogens, and demonstrates a clear advantage in the control of Phytophthora vinifera.

[0022] Table 1

[0023] Note: a, b, and c in the table indicate significant differences in antibacterial effects against different pathogens (p < 0.05). Implementation Procedure 5: Detection of nematicidal activity of metabolites produced by Robbaureera fungi 1-F6 in different culture media. The specific steps are as follows: Step 1: Add strain 1 F6 was inoculated onto PDA plates and cultured at 28℃ for 5 days. Mycelial cakes were prepared using a 6mm diameter sterile punch and inoculated into PDB liquid medium. The cakes were then cultured at 28℃ and 160 rpm on a shaker for 3 days, yielding one genus of Robbaurera fungus. F6 seed solution; Step 2: 1 Robbaureera fungus F6 seed culture was inoculated into PDB medium, industrial medium and millet medium at a 5% inoculum and fermented at 28℃ for 28 days. The fermentation product was extracted with ethyl acetate, concentrated by rotary evaporation, and then methanol was added to prepare a methanol solution of metabolites with a mass concentration of 20 mg / mL. Step 3: Add 100 μL of the metabolite methanol solution to a 24-well cell culture plate, then add 900 μL of suspension containing approximately 100 second-instar nematodes. Mix thoroughly and treat at room temperature for 24 hours (treatment group). Each treatment group is repeated 3 times. The water treatment group (100 μL methanol + 900 μL water) serves as a blank control (control group). After treatment, collect the solution from each well and bring the volume to 8 mL with sterile water. Centrifuge at 2000 rpm for 2 min, discard the supernatant, and bring the volume to 8 mL again. Resuspend and let stand for at least 4 hours. Observe and count the number of dead nematodes under a dissecting microscope. The criteria for death are rigidity and lack of response to mechanical stimulation. Calculate the nematode mortality rate (%) using the following formula: Nematode mortality rate (%) = (Number of dead nematodes / Total number of tested nematodes) × 100%; Nematode corrected mortality rate (%) = (Nematode mortality rate in the treatment group - Nematode mortality rate in the control group) / (1 - Nematode mortality rate in the control group) The results are shown in Table 2. Different culture media significantly affected the nematicidal activity of the metabolites of Robbaureera fungi 1-F6. The metabolites produced by fermentation in industrial media exhibited the best lethality against nematodes, with a mortality rate of 94.80%. Metabolites obtained from fermentation in PDB and millet media showed lower nematicidal activity, with mortality rates of only 3.52% and 4.51%, respectively. These results indicate that industrial culture media can significantly induce Robbaureera fungi 1-F6 to synthesize metabolites with highly effective nematicidal activity.

[0024] Table 2

[0025] Implementation Procedure 6: Detection of the inhibitory effects of Robbaureera fungi 1-F6 on different pathogens based on metabolites produced in different culture media: Based on the antibacterial activity of the metabolites obtained in process 5 against various plant pathogens, the tested pathogen was Phytophthora palmatum (… Phytophthora palmivora ), cowpea wilt pathogen ( Fusarium oxysporum Passion fruit rot pathogen ( Diaporthe passifloricola ) and Fusarium equisetifolium ( Fusarium equiseti ); The specific method is as follows: the above-mentioned pathogenic bacteria are made into a fungal cake with a diameter of 6 mm, and then inoculated in the center of a PDA plate; equal amounts of metabolites are added at points equidistant from the center, and the plate is incubated at a constant temperature of 28℃ for 6 days. After the incubation period, the antibacterial ability is evaluated. The results are as follows Figure 4As shown, the metabolites produced by Robbaureera fungi 1-F6 on different culture media all exhibited certain antibacterial effects; among them, the metabolites produced by Robbaureera fungi 1-F6 on PDB, industrial, and millet culture media showed the greatest antibacterial effect against Phytophthora palmatum (…). Phytophthora palmivora The inhibitory effect on *Fusarium wiltii* (the causal agent of cowpea wilt) was most significant, with colony growth being significantly restricted and inhibition zones clearly visible; it also showed a strong inhibitory effect on *Fusarium wiltii* (the causal agent of cowpea wilt). Fusarium oxysporum ) and Fusarium equisetifolium ( Fusarium equiseti The growth of cowpea wilt pathogens (Fusarium wilt) was also inhibited to some extent, with metabolites in millet culture medium showing a certain inhibitory effect. Fusarium oxysporum The inhibition zone diameter is larger; while it is more effective against passion fruit rot pathogens ( Diaporthe passifloricola While its inhibitory effect on *Phytophthora palmatum* is relatively weak, it still exhibits some inhibitory effect. Therefore, the metabolites of *Robbauera* fungi 1-F6 have broad-spectrum antibacterial activity against a variety of plant pathogens, especially against *Phytophthora palmatum*. Phytophthora palmivora The inhibitory effect is outstanding.

[0026] Implementation Procedure 7: High-performance liquid chromatography analysis of metabolites of Robbaureera fungi 1-F6 based on different culture media: Metabolites produced by Robbaurera fungi 1-F6 in PDB, industrial, and millet culture media were added to methanol to prepare a 20 mg / mL methanol solution. The solution was filtered through a 0.22 μm ultrafiltration membrane and analyzed by high-performance liquid chromatography (HPLC). A 250 mm × 4.6 mm, 5 μm Agilent Zorbox SB C18 column was used with a gradient elution of ultrapure water as phase A and methanol as phase B. The gradient elution parameters were: 0–15 min, 10%–100% phase B; 15–20 min, 100% phase B; 20–25 min, 10% phase B; flow rate: 1.0 mL / min; column temperature: 25 °C; injection volume: 10 mL. The results are as follows Figure 5 As shown, among the metabolites of Robbaureera fungi 1-F6 in PDB medium, strain 1-F6 exhibited the highest number of chromatographic peaks and the strongest signal intensity, indicating that this medium can significantly induce the strain to synthesize high levels of secondary metabolites; for example... Figure 6 As shown, the number of chromatographic peaks of the bacterial strain's metabolites in the process culture medium is slightly less than that in PDB culture medium, but the number of chromatographic peaks is still relatively large, and some chromatographic peaks have high signal intensity; for example... Figure 7 As shown, under millet culture medium conditions, the strain exhibited fewer peaks and lower signal intensity for its metabolites, indicating a weak induction ability for the target active metabolites. These results are consistent with the assay results for the nematicidal activity of the metabolites.

[0027] Implementation Procedure 8: Potted Validation Experiment of Robbaureera Fungi 1-F6: The experimental treatments included: control group KB: treated with only water; experimental group F: treated with spores at a concentration of 10... 7 CFU / g of cowpea wilt pathogen; Experimental group R: spore concentration of 10 7 CFU / g strain 1-F6; experimental group R+F: spore concentration of 10 7 CFU / g of cowpea wilt pathogen and strain 1-F6; 3 potted cowpea plants per group, 3 plants per pot, 3 parallel experiments; All the above treatments involved root drenching with spore suspension, with a single pot dosage of 50 mL. Chlorophyll content in cowpea leaves was measured on days 7, 14, and 21 post-inoculation. Plants were harvested 21 days post-inoculation, and root weight, root length, and above-ground fresh weight were measured. Disease index and control efficacy were calculated using the following formula: Disease index = ∑(disease grade of each plant) / (total number of plants × highest disease grade) × 100%; Prevention and control effect = (Disease index of treatment F in experimental group - Disease index of treatment R + disease index of treatment F in experimental group) / Disease index of treatment F in experimental group × 100%; Table 3 shows the results of the effects of Robbauera fungus 1-F6 on chlorophyll content, growth indicators, and control of cowpea wilt disease. Data in the table are mean ± standard deviation. Regarding chlorophyll content, 7 days after inoculation, the R treatment had the highest chlorophyll content, significantly higher than the KB and R+F treatments. The F and R+F treatments were in the middle range, and the differences among treatments were not statistically significant, indicating that Robbauera fungus 1-F6 alone has a certain promoting effect on plant photosynthesis in the early stages of disease occurrence. 14 days after inoculation, the R+F treatment had the highest chlorophyll content among all treatments, significantly higher than the F treatment, but no significant difference from the KB and R treatments. The lower chlorophyll content compared to the other three treatments indicates that pathogen infection has significantly inhibited plant photosynthesis. The intervention of Robbaureera fungi 1-F6 in the R+F treatment effectively mitigated the negative impact of the pathogen on chlorophyll synthesis, restoring chlorophyll content to a level comparable to the healthy control. At 21 days post-inoculation, chlorophyll content in all treatments decreased to varying degrees compared to 14 days, with the R+F treatment maintaining the highest chlorophyll content and the F treatment the lowest. Furthermore, the R+F treatment showed significantly higher chlorophyll content than the other treatments. Therefore, Robbaureera fungi 1-F6 can significantly alleviate the inhibitory effect of the pathogen on chlorophyll content during the critical disease development period of 14-21 days. Regarding growth indicators, there were no significant differences in root weight and aboveground fresh weight among the treatment groups at 21 days after inoculation; however, the root length of the R+F treatment was 28.25±2.63cm, which was higher than that of the KB and F treatments, and significantly higher than that of the R treatment (21.00±2.65cm). This indicates that strains 1-F6 can alleviate the inhibition of cowpea root growth by cowpea wilt pathogens, but have no promoting effect on root length when applied alone.

[0028] Regarding the control efficacy against cowpea wilt, the disease index of the F treatment (inoculated only with the pathogen) was 63.24%, indicating severe cowpea wilt. In contrast, the R+F treatment had a disease index of only 7.29%, achieving a control efficacy of 88.47%, demonstrating significant control effectiveness. Therefore, Robbaureera fungi 1-F6 can significantly alleviate the inhibition of photosynthesis and root growth in cowpea by the pathogen, effectively reducing the disease index and exhibiting excellent control efficacy against cowpea wilt.

[0029] Table 3

[0030] Note: In the table, a, b, and ab indicate significant differences (p < 0.05) between different treatments on the same day. The effects of Robbauera fungi 1-F6 on cowpea root growth, such as Figure 8 As shown, in terms of root surface morphology, the KB treatment showed well-developed fibrous roots and abundant root hairs, with good overall growth; the F treatment showed significantly inhibited root growth, with shortened root length, a significant reduction in the number of lateral roots, and the weakest growth; the R treatment showed no obvious brown lesions, and the density and length of lateral roots were slightly lower than the KB treatment; the R+F treatment showed the best root growth, with significantly longer roots than other treatments, and more abundant and robust lateral roots and root hairs; in terms of root longitudinal section morphology, the F treatment showed obvious brown lesions starting from the bottom and spreading upwards, indicating that the pathogen had invaded the internal root tissue and caused disease; the R+F treatment showed that the internal tissue of the roots remained healthy and white, without lesions, indicating that Robbaureera fungi 1-F6 can effectively inhibit pathogen infection of the roots; in addition, as Figure 9 As shown, the growth of cowpea potted plants differed significantly under different treatment groups, indicating that Robbaureera fungi 1-F6 can inhibit plant pathogens and thus promote cowpea plant growth.

[0031] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.

Claims

1. A Robbaurera fungus originating from the rainforest, characterized by: The Robbaauera fungus is Robbauera albescens It is named 1-F6 and has the accession number CGMCC No.42326.

2. The Robbaurera fungus originating from the rainforest according to claim 1, characterized in that: The Robbaureera fungi are effective against cowpea wilt pathogens ( Fusarium oxysporum Phytophthora infestans ( Phytophthora vignae ), Dioscorea opposita ( Lasiodiplodia theobromae Passion fruit rot pathogen ( Diaporthe passifloricola ) and anthrax of the capsicum ( Colletotrichum capsici It has antibacterial properties; The Robbaauera fungi, based on metabolites produced by PDA medium, millet medium, and industrial medium, target Phytophthora palmis (… Phytophthora palmivora ), cowpea wilt pathogen ( Fusarium oxysporum Passion fruit rot pathogen ( Diaporthe passifloricola ) and Fusarium equisetifolium ( Fusarium equiseti It has antibacterial properties.

3. The application of a Robbaurera fungus derived from the rainforest according to claim 1, characterized in that: The Robbaureera fungi inhibit the growth of cowpea wilt pathogens ( Fusarium oxysporum Phytophthora infestans ( Phytophthora vignae ), Dioscorea opposita ( Lasiodiplodia theobromae Passion fruit rot pathogen ( Diaporthe passifloricola ) and anthrax of the capsicum ( Colletotrichum capsici Applications of activity.

4. The application of a Robbaurera fungus derived from the rainforest according to claim 1, characterized in that: The metabolites of the genus Robbaureera fungi inhibit Phytophthora palmatum ( Phytophthora palmivora ), cowpea wilt pathogen ( Fusarium oxysporum Passion fruit rot pathogen ( Diaporthe passifloricola ) and Fusarium equisetifolium ( Fusarium equiseti Applications of activity.

5. The application of a Robbaurera fungus derived from the rainforest according to claim 1, characterized in that: The application of Robbaurera fungi in the control of plant nematodes.

6. The application of a Robbaurera fungus derived from the rainforest according to claim 1, characterized in that: The application of Robbaurera fungi to inhibit cowpea wilt pathogens while promoting cowpea root growth.

Images