Mutant transglutaminases and their use in food products
By directing the evolution of wild-type transglutaminase, mutants with stronger heat resistance and iron ion tolerance were constructed, solving the problems of thermal stability and iron ion sensitivity of microbial enzymes in food processing and achieving more efficient food processing results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SICHUAN MEINING FOOD
- Filing Date
- 2026-06-08
- Publication Date
- 2026-07-07
AI Technical Summary
Existing wild-type glutamine transaminases derived from microorganisms have poor thermal stability in food processing and are sensitive to iron ions, affecting catalytic efficiency and product quality stability.
Wild-type glutamine transaminase was directed to evolve using error-prone PCR technology, resulting in mutants with higher enzyme activity, heat resistance, and iron tolerance. These mutants were then expressed using Bacillus subtilis SCK6 to prepare enzyme preparations for food processing.
It increased the enzyme activity of transglutaminase to 2.4 times that of the wild type, significantly enhanced its catalytic stability and iron ion tolerance under high temperature conditions, improved the gel strength, elasticity and water retention of food, and improved the sensory quality of the product.
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to glutamine transaminase mutants and their application in food. Background Technology
[0002] Transglutaminase (EC 2.3.2.13), also known as transglutaminase, is a class of enzymes that catalyze acyl transfer reactions between glutamine residues and various primary amines. It can bind to various protein substrates such as whey protein, soy protein, casein, and bovine myosin, catalyzing intermolecular or intramolecular cross-linking, thereby significantly improving the gelling, emulsifying, water-holding, and textural properties of proteins. Based on these properties, this enzyme has been widely used in the processing of protein-rich foods such as meat products, dairy products, and soy products to improve product quality, yield, and added value.
[0003] Transglutaminases (TGAs) are widely found in nature, originating from animals, plants, and microorganisms. Microbial TGAs, in particular, have become the mainstream for industrial applications due to their advantages such as low substrate specificity, low cost, and high yield. However, existing wild-type TGAs from microorganisms still have significant drawbacks in practical industrial applications. Poor thermal stability is the main bottleneck limiting their application efficiency. The optimal reaction temperature for most wild-type TGAs from microorganisms is approximately 50 °C. When the reaction temperature exceeds 55 °C, their enzyme activity rapidly declines, making them unsuitable for food processing techniques requiring medium to high temperatures, such as the heat treatment of meat products and extrusion cooking, common industrial processes.
[0004] More importantly, existing wild-type glutamine transaminases from microbial sources are less effective against common metal ions in food systems, especially naturally occurring iron ions (including Fe). 2+ and Fe 3+ It exhibits high sensitivity. Iron ions can specifically bind to the active site of wild-type transglutaminase, disrupting the enzyme's spatial conformation and leading to a significant decrease in its catalytic activity. Even low concentrations of iron ions can significantly inhibit its protein cross-linking function. This inhibitory effect severely impacts the catalytic efficiency and stability of wild-type transglutaminase in food processing, leading to problems such as increased dosage, unstable application effects, and fluctuations in product quality, thereby increasing food production costs and limiting the improvement of product performance.
[0005] In view of this, this invention is hereby proposed. Summary of the Invention
[0006] Based on the above problems, the purpose of this invention is to provide a glutamine transaminase mutant and its application in food. This mutant has higher activity, heat resistance, and iron ion tolerance, and can significantly improve the quality of products when used in food processing.
[0007] A first aspect of the present invention provides a glutamine transaminase mutant, the amino acid sequence of which is shown in SEQ ID NO.3.
[0008] A second aspect of the invention provides the encoding gene for the glutamine transaminase mutant as described above.
[0009] A third aspect of the invention provides a recombinant expression vector comprising the gene encoded as described above.
[0010] Preferably, the expression vector is plasmid pMA LipA.
[0011] A fourth aspect of the invention provides a recombinant strain comprising the recombinant expression vector described above.
[0012] Preferably, the host cell of the recombinant strain is Bacillus subtilis SCK6.
[0013] A fifth aspect of the invention provides an enzyme preparation comprising the glutamine transaminase mutant as described above.
[0014] Preferably, the enzyme preparation includes liquid and solid dosage forms.
[0015] The sixth aspect of the present invention provides the use of the glutamine transaminase mutant or enzyme preparation as described above in food.
[0016] Preferably, the food products include meat products, dairy products, and soy products.
[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention utilizes error-prone PCR technology to perform directed evolution of wild-type glutamine transaminase in vitro, resulting in a glutamine transaminase mutant with significantly enhanced enzyme activity and heat resistance. The enzyme activity of this mutant is approximately 2.4 times that of the wild-type glutamine transaminase.
[0018] The glutamine transaminase mutant provided by this invention also exhibits strong temperature / pH stability and iron ion tolerance, and can withstand salt concentrations up to 18%. When used in the preparation of protein-rich foods such as meat products, dairy products, and soy products, it not only maintains sufficient cross-linking activity under high-temperature heat processing conditions, making protein cross-linking reactions more compatible with high-temperature processes such as sterilization and ripening, but also effectively resists the presence of Fe in the food system. 2+ and Fe 3+The inhibitory effect of enzymes is maintained under normal or high iron ion content raw material conditions, and a high catalytic efficiency is maintained. A better protein cross-linking effect can be achieved with a lower amount of enzyme added, significantly improving the gel strength, elasticity, water retention and other properties of food, and enhancing the sensory quality of the final product. Detailed Implementation
[0019] The invention is further described below through specific embodiments. Unless otherwise specified, the technical means and materials involved in the following embodiments are all known to those skilled in the art, and suitable means and materials that can solve the corresponding technical problems can be selected. In addition, the embodiments should be understood as illustrative, not limiting the scope of the invention, and the essence and scope of the invention are defined only by the claims.
[0020] It should be understood that the scope of this invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to these embodiments that will be apparent to those skilled in the art or related fields without departing from the spirit and scope of this invention are covered within the scope of the appended claims.
[0021] It should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.
[0022] The markers for the glutamine transaminase mutants used in this invention are as follows: The amino acids in the glutamine transaminase mutant are represented by "amino acids that have been replaced at the original amino acid position". For example, D29K indicates that the amino acid at position 29 has been replaced by K from the parental glutamine transaminase, and the position number of the amino acid corresponds to the amino acid sequence number in SEQ ID NO.1.
[0023] This invention provides a glutamine transaminase mutant, the amino acid sequence of which is shown in SEQ ID NO.3.
[0024] This invention uses wild-type glutamine transaminase from Streptomyces as the parent, constructs a mutant library using error-prone PCR, then ligates the mutant gene into a vector to achieve gene expression in host cells, and subsequently screens for glutamine transaminase mutants with significantly enhanced enzyme activity and heat resistance. Sequencing revealed that the mutation sites of this glutamine transaminase mutant include: D29K, S152P, G208N, R213L, and A338P. Specifically, aspartic acid, serine, glycine, arginine, and alanine at positions 29, 152, 208, 213, and 338 are mutated to lysine, proline, asparagine, leucine, and proline, respectively. The enzyme activity of this mutant is approximately 2.4 times that of the wild-type glutamine transaminase.
[0025] The present invention further provides the coding gene of the glutamine transaminase mutant as described above, the nucleotide sequence of which is shown in SEQ ID NO.4.
[0026] This invention further provides a recombinant expression vector containing the coding gene as described above. The recombinant expression vector may include prokaryotic expression vectors, eukaryotic expression vectors, and other expression vectors. The vectors for prokaryotic expression vectors include the pHT series, pMA5 series, pHY series, pP43 series, pET series, and pGEX series, while the vectors for eukaryotic and other expression vectors include the pPIC series, pGAP series, pYES series, and pcDNA series. In a preferred embodiment, the recombinant expression vector is a prokaryotic expression vector, and the vector is the plasmid pMALipA.
[0027] This invention further provides a recombinant bacterial strain comprising the recombinant expression vector described above. The host cell for the recombinant bacterial strain is selected according to the type of the recombinant expression vector. For example, when the recombinant expression vector is a prokaryotic expression vector, a prokaryotic cell is selected as the host cell; common prokaryotic cells include Bacillus subtilis and Escherichia coli. When the recombinant expression vector is a eukaryotic expression vector or other expression vector, eukaryotic cells or plant cells can be selected as the host cell, including Pichia pastoris, Saccharomyces cerevisiae, filamentous fungi, and protoplast-transformed plant cells. In a preferred embodiment, the host cell of the recombinant bacterial strain is Bacillus subtilis, specifically Bacillus subtilis SCK6.
[0028] The present invention further provides an enzyme preparation containing the glutamine transaminase mutant as described above. The enzyme preparation includes liquid and solid dosage forms, and in addition to the glutamine transaminase mutant, may also contain auxiliary components such as buffers, stabilizers, and preservatives to ensure the quality and safety of the enzyme preparation during storage and use.
[0029] This invention further provides the application of the above-described glutamine transaminase mutant or enzyme preparation in food. The food includes protein-rich foods such as meat products, dairy products, and soy products. The mutant provided in this embodiment exhibits higher catalytic activity, superior thermal stability, and significantly enhanced iron ion tolerance. When used in the aforementioned food processing, it not only maintains sufficient cross-linking activity under high-temperature heat processing conditions, making protein cross-linking reactions more compatible with high-temperature processes such as sterilization and ripening, but also effectively resists the presence of Fe in the food system. 2+ and Fe 3+ The inhibitory effect of enzymes is maintained under normal or high iron ion content raw material conditions, and a high catalytic efficiency is maintained. A better protein cross-linking effect can be achieved with a lower amount of enzyme added, significantly improving the gel strength, elasticity, water retention and other properties of food, and enhancing the sensory quality of the final product.
[0030] To make the technical solution of the present invention clearer, the following detailed description of the glutamine transaminase mutant is provided through several specific embodiments.
[0031] The experimental reagents and their components involved in the embodiments of this invention include: LB liquid medium: yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L, pH 7.0.
[0032] LB solid medium: yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L, agar 15 g / L, pH 7.0.
[0033] Fermentation medium: glucose 5 g / L, yeast extract 20 g / L, tryptone 10 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, pH 7.0.
[0034] The indicators and their measurement methods involved in the embodiments of this invention include: (1) Enzymatic activity of glutamine transaminase The Folk method was used for determination. Specifically, 100 µL of bacterial culture supernatant and 1 mL of substrate solution were mixed and reacted precisely in a 37 ± 1 °C water bath for 10 min. Immediately after the reaction, 1 mL of colorimetric solution was added to terminate the reaction, and the mixture was centrifuged at 4000 r / min for 5 min to remove the precipitate. The OD value was measured at 525 nm using water as a control; this value represents the absorbance of the enzyme solution. The specific enzyme activity units were calculated using a standard curve. The OD values of different concentrations of L-glutamate-γ-monoisohydroxyoxime standard solutions were also measured. 525The values were calculated, and a standard curve was plotted. One unit of enzyme activity is defined as the amount of enzyme required to produce 1 µmol / min of isohydroxamic acid at 37 °C.
[0035] The reagent preparation methods involved in the above enzyme activity assays are as follows: Substrate solution: Accurately weigh 2.42 g Tris, 0.7 g hydroxylamine hydrochloride, 0.31 g reduced glutathione, and 1.01 g CBZ-Gln-Gly, dissolve in 80 mL of water, adjust the pH to 6.0 with hydrochloric acid, and bring the volume to 100 mL with water. The substrate solution should be refrigerated at 4 ℃ and is effective within one week.
[0036] Colorimetric solution: Dissolve 100 L of 3 M hydrochloric acid; dissolve 12 g of TCA in 100 mL of water; dissolve 5 g of ferric chloride hexahydrate in 100 mL of 0.1 M hydrochloric acid. Mix the three solutions in equal proportions to obtain the colorimetric solution, and store at 4 °C.
[0037] L-Glutamate-γ-monohydroxamic acid standard solution: Accurately weigh 64.8 mg of L-glutamate-γ-monohydroxamic acid and dissolve it in Tris-HCl (10 mL 0.2 mol / L, pH=6.0) buffer to prepare a 40 µmol / mL standard solution. Dilute it with Tris-HCl buffer to prepare standard solutions with concentrations of 8.0 µmol / mL, 16 µmol / mL, 20 µmol / mL, 24 µmol / mL, and 32 µmol / mL, respectively.
[0038] Example 1 Preparation of glutamine transaminase mutant 1.1 Obtain the wild-type glutamine transaminase gene and construct a recombinant plasmid. Using the wild-type glutamine transaminase TYQ1024 from *Streptomyces* as the parent, with the amino acid sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ ID NO.2, and referring to... pfu PCR amplification of the TYQ1024 gene was performed using DNA polymerase (purchased from Sangon Biotech (Shanghai) Co., Ltd.) according to the manufacturer's instructions, with annealing temperatures ranging from 57 to 64 °C. After detecting the PCR products by 1% agarose gel electrophoresis, the amplified fragments were recovered following the instructions of a DNA recovery kit.
[0039] Using restriction endonucleases Bam HI and Nhe I. The PCR product and the pMA LipA vector were double-digested with enzymes, as shown in Table 1. After thorough mixing, the mixture was reacted in a 37 °C water bath for 1 h.
[0040] Table 1. Mt-IPS site-directed mutagenesis PCR reaction system .
[0041] PCR digestion products and plasmid digestion products were recovered separately using a DNA recovery kit, and then ligated using T4 DNA ligase. The concentration ratio of DNA fragment to plasmid vector in the ligation system was 5:1, and the reaction was carried out at 25 °C for 1 h to obtain the recombinant expression vector pMA LipA-TYQ1024.
[0042] 1.2 Construction of a glutamine transaminase mutant library Using the wild-type glutamine transaminase TYQ1024 genome as a DNA template, error-prone PCR was performed. The reaction system is shown in Table 2, and the reaction procedure is shown in Table 3. Randomly mutated glutamine transaminase genes were obtained.
[0043] Table 2 Commonly Misunderstood PCR Reaction Systems .
[0044] Table 2 shows the sequences of the forward and reverse primers in the reaction system: Forward primer: CGCGGATCCTCGCCACCGGCAGTGGCAGTGGCA; Reverse primer: CTAGCTAGCTCACGGCCAGCCCTGTGTCA.
[0045] Table 3 Commonly Misunderstood PCR Reaction Procedures .
[0046] After processing the error-prone PCR products with 1% agarose gel electrophoresis, the products were recovered using a DNA recovery kit to obtain the randomly mutated glutamine transaminase gene.
[0047] 1.3 Expression and screening of glutamine transaminase mutants Following the aforementioned method, the randomly mutated glutamine transaminase gene was double-digested with plasmid pMA LipA and ligated to obtain a recombinant expression vector containing the mutated gene. This vector was then transformed into Bacillus subtilis SCK6 host cells to obtain recombinant strains. Glutamine transaminase mutants with high enzyme activity and high heat resistance were screened. The specific transformation and screening methods are as follows: (1) Bacillus subtilis SCK6 stored in glycerol tubes at -80 ℃ was streaked on LB solid medium containing erythromycin (1 μg / mL) to activate it and obtain single colonies; (2) Take a single colony and inoculate it into 100 mL of fresh LB liquid medium. After incubating overnight at 37 ℃ and 200 r / min for 12-14 h, transfer more than 50 mL of bacterial culture to 50 mL of LB liquid medium containing 1% xylose to allow OD to rise. 600 Once the concentration reaches 1, culture the cells at 37 °C and 200 r / min for 2 h. The resulting bacterial culture is the competent cell. (3) Linearize the recombinant expression vector containing the mutant gene. Take 1 µL of the linearized product and mix it slightly in 100 µL of competent cells. After incubating at 37 °C and 200 r / min for 90 min, spread it on LB solid medium containing kanamycin (50 µg / ml) and incubate until a single colony appears. (4) Pick a single colony and inoculate it into the fermentation medium. Incubate at 37 °C and 200 r / min for 3 days. Centrifuge and collect the fermentation broth to obtain the crude enzyme solution of the glutamine transaminase mutant. (5) Following the above method, the recombinant expression vector pMA LipA-TYQ1024 was linearized to prepare a crude wild-type glutamine transaminase solution. The enzyme activity was measured at different temperatures (40 ℃, 50 ℃, 60 ℃, 70 ℃). The results showed that the optimal temperature for wild-type glutamine transaminase was 50 ℃, and the enzyme activity decreased by about 60% at 60 ℃.
[0048] The enzyme activities of glutamine transaminase mutants at 50 °C and 60 °C were measured and compared with those of wild-type glutamine transaminase at the corresponding temperatures. Preliminary screening identified glutamine transaminase mutants with enhanced enzyme activity and heat resistance. The above steps were repeated for secondary screening, ultimately yielding glutamine transaminase mutants with significantly enhanced enzyme activity and heat resistance. 1.4 Purification of glutamine transaminase mutant According to the ammonium sulfate solution saturation table, ammonium sulfate solid was slowly added to the crude enzyme solution of the glutamine transaminase mutant obtained above while stirring until the saturation was 20%, 30%, 40%, 50%, 60%, 70%, 80%, and 90%, respectively. The solution was then placed in a refrigerator at 4°C for 4 h, and centrifuged at 7000 r / min and 4°C for 20 min. The supernatant was collected to measure the residual enzyme activity, and an ammonium sulfate fractionation precipitation table was plotted.
[0049] Ammonium sulfate was added to the crude enzyme solution of the glutamine transaminase mutant until precipitation saturation began. After standing at low temperature for 8 hours, the precipitate and other impurities were removed by centrifugation. Ammonium sulfate was added again until the glutamine transaminase mutant was completely saturated with precipitation. After standing at low temperature for 8 hours, the precipitate was collected by centrifugation. The precipitate was dissolved in 20 mM sodium phosphate buffer (PB; pH 5.8), dialyzed, and the supernatant was collected by centrifugation for further purification.
[0050] Further purification was performed using an SP cation exchange column. Solution A (20 mM PB; pH 5.8) was used to equilibrate the column, and solution B (1M NaCl, 20 mM PB; pH 5.8) was used for linear gradient elution. The collected eluent was the purified glutamine transaminase mutant enzyme solution. Freeze-drying this enzyme solution yielded powdered glutamine transaminase mutant.
[0051] The obtained glutamine transaminase mutant was sequenced, and its amino acid sequence is shown in SEQ ID NO.3, and its nucleotide sequence is shown in SEQ ID NO.4.
[0052] The enzyme activity of the glutamine transaminase mutant at 50 °C was 153.28 U / mg, which is about 2.4 times that of the wild-type glutamine transaminase (63.75 U / mg).
[0053] Example 2: Investigation of the enzymatic properties of glutamine transaminase mutants 2.1 Optimal temperature and temperature stability of glutamine transaminase mutants The enzyme activity of the glutamine transaminase mutant was measured at 25-80 °C (pH 7.0). The temperature at which the highest enzyme activity was reached was defined as the optimum temperature for the glutamine transaminase mutant, and this enzyme activity was defined as 100%. The relative enzyme activities under other temperature conditions were calculated. The results are shown in Table 4. The optimum temperature for the glutamine transaminase of this invention is 55 °C, and it retains more than 80% of its enzyme activity between 40-75 °C.
[0054] Table 4. Relative enzyme activities of glutamine transaminase mutants at different temperatures. .
[0055] The glutamine transaminase mutant was incubated at 30 °C, 35 °C, 40 °C, 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, 70 °C, 75 °C, and 80 °C (pH 7.0) for 2 h, and the residual activity was measured at 55 °C, with the activity of the untreated enzyme solution as 100%. The results are shown in Table 5. After incubation at 70 °C for 2 h, the residual enzyme activity of the glutamine transaminase mutant of the present invention was still above 60%, indicating that it has good thermostability.
[0056] Table 5. Results of temperature stability determination of glutamine transaminase mutants .
[0057] 2.2 Optimal pH and pH stability of glutamine transaminase mutants The enzyme activity of the glutamine transaminase mutant was measured at 55 °C in reaction systems with pH values ranging from 2 to 11. The pH at which the highest enzyme activity was observed was defined as the optimum pH for the glutamine transaminase mutant, and this enzyme activity was defined as 100%. The relative enzyme activities under other pH conditions were calculated. The results are shown in Table 6. The optimum pH for the glutamine transaminase mutant of this invention is 8, and it retains more than 80% of its enzyme activity between pH 5 and 9.
[0058] Table 6. Relative enzyme activities of glutamine transaminase mutants at different pH values. .
[0059] The glutamine transaminase mutants were incubated at pH 4-10 (35 °C) for 6 h, and their residual activity was measured at 55 °C, with the activity of the untreated enzyme solution as 100%. The results are shown in Table 7. After incubation at pH 5-8 for 6 h, the residual enzyme activity of the glutamine transaminase mutants of this invention was still above 80%, indicating that they have good stability within this pH range.
[0060] Table 7. Results of pH stability assay for glutamine transaminase mutants .
[0061] 2.3 Effect of salt concentration on enzyme activity of glutamine transaminase mutants NaCl solutions with concentrations of 2%, 4%, 6%, 8%, 10%, 12%, 14%, 16%, 18%, and 20% were prepared respectively. These solutions were mixed with purified glutamine transaminase mutant enzyme solution at a volume ratio of 1:1 and reacted at room temperature for 30 min. The residual enzyme activity was then measured at 55 °C, with the activity of the NaCl-free enzyme solution considered as 100%. The results are shown in Table 8. When the NaCl concentration was 18%, the glutamine transaminase mutant of this invention still retained more than 90% enzyme activity, indicating that this mutant has strong NaCl tolerance and can play a significant role in high-salt foods.
[0062] Table 8. Effects of salt concentration on enzyme activity of glutamine transaminase mutants. .
[0063] 2.4 Effect of iron ions on the enzyme activity of glutamine transaminase mutants Fe was prepared at concentrations of 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, and 7 mM, respectively. 2+ Solution and Fe 3+ The solution was mixed with purified glutamine transaminase mutant enzyme solution at a volume ratio of 1:1 and incubated at room temperature for 30 min. Residual enzyme activity was then measured at 55 °C, using Fe-free solutions. 2+ or Fe 3+ The enzyme activity of the enzyme solution was 100%. The results are shown in Table 9. When Fe... 2+ or Fe 3+ At a concentration of 5 mM, the glutamine transaminase mutant of the present invention still has more than 60% enzyme activity, indicating that the mutant has strong iron ion tolerance.
[0064] Table 9. Effects of iron ions on the enzyme activity of glutamine transaminase mutants. .
[0065] Example 3: Application of glutamine transaminase mutant in meat products Experimental group: 5% corn starch, 1.5% salt, 1.5% white sugar, 2% spices, 10% water, and 0.2% transglutaminase mutant by weight were added to minced pork. After being chopped and mixed evenly, the mixture was packed into tin cans, vacuum sealed, and first placed in a water bath at 55 ℃ for 60 min for incubation. Then, it was sterilized at 121 ℃ for 30 min to obtain the canned product.
[0066] Based on the above experimental groups, the following control experiment was set up: Control group 1: No glutamine transaminase mutant added; Control group 2: The glutamine transaminase mutant was replaced with wild-type glutamine transaminase at 0.5% of the weight of minced pork.
[0067] The texture and water loss rate of the canned products in the experimental and control groups were determined using the following methods: Texture: Take the central portion of the samples from the experimental group and the control group, and cut it into 2×2×2 cm pieces. 3 The cubes were tested for hardness, elasticity, and chewiness using a texture analyzer. The test parameters were: probe P50, pre-test speed 1 mm / s, test speed 1 mm / s, post-test speed 1 mm / s, interval between two compressions 5 s, and compression degree 40%.
[0068] Water loss rate: Take an appropriate amount of the central part of the sample, weigh it and record it as M, wrap it with filter paper and put it into a centrifuge tube, centrifuge at 3500 r / min for 10 min, weigh the centrifuged sample and record it as m, and calculate the water loss rate according to the formula: Water loss rate (%) = (Mm) / M×100%.
[0069] The results of the determination of texture and water loss rate of each group of products are shown in Table 10. According to the determination results, the glutamine transaminase mutant of the present invention exhibits excellent thermal stability and iron ion tolerance in canned food processing, and can significantly improve the texture and water loss of the product with a lower addition amount.
[0070] Table 10 Results of Texture and Water Loss Rate Measurement of Canned Products .
[0071] Example 4: Application of glutamine transaminase mutant in dairy products Experimental group: Raw milk was pasteurized and cooled to 42 ℃, then 4% white sugar, 0.05% lactic acid bacteria starter and 0.02% glutamine transaminase mutant were added. The mixture was fermented at 45 ℃ for 5 h, and then transferred to 4 ℃ for 24 h of post-ripening to obtain set-type yogurt.
[0072] Based on the above experimental groups, the following control experiment was set up: Control group 1: No glutamine transaminase mutant added; Control group 2: The glutamine transaminase mutant was replaced with an equal amount of wild-type glutamine transaminase.
[0073] The gel strength, water retention, and whey separation rate (after refrigeration at 4℃ for 7 days) of the canned products in the experimental and control groups were measured using the following methods: Gel strength: Determined using a texture analyzer via the puncture method. Test parameters were: probe TA.XTC-18, pre-test velocity 1 mm / s, test velocity 1 mm / s, post-test velocity 5 mm / s, trigger force 5 g, and puncture depth 15 mm (ensuring the probe penetrates the gel surface). The yogurt sample was placed under the texture analyzer, the probe aligned with the center of the sample, and the probe was pressed downwards into the sample at a constant rate. The peak force at which the probe penetrated the gel surface was recorded as the gel strength.
[0074] Water holding capacity (%): Weigh an appropriate amount of sample (mass denoted as G) into a centrifuge tube, centrifuge at 4℃ and 3000 r / min for 20 min, discard the supernatant, invert the centrifuge tube to drain the residual liquid, accurately weigh the mass of the precipitate (denoted as g), and calculate the water holding capacity according to the formula: water holding capacity (%) = g / G × 100%.
[0075] Whey separation rate (%): Place yogurt (mass denoted as m0) in a funnel, let it stand for 2 hours and collect the whey (mass denoted as m1) that has been drained out. Calculate the whey separation rate according to the formula: whey separation rate (%) = m1 / m0 × 100%.
[0076] The results of the index determination of each group of yogurt products are shown in Table 11. According to the results, the glutamine transaminase mutant of the present invention maintains high activity during the yogurt fermentation process, which can effectively improve the gel strength and water retention of the product and improve the whey separation.
[0077] Table 11 Results of gel strength, water retention and whey separation rate of yogurt .
[0078] Example 5: Application of glutamine transaminase mutant in soy products Experimental group: By weight, 60 parts of soy protein isolate, 20 parts of wheat gluten, 15 parts of potato starch, 2 parts of seasoning, and 0.4 parts of transglutaminase mutant were mixed evenly to obtain a dry powder. 65 parts of water and 3 parts of vegetable oil were mixed and slowly added to the dry powder, stirring until a wet material was formed. The wet material was allowed to stand at 50℃ for 30 min, then subjected to high-temperature extrusion. The extrusion process employed three temperature zones: feeding zone 60-70℃, mixing zone 90-100℃, and maturation zone 120-140℃. The feeding rate was 15 kg / h, and the screw speed was 200 rpm. After cutting and shaping, the extruded material was vacuum-packed and sterilized at 121℃ for 20 min to obtain plant-based meat.
[0079] Based on the above experimental groups, the following control experiment was set up: Control group 1: No glutamine transaminase mutant added; Control group 2: The glutamine transaminase mutant was replaced with an equal amount of wild-type glutamine transaminase.
[0080] The texture, firmness, chewiness, and water-holding capacity of the plant protein meat products from the experimental and control groups were measured using the following methods: Texture degree: Texture degree is a key indicator for measuring the density and fibrosis of plant protein meat, reflecting the integrity of the tissue after protein cross-linking. A higher texture degree indicates better tissue integrity after protein cross-linking. The texture analyzer shear force method was used for determination. Plant protein meat was cut into uniform samples of 1 cm × 1 cm × 0.2 cm. An HDP / BS shear probe was used to perform shear tests along the calendering direction (longitudinal) and perpendicular to the calendering direction (transverse). The initial speed was 2 mm / s, the testing speed was 1 mm / s, and the post-test speed was 2 mm / s. The trigger force was 5 g. The longitudinal and transverse shear forces were recorded. The texture degree was calculated as: Texture degree = Transverse shear force / Longitudinal shear force.
[0081] Hardness and chewiness: The TPA full texture analysis mode was used. The test parameters were: probe P / 0.5, pre-test speed 1 mm / s, test speed 1 mm / s, post-test speed 2 mm / s, trigger force 5 g, interval between two compressions 5 s, and compression ratio 50%.
[0082] Water holding capacity (%): The determination method is the same as in Example 4.
[0083] The index test results of each group of plant protein meat products are shown in Table 12. According to the results, the glutamine transaminase mutant of the present invention can effectively crosslink soybean protein under medium and high temperature conditions in the processing of plant protein meat due to its excellent thermal stability and high catalytic activity, which significantly improves the product's tissue integrity, texture properties and water holding capacity.
[0084] Table 12 Results of tests on the texture, firmness, chewiness, and water-holding capacity of plant protein meat .
[0085] Finally, it should be noted that although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A mutant of glutamine transaminase characterized in that, The amino acid sequence of the mutant is shown as SEQ ID NO.
3.
2. A gene encoding the transaminase mutant according to claim 1.
3. A recombinant expression vector comprising the gene encoding according to claim 2.
4. The recombinant expression vector of claim 3, wherein, The vector of the expression vector is plasmid pMALipA.
5. A recombinant strain comprising the recombinant expression vector according to claim 3 or 4.
6. The recombinant bacterial strain of claim 5, wherein The host cell of the recombinant strain is Bacillus subtilis SCK6.
7. An enzyme preparation comprising the transaminase mutant according to claim 1.
8. The enzyme preparation of claim 7, wherein The enzyme preparation includes liquid and solid dosage forms.
9. Use of the transaminase mutant according to claim 1, or the enzyme preparation according to claim 7 or 8 in food.
10. Use according to claim 9, wherein The food includes meat products, dairy products, and bean products.