A method for constructing a genetically engineered k. lactis bacteria for producing miR162a and application thereof

By constructing a multi-gene co-expression system in Kluyveromyces lactis, the stability issues of miR162a expression and processing in yeast were resolved, achieving efficient production and demonstrating its potential application in osteoporosis treatment.

CN122344585APending Publication Date: 2026-07-07NANJING UNIV OF TRADITIONAL CHINESE MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING UNIV OF TRADITIONAL CHINESE MEDICINE
Filing Date
2026-05-13
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Existing technologies make it difficult to express and process plant miRNAs, especially miR162a, in yeast efficiently and stably, which limits their application in the biomedical field.

Method used

A multi-gene co-expression system was constructed in Kluyveromyces lactis. The DCL1, HYL1 and SE genes were linked by the IGG6 sequence to form a polycistronic expression unit, which co-expressed and processed the miR162a precursor. Stable genetically engineered strains were obtained by screening with acetamide.

Benefits of technology

High-yield and stable miR162a production was achieved, which significantly promoted osteogenic differentiation of mesenchymal stem cells and showed significant therapeutic effects in a mouse osteoporosis model.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122344585A_ABST
    Figure CN122344585A_ABST
Patent Text Reader

Abstract

The application discloses a method for constructing a genetically engineered Kluyveromyces lactis strain for producing miR162a, which comprises co-transferring two plasmids expressing DCL1, HYL1 and SE genes from Arabidopsis thaliana into a Kluyveromyces lactis GG799 strain by electroporation, so that the yeast obtains the ability to cut plant-derived precursor miRNA, one of the plasmids synchronously expresses a precursor of miR162a from Lycium ruthenicum Murr, and the genetically engineered Kluyveromyces lactis strain for stably producing miR162a is obtained after acetamide screening. The application further discloses the genetically engineered Kluyveromyces lactis strain constructed according to the above method and application thereof. The genetically engineered strain constructed by the method has a high yield of miR162a at a laboratory flask level, and can stably produce miR162a after continuous subculture, the genetically engineered Kluyveromyces lactis strain exhibits the ability to promote osteogenic differentiation in a cell experiment, and can effectively improve the osteoporosis symptoms of mice in an animal experiment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and microbial fermentation technology, specifically to a recombinant yeast strain for producing plant-derived microRNAs (miRNAs), its construction method, and its applications. More specifically, this invention relates to constructing a genetically engineered strain capable of efficiently and stably producing bioactive plant miR162a by using linker sequences such as IGG6 in *Kluyveromyces lactis* to construct polycistronic expression units of key enzyme genes (DCL1, HYL1, SE) for plant-derived miRNA biosynthesis, and co-expressing them with a target miRNA precursor (pre-miR162a) using yeast as a vector. The invention also relates to the application of this engineered strain in promoting osteogenic differentiation and improving osteoporosis. Background Technology

[0002] Minimal RNAs (miRNAs) are a class of non-coding single-stranded RNA molecules, approximately 20-24 nucleotides in length, widely distributed in eukaryotes. They play crucial roles in biological processes such as cell growth, differentiation, metabolism, and disease development by regulating target gene expression post-transcriptionally. Plant-derived miRNAs, such as miR162a, have not only been reported to have important functions in plants, but recent studies have also revealed that plant-derived miRNAs, after oral administration to animals, can influence gene expression through cross-species regulatory mechanisms, demonstrating potential medicinal value. However, the content of miRNAs in natural plants is low and affected by factors such as season and origin, making direct extraction difficult to meet the needs of large-scale applications. Chemical synthesis methods are costly, and the synthesized small RNAs are easily degraded in vivo, exhibiting poor stability. Therefore, developing an economical, efficient, and sustainable biomanufacturing system for producing high-purity, highly active plant miRNAs with good biological functions is a key bottleneck for the green industrialization of this field.

[0003] Utilizing microorganisms (such as Escherichia coli and yeast) as cell factories to produce high-value compounds through synthetic biology is a mainstream strategy in biomanufacturing. Compared to Escherichia coli, yeast, as a eukaryote, possesses a more complete intracellular membrane system and protein post-translational modification mechanisms, making it more suitable for expressing complex eukaryotic proteins. Kluyveromyces lactis is a fungal species that can be used in health foods. It is FDA-certified as a food-grade microorganism (Generally Recognized as Safe, GRAS), possessing advantages such as strong protein secretion and efficient integration expression. Its clear genetic background facilitates genetic manipulation, making it a highly promising host for the production of proteins and nucleic acids.

[0004] However, the biosynthesis of plant miRNAs depends on their specific in vivo processing mechanisms. In the plant cell nucleus, primary miRNA transcripts (pri-miRNAs) are first progressively cleaved by a complex formed by DCL1, HYL1, and SE proteins to generate pre-miRNAs with stem-loop structures, which are then processed to produce mature miRNA double strands. This processing pathway is plant-specific; conventional yeast hosts (such as Saccharomyces cerevisiae) lack the corresponding processing enzyme systems and cannot directly process plant-derived pri-miRNAs or pre-miRNAs to produce the correct mature miRNAs. Therefore, accurate expression of the aforementioned complex is necessary in yeast.

[0005] If the three genes DCL1, HYL1, and SE are expressed with separate promoters and terminators, not only will plasmid construction be complex and the vector capacity large, but it will also increase the difficulty of controlling the electroporation of the three genes into yeast transcription and translation, which may lead to low complex assembly efficiency and affect the processing efficiency of pre-miRNA.

[0006] Furthermore, research on reconstructing the complete plant miRNA biosynthetic pathway in *Kluyveromyces lactis* and using it to produce specific plant miRNAs with defined in vitro and in vivo activities (such as miR162a) remains lacking. Meanwhile, existing engineered strains still have significant room for improvement in terms of genetic stability, target product yield, and processing fidelity, limiting their industrial application. Therefore, there is an urgent need in this field to develop a novel strategy for constructing genetically engineered strains based on non-traditional yeasts, capable of efficiently, stably, and coordinately expressing plant miRNA processing complexes through multi-gene co-expression technology, thereby efficiently producing plant miRNAs with complete biological activity, especially miRNA molecules like miR162a with significant biomedical application potential. Summary of the Invention

[0007] This invention addresses the challenges of large-scale, low-cost, and high-activity production of plant miRNAs in existing technologies, as well as the problems of expression imbalance, low efficiency, and poor stability in existing microbial expression systems when reconstructing plant miRNA processing pathways. It provides a novel and efficient method for constructing genetically engineered bacteria based on Kluyveromyces lactis, the resulting high-yield and stable engineered bacteria, and their applications in the biomedical field.

[0008] This invention first provides a method for constructing a Kluyveromyces lactis genetically engineered strain that produces miR162a. The core of this method lies in the innovative and successful transplantation of the complete core processing mechanism of plant-derived miRNA biosynthesis into Kluyveromyces lactis.

[0009] The specific technical solution is as follows:

[0010] A method for constructing a genetically engineered Kluyveromyces lactis strain that produces miR162a, comprising the following steps:

[0011] S1. Construct a first recombinant expression plasmid containing the HYL1 (Hyponastic Leaves1) and SE (Serrate) gene sequences derived from Arabidopsis thaliana (the nucleotide sequences of the HYL1 and SE genes are shown in SEQ ID No. 1 & No. 2).

[0012] S2. Construct a second recombinant expression plasmid containing the miR162a precursor sequence from Lycium barbarum and the DCL1 (Dicer-like 1) gene sequence from Arabidopsis thaliana (the nucleotide sequences of the miR162a precursor and DCL1 gene are shown in SEQ ID No. 3 & No. 4), wherein the second recombinant expression plasmid has a different tag from the first recombinant expression plasmid;

[0013] S3. The two recombinant expression plasmids constructed in steps (1) and (2) were co-transformed into Kluyveromyces lactis GG799 strain by electroporation.

[0014] S4. The transformed yeast strains were screened using acetamide medium to obtain Kluyveromyces lactis genetically engineered strains that could stably express the DCL1, HYL1, and SE proteins and be processed to produce mature miR162a.

[0015] As a preferred embodiment, the recombinant plasmid constructed using the pKLAC1 vector in the above-described construction method combines the endogenous terminator LAC4t of Kluyveromyces lactis with a selection marker gene based on the acetamipase gene of Aspergillus niger (encoded by the amdS gene), enabling it to convert acetamide, which Kluyveromyces lactis cannot utilize, into ammonia, a usable nitrogen source. Therefore, recombinant bacteria can be screened using YCB medium with acetamide as the sole nitrogen source.

[0016] As a preferred embodiment, in the construction method described above, in step S1, the HYL1 and SE gene sequences are sequentially linked by the IGG6 sequence (the IGG6 nucleotide sequence is shown in SEQ ID No. 5), and modified with Myc (nucleotide sequence is shown in SEQ ID No. 6) and EGFP (nucleotide sequence is shown in SEQ ID No. 7) fusion tags to form a HYL1-Myc-IGG6-SE-EGFP fusion gene unit, which is placed under the control of a single yeast strong promoter.

[0017] As a preferred embodiment, in the above-described construction method, in step S2, the DCL1 gene sequence is sequentially linked to the miR162a precursor sequence via the IGG6 sequence, and the DCL1 sequence is modified with an HA (nucleotide sequence as shown in SEQ ID No. 8) fusion tag to form a miR162a-IGG6-DCL1-HA fusion gene unit, which is placed under the control of a single yeast strong promoter.

[0018] This invention provides a method for constructing a Kluyveromyces lactis genetically engineered strain for producing miR162a. The method involves constructing two key recombinant expression plasmids. The first plasmid uses the IGG6 sequence to tandemly link the Arabidopsis-derived HYL1 and SE genes, responsible for expressing the HYL1 and SE proteins essential for forming the core cleavage complex. This ensures strict co-expression of the two accessory proteins, forming a polycistronic expression unit controlled by a strong promoter. The second plasmid combines the core enzyme DCL1, responsible for initial recognition and cleavage, with the precursor gene sequence of its directly acting substrate, Lycium barbarum miR162a, on the same plasmid, improving the processing efficiency and specificity of DCL1 for specific pre-miR162a. This method allows the entire expression system to be implemented using only two plasmids, significantly improving the genetic stability of the system and its feasibility for application in industrial strains. Two plasmids were co-transformed into the Kluyveromyces lactis GG799 host strain via electroporation, and after acetamide resistance screening, a genetically engineered strain that can be stably inherited was finally obtained (hereinafter referred to as strain G-DCL1-HYL1-SE-miR162a).

[0019] This invention further provides the application of the Kluyveromyces lactis genetically engineered strain in the production of miR162a. The miR162a produced by this recombinant strain not only has high yield and good stability, but also possesses complete biological activity. Experimental results show that miR162a extracted from this engineered strain can significantly promote osteogenic differentiation of mesenchymal stem cells.

[0020] Beneficial effects:

[0021] This invention utilizes the IGG6 self-cleaving polypeptide sequence to link multiple genes DCL1, HYL1, SE, and the precursor sequence miR162a into a single transcript, achieving multi-gene synergistic expression and ensuring a relatively stable protein molar ratio. The *Kluyveromyces lactis* genetically engineered strain constructed in this invention possesses the ability to produce miR162a and provides a strategy for the intervention of miR162a-producing engineered bacteria in osteoporosis. Animal experiments as shown in Example 7 demonstrate that continuous gavage administration of the engineered bacteria to mice effectively increases bone mineral density in ovariectomy (OVX)-induced osteoporosis models, with efficacy comparable to that of the positive control drug etidronate disodium group. This provides experimental evidence that the engineered bacteria constructed in this invention can serve as a "living cell factory," sustainably and economically producing plant miRNAs with clear therapeutic activity, and providing a novel and efficient biomanufacturing platform for developing miRNA-based osteoporosis prevention and treatment drugs or functional foods. Attached Figure Description

[0022] Figure 1 A schematic diagram showing the design and construction of two electroporation plasmids for recombinant yeast.

[0023] Figure 2 The construction process of the recombinant strain corresponding to Example 3 is as follows: A. Single enzyme digestion was performed on the two expression plasmids to obtain linear plasmid products, and the products were recovered by agarose gel electrophoresis; B & C. After co-electroporation and acetamide screening, single clones were taken for amplification and verification. Western blot analysis revealed that a positive recombinant strain with stable expression of the DCL1-HYL1-SE gene existed after plate passage. The corresponding position detected by the tag antibody was consistent with the predicted molecular weight.

[0024] Figure 3 To identify and sequence the screened F1 generation recombinant strains: A. Real-time quantitative PCR (qPCR) was used to amplify and relatively quantify the target sequence, detecting miR162a expression at the predicted location; B. The purified qPCR product was used as a template and sent to Sangon Biotech (Shanghai) Co., Ltd. for bidirectional Sanger sequencing. The obtained sequencing peak diagram was compared with the expected sequence of mature miR162a. The alignment software showed complete sequence identity, and the sequencing peak diagram was clear and free of impurities, proving that the product amplified by qPCR was indeed the target miR162a.

[0025] Figure 4To determine the ability of the recombinant strain to stably express miR162a, A&B. conducted continuous subculture experiments on the F1 generation positive strain and sampled yeast from 10 consecutive generations. The qPCR combined with Sanger sequencing method described in Example 4 was repeated to detect the expression stability of the target product. The target miR162a could be obtained through the yeast expression system up to the F10 generation, proving that the recombinant strain has strong stability.

[0026] Figure 5 To determine the ability of recombinant bacterial strains to promote osteogenic differentiation of human bone marrow mesenchymal stem cells (hBMSCs), the results showed that cell lysates derived from the recombinant strain G-DCL1-HYL1-SE-miR162a could independently and significantly induce osteogenic differentiation of hBMSCs and the formation of a mineralized matrix without the assistance of any exogenous chemical inducers.

[0027] Figure 6 To demonstrate the ability of recombinant strains to improve osteoporosis symptoms in mice. A. Schematic diagram of CT images of the tibia in each group of mice; B. Immediately after ovariectomy, intervention with G-DCL1-HYL1-SE-miR162a recombinant engineered bacteria effectively prevented bone loss in the tibia due to estrogen deficiency in mice and significantly maintained their bone mineral density (BMD) and bone volume fraction (BV / TV). Specific implementation methods

[0028] The present invention is further illustrated below by way of specific embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0029] The Kluyveromyces lactis used in the following examples uses Kluyveromyces lactis GG799 as the starting strain.

[0030] Example 1: Design and construction of plasmids for yeast expression system

[0031] Step 1: Using the pKLAC1 vector as the plasmid vector, a first recombinant expression plasmid containing the HYL1 (Hyponastic Leaves 1) and SE (Serrate) gene sequences derived from Arabidopsis thaliana was constructed. The nucleotide sequences of the HYL1 and SE genes are shown in SEQ ID No. 1 & No. 2. The HYL1 and SE gene sequences are sequentially linked by an IGG6 sequence, the IGG6 nucleotide sequence of which is shown in SEQ ID No. 5. Furthermore, a Myc (nucleotide sequence of which is shown in SEQ ID No. 6) and EGFP (nucleotide sequence of which is shown in SEQ ID No. 7) fusion tag modification was performed to form a HYL1-Myc-IGG6-SE-EGFP fusion gene unit, which is controlled by a single yeast strong promoter. Using pKLAC1 as a vector, the target fragment was synthesized in its entirety. The target fragment was tandemly composed of the following sequences: the full-length sequence of the HYL1 CDS region including the stop codon (SEQ ID No. 1) + the IGG6 sequence (SEQ ID No. 5) + the SE CDS region without the stop codon (SEQ ID No. 2) + the EGFP sequence (SEQ ID No. 7), and the Myc tag sequence (SEQ ID No. 6) was appended before the HYL1 stop codon.

[0032] Step 2: Using the pKLAC1 vector as the plasmid vector, a second recombinant expression plasmid containing the miR162a precursor sequence from Lycium barbarum and the DCL1 (Dicer-like 1) gene sequence from Arabidopsis thaliana was constructed. The miR162a precursor sequence and the DCL1 gene nucleotide sequence are shown in SEQ ID No. 3 & No. 4. The DCL1 gene sequence was sequentially linked to the miR162a precursor sequence via the IGG6 sequence, and the DCL1 sequence was modified with an HA fusion tag (nucleotide sequence shown in SEQ ID No. 8) to form a miR162a-IGG6-DCL1-HA fusion gene unit. This fusion gene unit was placed under the control of a single yeast strong promoter. Using pKLAC1 as a vector, the target fragment was synthesized in its entirety. The target fragment was tandemly composed of the following sequences: miR162a precursor (SEQ ID No. 3) + IGG6 sequence (SEQ ID No. 5) + full-length DCL1 CDS region sequence (SEQ ID No. 4), with the HA tag sequence (SEQ ID No. 8) preceding the DCL1 stop codon.

[0033] Example 2: Preparation of GG799 yeast competent cells

[0034] Step 1: Take out the GG799 yeast glycerol bacteria frozen at -80℃, streak it on a plate, pick out a single colony and put it into 5ml of YPD (Yeast Extract Peptone Dextrose) liquid medium, and incubate at 30℃ for 12-16 h;

[0035] Step 2: Transfer the growing yeast to 50 ml of YPD medium and incubate in a shake flask at 30°C for 6-9 h;

[0036] Step 3: When the OD reaches 0.5-1.2, place on ice for 10 min, centrifuge to collect the bacterial cells (4℃, 1100 g, 5 min), discard the supernatant, then reselect the bacterial cells with 20 ml of sterile water in an ice bath, centrifuge again and discard the supernatant;

[0037] Step 4: Resuspend the bacterial cells in 20 ml of 0.1 M lithium acetate (16 ml sorbitol + 2 ml 10×TE buffer + 2 ml 1M lithium acetate) and incubate at 30°C for 30 min;

[0038] Step 5: Add 1M DTT, keep at 30℃ for 15 minutes, then centrifuge and discard the supernatant;

[0039] Step 6: Wash the yeast cells twice with 20ml of 1M sorbitol in an ice bath, centrifuge, and discard the supernatant;

[0040] Step 7: Reselect the bacterial cells with 1 mL of 1M sorbitol in an ice bath, and dispense 80~100 μL / tube;

[0041] Step 8: Immediately store in a -80°C refrigerator for later use.

[0042] Example 3: Construction of G-DCL1-HYL1-SE-miR162a recombinant strain

[0043] Step 1: Take out the aliquoted GG799 yeast electrotransfer competent cells from the -80 ℃ freezer, and after they are fused, add 5 μg of linearized plasmid (i.e., 2.5 μg each of the first recombinant expression plasmid and the second recombinant expression plasmid described in Example 1), pre-cool on ice for 15 min, mix, and quickly transfer to an electroporation cuvette (the electroporation cuvette was sterilized and pre-cooled on ice).

[0044] Step 2: Set the electroporator to 1.5 kV, 200 Ω, 25 μF for electroporation, and immediately add 1 ml of 1M sorbitol in an ice bath;

[0045] Step 3: Incubate the resuspension at 30℃ and 200 rpm on a shaker for 1-3 hours, then centrifuge to collect the bacterial cells. Spread 150 μL of the bacterial suspension onto a resistant (chloramphenicol) plate and incubate at 30℃ for 3 days.

[0046] Step 4: Select a single clone of suitable size from the cultured resistance plate, inoculate it into 2 mL of YPD medium with chloramphenicol resistance, add acetamide to the medium for screening, and incubate at 30℃ and 200 rpm for 24 hours to obtain the recombinant strain G-DCL1-HYL1-SE-miR162a to be identified.

[0047] Step 5: Using a nuclease-free pipette tip, aspirate a uniform suspension of the strain (the recombinant strain G-DCL1-HYL1-SE-miR162a to be identified), centrifuge to obtain a precipitate, lyse the recombinant yeast precipitate, prepare protein samples, and use Western blotting and tag antibodies to test the expression of each component in the recombinant yeast.

[0048] The results are as follows Figure 2 A involves single enzyme digestion of two expression plasmids to obtain linear plasmid products, followed by agarose gel electrophoresis and gel recovery. Figure 2 After co-electroporation and acetamide screening of strains B and C, single clones were amplified and verified. Western blot analysis revealed that after passaging, positive recombinant strains with stable expression of the DCL1-HYL1-SE gene were found. The corresponding position of the tag antibody was consistent with the predicted molecular weight.

[0049] Example 4: Identification of the ability of recombinant strains to produce miR162a

[0050] To confirm that the constructed engineered strain can specifically produce the target mature miR162a and to assess its relative yield, real-time quantitative PCR (qPCR) was used to amplify and relatively quantify the target sequence. The final confirmation of the product was achieved by Sanger sequencing of the specific amplified products. The specific steps included:

[0051] Step 1: Extraction of total RNA from yeast. The recombinant strain G-DCL1-HYL1-SE-miR162a successfully constructed in Example 3 was cultured in selective medium to the logarithmic growth phase. The cells were collected and total RNA was extracted. The operation was strictly performed according to the instructions. The RNA concentration and purity (A260 / A280 ratio between 1.8 and 2.2) were determined using a micro spectrophotometer.

[0052] Step 2: Stem-Loop Reverse Transcription and qPCR Amplification. Take 1 µg of total RNA and use specific stem-loop reverse transcription primers designed for mature miR162a to perform reverse transcription to synthesize cDNA. Prepare qPCR premix using SYBR Green, and amplify the reverse transcription product using miR162a-specific qPCR primers. Run the standard three-step program on a real-time quantitative PCR instrument (95℃ pre-denaturation for 10 min; followed by 40 cycles of 95℃ for 15 s, 60℃ for 59 s, and 72℃ for 30 s, with fluorescence signal acquisition during the extension phase), and add a melting curve analysis step after the amplification program to verify the singleness of the amplified product. Figure 3 A represents the amplification and relative quantification of the target sequence using real-time quantitative PCR (qPCR), which detected miR162a expression at the predicted location.

[0053] Step 3: qPCR Product Purification and Sanger Sequencing Verification. After large-scale product amplification, the products are purified using a DNA purification kit to remove impurities such as primers and dNTPs. The purified qPCR product is used as a template, and one of the forward or reverse primers from the qPCR reaction is used as the sequencing primer, and the sample is sent to Sangon Biotech (Shanghai) Co., Ltd. for bidirectional Sanger sequencing. Figure 3 B compared the obtained sequencing peak diagram with the expected sequence of mature miR162a. The comparison software showed that the sequence was completely identical and the sequencing peak diagram was clear and free of impurities, proving that the product amplified by qPCR was the target miR162a, and excluding interference from non-specific amplification or primer dimers.

[0054] Example 5: Determining the ability of recombinant strains to stably transmit miR162a

[0055] To evaluate the genetic stability of the exogenous expression elements and the persistence of miR162a production capacity of the recombinant strain G-DCL1-HYL1-SE-miR162a under continuous culture without selection pressure, a continuous subculture experiment was conducted. Samples were taken from 10 consecutive generations of yeast, and the qPCR combined with Sanger sequencing method described in Example 4 was repeated to detect the expression stability of the target product. The first-generation recombinant strain identified as positive by Sanger sequencing was named F1. An appropriate amount of bacterial culture was plated on chloramphenicol-resistant plates and cultured for 48-72 hours. Single clones of suitable size were picked and cultured and amplified according to the shaker culture methods described in Examples 3 and 4, followed by sequencing identification. The results of this example show that the G-DCL1-HYL1-SE-miR162a recombinant strain constructed in this invention, under conditions without exogenous selection pressure, maintained stable exogenous gene expression after 10 consecutive subcultures, and its ability to produce the target product miR162a did not significantly decrease, demonstrating good genetic and production stability and possessing the potential for large-scale industrial fermentation culture. Figure 4 To determine the ability of the recombinant strain to stably express miR162a, A&B conducted continuous subculture experiments on the F1 generation positive strain and sampled yeast from 10 consecutive generations. The target miR162a could be obtained through the yeast expression system up to the F10 generation, demonstrating the strong stability of the recombinant strain.

[0056] Example 6: Determining the ability of recombinant bacterial strains to promote osteogenic differentiation of human bone marrow mesenchymal stem cells

[0057] To confirm the biological activity of the fermentation products of the genetically engineered bacteria constructed in this invention, a human bone marrow mesenchymal stem cell (hBMSCs) osteogenic differentiation model was used. The ability to independently induce osteogenic differentiation was assessed by directly adding the cell lysis supernatant of the recombinant bacteria (without adding any standard chemical inducers), with Alizarin Red staining results used as the core evaluation indicator. The specific experimental steps are as follows:

[0058] Step 1: Recombinant strain G-DCL1-HYL1-SE-miR162a was cultured in YPD liquid medium at 30°C and 220 rpm for 48 hours with shaking. Cells were collected by centrifugation at 5000×g for 10 minutes at 4°C and washed twice with pre-chilled sterile PBS buffer. The cells were then lysed using a high-pressure cell disruptor under ice bath conditions. The lysate was centrifuged at 12,000×g for 20 minutes at 4°C, and the supernatant was carefully aspirated. This was the crude lysate containing intracellular soluble proteins, nucleic acids (including the target miR162a), and other metabolites. The lysate was filtered through a 0.22 μm sterile filter. The total protein concentration was determined using the BCA method. Each batch of lysate was diluted to a uniform working protein concentration (1 mg / mL) with serum-free basal medium and stored at -80°C for later use.

[0059] Step 2: Use fifth-generation human bone marrow mesenchymal stem cells (hBMSCs) and routinely culture them in DMEM / F12 complete medium containing 10% FBS.

[0060] Step 3: Spread the cells at a rate of 1×10 4 The cells were inoculated at a density of cells / well in 6-well plates and divided into the following three groups: (1) Blank control group: normal serum basal medium; (2) Positive control group: standard osteogenic induction complete medium (containing ascorbic acid at a final working concentration of 50 µg / mL and 10 mM sodium β-glycerophosphate); (3) Yeast lysate group: in the basal medium, only standardized recombinant bacterial lysate was added, without adding any exogenous chemical inducers, and the final concentration of the lysate was 50 µg / mL.

[0061] Step 4: Replace with freshly prepared culture medium every 3 days, and continue induction for 18-21 days. After induction, wash with PBS and fix with 4% paraformaldehyde for 15 minutes. Add 1 mL of 0.1% alizarin red staining solution to each well, stain at room temperature in the dark for 20 minutes, wash thoroughly with deionized water until the background is colorless, and air dry at room temperature. Observe and photograph under a microscope to compare the formation of mineralized nodules (orange-red / red) in each group.

[0062] like Figure 5 The experimental results, derived from cell lysates of recombinant bacteria G-DCL1-HYL1-SE-miR162a, showed that hBMSCs could independently and significantly induce osteogenic differentiation and the formation of mineralized matrix without the assistance of any exogenous chemical inducers.

[0063] Example 7: Testing the ability of recombinant strains to improve osteoporosis symptoms in mice

[0064] To evaluate the in vivo preventive intervention effect of the genetically engineered bacteria constructed in this invention on osteoporosis, an ovariectomy (OVX)-induced postmenopausal osteoporosis mouse model was established. Continuous intervention was performed via gavage after surgery, and the effect on preventing and reducing bone loss was systematically evaluated using bone mineral density and bone microstructure as core indicators. The specific experimental steps are as follows:

[0065] Step 1: Select 10-week-old, healthy female C57BL / 6J mice, weighing 18-20 g. All mice were acclimatized in an SPF-grade animal facility for one week, with free access to food and water, and a 12 / 12-hour light / dark cycle.

[0066] Step 2: Grouping and Surgery: Mice were randomly divided into 5 groups of 5 mice each: (1) Sham-operated group: Sham surgery was performed (only the ovaries were exposed, but not removed) as a control for normal bone metabolism; (2) Model group: Bilateral ovariectomy was performed, and PBS was administered by gavage after surgery as a control for osteoporosis model; (3) Positive drug group: After ovariectomy, etidronate disodium (250 mg / kg) was administered; (4) Engineered yeast group: After ovariectomy, G-DCL1-HYL1-SE-miR162a recombinant bacterial suspension was administered by gavage; (5) Blank yeast control group: After ovariectomy, Kluyveromyces lactis GG799 suspension, which was not genetically modified, was administered by gavage. All surgeries were performed under sterile conditions, and the mice were cared for for 3 days after surgery. All OVX mice were fed routinely after surgery.

[0067] Step 3: Preparation of bacterial suspension: The concentration of the bacterial suspension in both the engineered yeast group and the blank yeast control group was adjusted to 5 × 10⁻⁶. 9 CFU / mL.

[0068] Dosage regimen: Starting from the second day post-surgery, administration was administered via gavage continuously for 8 weeks. Sham-operated group and model group: Administered an equal volume (0.2 mL) of sterile PBS daily via gavage. Positive control group: Administered etidronate disodium daily via gavage at a dose of 250 mg / kg / day, in a volume of 0.2 mL. Engineered yeast group and blank yeast control group: Administered the corresponding bacterial suspension daily via gavage, with a total bacterial count of 2 × 10⁻⁶ cells per yeast per day. 9 CFU. Adjust the gavage volume according to weekly weight gain.

[0069] Step 4: Sample Collection and Micro-CT Analysis. Mice were sacrificed 24 hours after the last drug administration. The tibia was completely dissected, and attached soft tissue was carefully removed. The sample was immediately fixed in 4% paraformaldehyde for 24 hours. The fixed tibia sample was removed, rinsed with PBS, and placed in sample tubes. A high-resolution micro-computed tomography system was used to scan the tibia to obtain high-quality three-dimensional images of the complete tibia (including the tibial plateau and metaphysis).

[0070] Step 5: Three-dimensional reconstruction and bone morphometric analysis. The proximal metaphysis of the tibia (usually the cancellous bone region 0.5 mm to 2.0 mm from the growth plate) was selected as the standard region for three-dimensional reconstruction. Quantitative analysis was performed on the region of interest for each sample. The core evaluation indicators included: (1) bone mineral density: BMD; (2) bone volume fraction: BV / TV.

[0071] Step 6: Data Processing and Statistical Analysis. All data are expressed as mean ± standard deviation. GraphPadPrism 9.0 software was used for pairwise comparisons between groups. *P < 0.05, **P < 0.01, *** < 0.001 were considered statistically significant.

[0072] The tibial bone mineral density (BMD) and bone volume volume (BV / TV) values ​​of the model group mice were significantly lower than those of the sham-operated group, confirming significant postoperative osteoporosis. The tibial BMD and BV / TV values ​​of the positive control group were significantly higher than those of the model group, demonstrating that early drug intervention has a clear preventive effect against bone loss. The tibial bone parameters of the blank yeast control group showed no significant difference from those of the model group, indicating that the original host bacterium GG799 itself has no preventive effect against OVX-induced bone loss. The tibial BMD and BV / TV values ​​of the engineered yeast group were significantly higher than those of the model group and the blank yeast control group. This indicates that early postoperative administration of engineered bacteria capable of producing miR162a can effectively prevent the decrease in tibial bone mineral density and the destruction of bone microstructure; its preventive effect is not mediated by the yeast carrier but rather stems from its engineered function.

[0073] This embodiment demonstrates that intervention with the G-DCL1-HYL1-SE-miR162a recombinant engineered bacteria immediately after ovariectomy can effectively prevent bone loss in the tibia of mice due to estrogen deficiency, and significantly maintain bone mineral density (BMD) and bone volume fraction (BV / TV). These in vivo experimental data strongly support the application potential of the engineered bacteria of this invention in the early prevention of postmenopausal osteoporosis.

[0074] sequence list

[0075] SEQ ID No. 1 (HYL1):

[0076]

[0077] SEQ ID No. 2(SE):

[0078]

[0079] SEQ ID No. 3 (miR162a precursor sequence):

[0080] TAGTTGGAAGAAGAGTGAGAGTCGCTGGAGGCAGCGGTTCATCGATCTCTTCCTGTGAACACATTAAAAATGTAAAAGCATGAATAGATCGATAAACCTCTGCATCCAGCGTTTGCCTCTTGTATCTTTCTTATTGACTT

[0081] SEQ ID No. 4 (DCL1):

[0082]

[0083]

[0084] SEQ ID No. 5(IGG6):

[0085] CAATCAAAC

[0086] SEQ ID No. 6(Myc-tag):

[0087] GAACAAAAACTCATCTCAGAAGAGGATCTG

[0088] SEQ ID No. 7(EGFP-tag):

[0089] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

[0090] SEQ ID No. 8(HA-tag):

[0091] ggtggttctggtTACCCATACGACGTCCCAGACTACGCT

Claims

1. A method for constructing a Kluyveromyces lactis genetically engineered strain that produces miR162a, characterized in that, Includes the following steps: S1. Construct the first recombinant expression plasmid containing the HYL1 and SE gene sequences derived from Arabidopsis thaliana; S2. Construct a second recombinant expression plasmid containing the miR162a precursor sequence from Lycium barbarum and the DCL1 gene sequence from Arabidopsis thaliana; S3. The two recombinant expression plasmids constructed in steps (1) and (2) were co-transformed into Kluyveromyces lactis GG799 strain by electroporation. S4. The transformed yeast strains were screened using acetamide medium to obtain Kluyveromyces lactis genetically engineered strains that could stably express the DCL1, HYL1, and SE proteins and be processed to produce mature miR162a.

2. The construction method according to claim 1, characterized in that, The nucleotide sequences of the HYL1 and SE genes are shown in SEQ ID No. 1 & No. 2; the nucleotide sequences of the miR162a precursor and DCL1 genes are shown in SEQ ID No. 3 & No.

4.

3. The construction method according to claim 1, characterized in that, The recombinant plasmid was constructed using the pKLAC1 vector, which contains both the endogenous terminator LAC4t of Kluyveromyces lactis and a selection marker gene based on the acetamipase gene of Aspergillus niger. This enables Kluyveromyces lactis to convert acetamide, which it cannot utilize, into ammonia, a nitrogen source that it can utilize. Therefore, recombinant bacteria can be screened using YCB medium with acetamide as the sole nitrogen source.

4. The construction method according to claim 1, characterized in that, In step S1, the HYL1 and SE gene sequences are sequentially linked by the IGG6 sequence, the IGG6 nucleotide sequence of which is shown in SEQ ID No. 5, and modified with Myc and EGFP fusion tags to form a HYL1-Myc-IGG6-SE-EGFP fusion gene unit, which is under the control of a single yeast strong promoter; the Myc nucleotide sequence of which is shown in SEQ ID No. 6, and the EGFP nucleotide sequence of which is shown in SEQ ID No.

7.

5. The construction method according to claim 4, characterized in that, In step S1, the specific construction method of the first recombinant expression plasmid is as follows: using pKLAC1 as a vector, the target fragment is fully synthesized, and the target fragment is tandemly composed of the following sequences: the full-length sequence of HYL1CDS region including the stop codon (SEQ ID No. 1) + IGG6 sequence (SEQ ID No. 5) + SECDS region without stop codon (SEQ ID No. 2) + EGFP sequence (SEQ ID No. 7), and the Myc tag sequence (SEQ ID No. 6) is appended before the HYL1 stop codon.

6. The construction method according to claim 1, characterized in that, In step S2, the DCL1 gene sequence is sequentially linked to the miR162a precursor sequence via the IGG6 sequence, and the DCL1 sequence is modified with an HA fusion tag to form a miR162a-IGG6-DCL1-HA fusion gene unit. The fusion gene unit is under the control of a single yeast strong promoter, and the nucleotide sequence of HA is shown in SEQ ID No.

8.

7. The construction method according to claim 6, characterized in that, In step S2, the specific construction method of the second recombinant expression plasmid is as follows: using pKLAC1 as a vector, the target fragment is fully synthesized, and the target fragment is tandemly connected with the following sequences, namely miR162a precursor (SEQ ID No. 3) + IGG6 sequence (SEQ ID No. 5) + full-length DCL1 CDS region sequence (SEQ ID No. 4), and the HA tag sequence (SEQ ID No. 8) is attached before the DCL1 stop codon.

8. A Kluyveromyces lactis genetically engineered strain obtained by the method described in any one of claims 1-6.

9. The use of the Kluyveromyces lactis genetically engineered strain according to claim 8 in the production of miR162a.

10. The use of the Kluyveromyces lactis genetically engineered strain of claim 8 in the preparation of a medicament or functional product for promoting osteogenic differentiation, preventing and / or treating osteoporosis.

11. A composition comprising a culture, fermentation supernatant, lysate, or miR162a isolated and purified therefrom of the genetically engineered *Kluyveromyces lactis* strain of claim 8.