A method for constructing an SMDT1 gene knockout animal model

Abstract

This invention relates to the field of animal model construction technology, and more particularly to a method for constructing an SMDT1 gene knockout animal model. The method utilizes gene editing technology to enable the animal model to... SMDT1 The sequence shown in SEQ ID No. 1 is missing from the locus. Stable and reliable results can be obtained using the construction method of this invention. SMDT1 Gene knockout animal models do not exhibit recombination repair and can be stably inherited, making them suitable for research. SMDT1 The biological functions of genes and MCU complexes, and their potential applications in... SMDT1 Gene-targeted drug development and guidance for livestock breeding have broad application prospects.

Description

Technical Field

[0001] This invention relates to the field of animal model construction technology, and in particular to a method for constructing an SMDT1 gene knockout animal model. Background Technology

[0002] The mitochondrial calcium uniporter (MCU) complex is a core molecular machine regulating intracellular calcium homeostasis. It plays a crucial role in key biological processes such as energy metabolism, apoptosis, reactive oxygen species (ROS) generation, and signal transduction by mediating the specific uptake of calcium ions by mitochondria. Dysfunction of this complex is closely associated with a variety of diseases, including neurodegenerative diseases, cardiovascular diseases, metabolic syndrome, and tumors.

[0003] SMDT1 The gene (Single-pass membrane protein with aspartate-rich tail 1) encodes a protein with a single-pass transmembrane structure and an aspartate-rich tail, which is an indispensable helper subunit in the MCU complex. Studies have shown that... SMDT1 Through the interaction of its acidic amino acid residues with the MCU pore subunits, it directly participates in regulating the threshold and kinetics of calcium ion transport, which is crucial for maintaining the structural integrity and functional stability of the complex. Therefore, SMDT1 It has become an important target for studying the regulatory mechanism of mitochondrial calcium signaling and developing intervention strategies for related diseases.

[0004] although SMDT1 The biological significance of this gene is becoming increasingly clear, but tools for functional research on this gene remain very limited. Currently, commonly used international mouse resource banks, such as Biocytogen and The Jackson Laboratory, do not offer commercially available [products / services]. SMDT1 Gene knockout mouse model. Meanwhile, a literature search revealed information regarding... SMDT1 Public reports on the preparation and systematic study of gene knockout mice are extremely scarce, which severely restricts the scientific community's in-depth exploration at the in vivo level. SMDT1 Its specific functions and molecular mechanisms under physiological and pathological conditions.

[0005] Therefore, developing a stable and reliable SMDT1 Gene knockout animal models are of urgent technical need and important scientific value for revealing the role of the gene in the calcium signaling network, elucidating its contribution to the occurrence and development of related diseases, and promoting drug development based on MCU complexes. Summary of the Invention

[0006] To solve the above-mentioned technical problems, the present invention provides a SMDT1 Methods for constructing gene knockout animal models, using gene editing technology to make the animal model... SMDT1 The sequence shown in SEQ ID No. 1 is missing from the locus.

[0007] SEQ ID No.1: CCAGGTCCTGTAGAAGTGCTGTCAGTGCTCCTCACCACTGGGCCATCCCTCCAGCCCCGGAACTCACTTTTGGGTGGAGAGAGCTGGTTAGAGCCCAGCCAGCCTAGTGTTCTCACCTAACTTTGTATGGTTCTTGCAAGGAATTAGGTTTGGCCCCTAATTTTGAGTTGCTTAGTTTCCTAAATTTAGTTTAGCTTTATGTTTTTCTTTCT GATATCCATTTTTGGTGGCCATAAAACTCACTTTGTCTCTTCGTTGCTCTGAGTTTCTTCAAAGACTTTAAAAATCGAGTGGTGTGGGGATCAGTAGTCCATTGGAGGCTTGGGCGCAGCCACTGGTCTCCCGGAGTGCACCCATTCTTCTCTCTGCAGATGTCCTTTGGTCTTCTCCGAGTGTTCTCCATTGTGATCCCCTTTCTCTATGTCGGGAC ACTCATCAGCAAGAACTTCGCTGCTCTGCTTGAGGAACATGACATTTTTGTCCCAGAGGATGACGACGACGACGATTAACAGGTAATCCTTGCCCTTCTTGTAAATGGGCAGAAGCAGCAGGCGGATGATCTGCTCTGTGGTGCTCTGGCCTGCGGCACCATCTGAACCCTCAGGGCAGGAGCAGCAGTGGGTTCACCACTCGAGACTTACTCTCTC TCATGTTGGATGACTTACACTCCCACTAGGTTAAGGTCCTCAGTGGCCTTCTCATTGTCCTTGATGGACTTCAGTCAACTGACATTCTCTTAATGTGCTTTTTATTTCATGAAGTCATGCAATCTCTGCCTCAGAGATGGAGGGATAAAACAGCAAATGATGGAGGAGAGGAAAGGGAATGCAGAAGATACCAGTAAGGAGATGGGCAAAGGGTGAT This invention discovers SMDT1 Gene knockout regions and sequences are quite important and have a significant impact. SMDT1 Success rate of gene knockout mouse preparation. When the sequence shown in SEQ ID No. 1 is knocked out, SMDT1 Gene knockout mice have a high success rate in preparation, do not undergo recombination repair, and the animal models can be stably inherited. SMDT- / - mice have a high lethality rate, while SMDT+ / - mice can survive and reproduce normally.

[0008] In some implementations, the animal model is identified using the primer pairs shown in SEQ ID No. 2 and SEQ ID No. 3.

[0009] In some implementations, the animal model is considered successfully constructed when a 321 bp DNA fragment is amplified using the primer pair. SMDT1 Animal models of gene loss of function.

[0010] In some implementations, when a 1184 bp DNA fragment is obtained by amplifying using the primer pair, it indicates that the animal model... SMDT1 The gene was not knocked out.

[0011] SEQ ID No. 2: 5'-GCAGGAGCCAGCTAAAAGAGAA-3' SEQ ID No. 3: 5'-GGGTAAGGATGTGGGTAACTCAA-3' In some implementations, the gene editing technology employs a CRISPR / Cas system; preferably, the CRISPR / Cas system is a CRISPR / Cas9 system.

[0012] In some implementations, the construction method includes: (1) Targeting SMDT1 Design and synthesize gRNA from the second exon region of the gene; (2) Prepare a ribonucleoprotein complex using the gRNA and Cas protein; (3) Gene editing of the target animal using the ribonucleoprotein complex to obtain the desired result. SMDT1 Gene knockout animal models.

[0013] Preferably, the SMDT1 The gene is numbered 69029 in NCBI (NCBI Gene ID: 69029).

[0014] In some embodiments, the gRNA target sequence is shown in SEQ ID No. 4 and / or SEQ ID No. 5.

[0015] SEQ ID No.4: 5'-CCCCGGAACTCACTTTTGGGTGG-3' SEQ ID No. 5: 5'-AGATGGGCAAAGGGTGATCCAGG-3' In some embodiments, step (3) involves injecting the ribonucleoprotein complex into the pronucleus of a fertilized egg of the target animal via microinjection, and obtaining the complex through embryo transfer. SMDT1 Gene knockout animal models.

[0016] In some embodiments, the construction method further includes: identifying the animal model using the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3; when a 321 bp DNA fragment is amplified using the primer pair, the animal model is considered successfully constructed. SMDT1 Animal models of gene loss of function.

[0017] In some implementations, let the SMDT1 Gene knockout animal models obtained by crossbreeding SMDT1 Gene knockout homozygous offspring yield stable offspring. SMDT1 Gene knockout animal models.

[0018] Furthermore, the present invention provides the method for obtaining the aforementioned construction method. SMDT1 Application of gene knockout animal models in livestock breeding.

[0019] Furthermore, the present invention provides the method for obtaining the aforementioned construction method. SMDT1 Application of gene knockout animal models in drug screening.

[0020] For example, by comparison SMDT1 Data from gene knockout animals and wild-type animals can be analyzed. SMDT1 The effects of gene deletion on body composition. For example, if knockout mice are found to have significantly higher muscle mass than wild-type mice, it suggests inhibition. SMDT1 Gene function may contribute to improving meat production performance in livestock and poultry. Therefore, it is possible to: (1) Target verification: confirmation SMDT1 It is a potential target for improving muscle growth.

[0021] (2) Screening substances: Using the animal model as a tool, feed or treat different candidate substances (such as specific nutrients or additives) and observe which substance can simulate or enhance the effect. SMDT1By knocking out animal phenotypes (such as those that further promote muscle growth), growth promoters or drugs that can be used in livestock production can be screened out.

[0022] (3) Guided breeding: The animal model of this invention can directly support breeding in economic animals such as pigs and cattle. SMDT1 Editing or breeding homologous genes to cultivate high-yield new varieties.

[0023] Preferably, the animal is a mouse.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a stable and reliable SMDT1 Gene knockout animal models do not exhibit recombination repair and can be stably inherited, making them suitable for research. SMDT1 The biological functions of genes and MCU complexes, and their potential applications in... SMDT1 Gene-targeted drug development and guidance for livestock breeding have broad application prospects. Attached Figure Description

[0025] Figure 1 yes SMDT1 The results of the construction and identification of gene knockout mice; where A is a schematic diagram of gene editing; B is the screening result of agarose gel electrophoresis; and C is the sequencing diagram.

[0026] Figure 2 yes SMDT1 Weight test results of gene knockout mice and wild-type mice; where A represents... SMDT1 Photographs of gene knockout mice and wild-type mice; B is a line graph of weight change.

[0027] Figure 3 yes SMDT1 Results of respiratory metabolic capacity tests in gene knockout mice and wild-type mice; where A represents oxygen detection results; B represents carbon dioxide detection results; and C represents respiratory exchange rate detection results.

[0028] Figure 4 yes SMDT1 Results of glucose tolerance and insulin tolerance tests in gene knockout mice and wild-type mice; where A represents glucose tolerance test results and B represents insulin tolerance test results. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0030] In the embodiments provided in this specification, unless specific techniques or conditions are specified, the techniques or conditions described in the literature in this field, or the product instructions, shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0031] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art complete the corresponding experiments under the guidance of the operating manuals accompanying various commercial reagent kits or entrust them to specialized companies, such as primer synthesis and gene sequencing.

[0032] Example 1 SMDT1 Construction of gene knockout mouse model 1. gRNA design and synthesis: based on SMDT1 gRNA was designed based on the gene sequence (NCBI Gene ID: 69029), and the target sequences of the gRNA are SEQ ID NO.4 and SEQ ID NO.5.

[0033] The specific steps are as follows: Donor oligo synthesis: Solid-phase support: Starting from the 3' end, the first nucleotide is attached to the solid-phase support via its 3'-OH.

[0034] Cyclic synthesis (4-step cycle): Deprotection: The DMT protecting group at the 5' end of the nucleotide attached to the solid phase is removed with trichloroacetic acid (TCA), exposing the 5'-OH for the next reaction.

[0035] Coupling: The phosphoramidite activator and the new nucleotide monomer with the DMT protecting group enter and undergo a coupling reaction with the exposed 5'-OH.

[0036] Capping: Acetic anhydride and N-methylimidazole are added to "cap" (acetylate) the unreacted 5'-OH groups, preventing them from reacting in the next cycle and causing deletion mutations.

[0037] Oxidation: Trivalent phosphorus is oxidized to more stable pentavalent phosphorus using iodine solution, forming a stable phosphodiester bond.

[0038] Repeat the loop n times until the entire chain is synthesized in sequence from 3' to 5'.

[0039] gRNA synthesis: Design a pair of primers, with the 5' end of the upstream primer containing the T7 promoter sequence (TAATACGACTCACTATA) and the downstream primer containing a portion complementary to the gRNA target sequence.

[0040] Using plasmids or oligos containing the target spacer sequence as templates, PCR amplification was performed to obtain a double-stranded DNA template with the T7 promoter.

[0041] Mix the purified DNA template with the following components: Ribonucleotides (NTPs): a mixture of ATP, CTP, GTP, and UTP, which are the raw materials for RNA synthesis.

[0042] Transcription buffer: Provides optimal pH and ionic environment.

[0043] T7 RNA polymerase: recognizes the T7 promoter and synthesizes crRNA.

[0044] When incubated at 37°C for 2-4 hours, the enzyme will synthesize a large amount of crRNA using DNA as a template.

[0045] 2. Preparation of RNP complex: The synthesized crRNA was mixed in equimolar amounts with tracrRNA purchased from IDT, heated at 95°C for 5 minutes, and then slowly cooled to room temperature to form gRNA. The gRNA was then mixed with Cas9 protein (catalog number: M0646M) from NEB and incubated at room temperature for 10 minutes to form the RNP complex.

[0046] 3. Collection and injection of fertilized eggs: 3-4 week old C57BL / 6J female mice were selected, and after superovulation, they were housed with male mice. Fertilized eggs from the female mice were collected. The RNP complex was microinjected into the male pronucleus of the fertilized eggs.

[0047] 4. Embryo transfer: The injected fertilized eggs were transferred into the oviduct of a pseudopregnant ICR female mouse, and F0 generation mice were obtained through natural delivery.

[0048] 5. Genotyping: At 3 weeks of age, 2-3 mm tail tips were harvested from F0 generation mice, and genomic DNA was extracted using proteinase K lysis. PCR was performed using primers F1 (SEQ ID NO.2) and R1 (SEQ ID NO.3). Positive individuals amplified with a 321 bp band were selected by agarose gel electrophoresis. The PCR products of positive individuals were sequenced.

[0049] 6. Sequencing Validation: The 321 bp PCR product was recovered from the gel and sent for sequencing. Sequencing results were compared with the wild-type sequence, confirming the presence of a precise 863 bp deletion, as shown below: TACTTGCGTGTGAGAGGCCACGTGGGTGCTGAGAACCAGG--del 863 bp—AAGGCATACCACAGGAACTCTCACTTCCTACTTTACATTG. Thus, the wild-type PCR product was successfully obtained. SMDT1 Gene knockout F0 generation heterozygous mice ( Figure 1 ),confirm SMDT1 Gene knockout mouse model SMDT1 The sequence shown in SEQ ID No. 1 is missing from the locus.

[0050] Furthermore, the body weight, respiratory metabolism, and glucose and insulin tolerance of F0 generation heterozygous mice were tested.

[0051] (1) The mice were fed normally under the same conditions for 24 weeks, and their body weight was recorded. The results showed that, compared with wild-type mice (WT group), Smdt1 - / + The mice's body weight increased significantly ( Figure 2 ).

[0052] (2) The metabolic cage device was used to detect changes in the respiratory metabolism of mice, and Smdt1 was found. - / + The oxygen uptake and CO2 excretion of Smdt1 mice were significantly lower than those of wild-type mice. - / + The respiratory exchange rate (RER) of mice did not change significantly, indicating that Smdt1 - / + The respiratory metabolic capacity of mice is weakened. Figure 3 ).

[0053] (3) The glucose tolerance test showed that 30 minutes after injecting glucose into mice, Smdt1 - / + The tolerance of mice was significantly reduced (P<0.05); and in the insulin tolerance test, it was found that Smdt1 was significantly reduced 15 min, 30 min, and 90 min after insulin injection in mice. - / + Compared with WT mice, the mice showed significant differences and decreased tolerance (P<0.05). Figure 4 ).

[0054] Example 2 SMDT1 Breeding and Identification of Gene Knockout Homozygous Mice 1. Breeding: The F0 generation heterozygous mice (numbered 1, 2, 3, 4, 5) obtained in Example 1 were mated with each other to obtain the F1 generation mice.

[0055] 2. Genotyping: Genotyping was performed on F1 generation mice using multiplex PCR. In addition to primer pair F1 / R1 (SEQ ID NO.2 / 3), primer pair F1 / R2 was also used for PCR amplification. F1 / R2 was used to amplify a 591 bp fragment on the wild-type allele.

[0056] R2 (SEQ ID NO.6): 5'-CCAAAGGACATCTGCAGAGAGAA-3' 3. Result determination: (1) Homozygote (- / -): Only a 321 bp band appears (from F1 / R1).

[0057] (2) Heterozygotes (+ / -): A band of 321 bp (from F1 / R1, knockout allele), 591 bp (from F1 / R2, wild-type allele) and a possibly weak 1184 bp band (from F1 / R1, wild-type allele, which may have low amplification efficiency due to its large size).

[0058] (3) Wild type (+ / +): 591 bp and 1184 bp bands appear.

[0059] This method successfully filtered out F1 generation. SMDT1 Gene knockout homozygous mice were used to establish a stable genetic mouse model population, SMDT. - / - High mortality rate in mice, SMDT + / - The mice were able to survive and reproduce normally.

[0060] Example 3 Application SMDT1 Preliminary phenotypic analysis of gene knockout models and their application in livestock breeding 1. Phenotypic analysis: 10-week-old infants were selected. SMDT1 Ten gene knockout homozygous male mice and ten wild-type male mice from the same littermate were dissected and their body composition was analyzed. Body weight, the weight of major internal organs (heart, liver, spleen, lungs, kidneys), and the weight of specific muscles (gastrocnemius, tibialis anterior, extensor digitorum longus, quadriceps femoris, soleus) and adipose tissue (groin fat, scapular fat, perirenal fat, gonadal fat) were measured.

[0061] 2. Expected Results and Applications: By comparing the data from the knockout group and the wild-type group, we can analyze... SMDT1 The effects of gene deletion on body composition. For example, if knockout mice are found to have significantly higher muscle mass than wild-type mice, it suggests inhibition. SMDT1 Gene function may contribute to improving meat production performance in livestock and poultry. Therefore, it is possible to: (1) Target verification: confirmation SMDT1 It is a potential target for improving muscle growth.

[0062] (2) Screening substances: Using this model as a tool, feed or treat different candidate substances (such as specific nutrients or additives) and observe which substance can simulate or enhance the phenotype of knockout mice (such as further promoting muscle growth), thereby screening out growth promoters or drugs that can be used in livestock production.

[0063] (3) Guiding breeding: The results of this study can directly support the development of breeding programs in economically important animals such as pigs and cattle. SMDT1 Editing or breeding homologous genes to cultivate high-yield new varieties.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A kind SMDT1 A method for constructing a gene knockout animal model, characterized in that, Gene editing technology can be used to make animal models SMDT1 The sequence shown in SEQ ID No. 1 is missing from the locus.

2. The construction method according to claim 1, characterized in that, The animal model was identified using the primer pairs shown in SEQ ID No. 2 and SEQ ID No.

3.

3. The construction method according to claim 2, characterized in that, When a 321 bp DNA fragment is amplified using the primer pair, the animal model is successfully constructed. SMDT1 Animal models of gene loss of function.

4. The construction method according to any one of claims 1 to 3, characterized in that, The gene editing technology uses the CRISPR / Cas system; preferably, the CRISPR / Cas system is the CRISPR / Cas9 system.

5. The construction method according to claim 4, characterized in that, The construction method includes: (1) Design and synthesize gRNA targeting the second exon region of the SMDT1 gene; (2) Prepare a ribonucleoprotein complex using the gRNA and Cas protein; (3) Gene editing of the target animal using the ribonucleoprotein complex to obtain the desired result. SMDT1 Gene knockout animal models.

6. The construction method according to claim 5, characterized in that, The gRNA target sequence is shown in SEQ ID No. 4 and / or SEQ ID No.

5.

7. The construction method according to claim 5 or 6, characterized in that, Step (3) involves injecting the ribonucleoprotein complex into the pronucleus of a fertilized egg of the target animal using microinjection, and obtaining the ribonucleoprotein complex through embryo transfer. SMDT1 Gene knockout animal models.

8. The construction method according to claim 5 or 6, characterized in that, The construction method further includes: identifying the animal model using the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3; when a 321 bp DNA fragment is amplified using the primer pair, the animal model is considered successfully constructed. SMDT1 Animal models of gene loss of function; And / or, let the stated SMDT1 Gene knockout animal models obtained by crossbreeding SMDT1 Gene knockout homozygous offspring yield stable offspring. SMDT1 Gene knockout animal models.

9. The method of construction obtained according to any one of claims 1 to 8 SMDT1 Application of gene knockout animal models in livestock breeding.

10. The method of construction obtained according to any one of claims 1 to 8 SMDT1 Application of gene knockout animal models in drug screening.

Images