A breeding method for breeding a polycross improved japonica rice

Abstract

This invention discloses a breeding method for improving japonica rice by cultivating polymorphic lines. This invention integrates the GS3 long-grain gene, PigmR disease-resistant gene, fgr aroma gene, ALS herbicide-resistant gene, and COLD1 cold-tolerant gene into japonica rice. The GS3 long-grain trait successfully compensates for the reduction in thousand-grain weight caused by the PigmR gene. Simultaneously, the COLD1 cold-tolerant genotype repairs the genetic defect of low-temperature intolerance in the GS3 donor parent. Furthermore, it demonstrates the heat-resistant function of GS3 in the context of polymorphic lines, simultaneously improving grain shape, blast resistance, aroma, herbicide resistance, heat tolerance, and low-temperature tolerance. This provides new germplasm for the green and efficient production of japonica rice and has significant application value.

Description

Technical Field

[0001] This invention relates to molecular breeding technology for rice, specifically to a breeding method for cultivating polymer lines to improve japonica rice. Background Technology

[0002] Rice is one of the world's most important food crops, and japonica rice, as the main cultivated type in the middle and lower reaches of the Yangtze River and northern regions of my country, has its yield and quality directly related to food security. However, existing japonica rice varieties generally suffer from one or more of the following technical defects:

[0003] First, the short grain size and low thousand-grain weight limit the potential for further yield improvement.

[0004] Second, insufficient resistance to rice blast: Although PigmR, a broad-spectrum rice blast resistance gene cloned from the rice variety Gumei 4, encodes an NLR immune receptor and can confer resistance to multiple physiological races of rice blast fungus by activating the reactive oxygen species signaling pathway (Deng et al., Epigenetic regulation of antagonistic receptors confers riceblast resistance with yield balance, Cell, 2017), while conferring resistance in japonica rice varieties, PigmR leads to smaller rice seeds and a reduced thousand-grain weight, i.e., there is a "resistance-yield reduction" trade-off effect, which limits its direct application in japonica rice breeding.

[0005] Third, lack of aroma: Although the fgr gene encodes betaine aldehyde dehydrogenase, the loss of its function can lead to the accumulation of 2-acetyl-1-pyrroline (2-AP) in rice grains, which imparts aroma (Chen et al., Fgr, Encoding BetaineAldehyde Dehydrogenase, Inhibits the Biosynthesis of 2-Acetyl-1-Pyrroline, a Major Component in Rice Fragrance, Plant Cell, 2008), its application is mostly in indica rice or specific japonica rice varieties, and there is a lack of high-quality aromatic japonica rice germplasm.

[0006] Fourth, resistance to ALS inhibitor herbicides: The ALS gene encodes acetolactate synthase, and specific point mutations (such as S627N and W548M) can confer resistance to imidazolinone and sulfonylurea ALS inhibitor herbicides in rice, simplifying field weeding management. Although existing technologies have reported the synthesis of ALS, Wx-mp, and fgr, synergistic improvement of multiple traits such as grain shape, disease resistance, aroma, herbicide resistance, heat tolerance, and low-temperature tolerance has not yet been achieved.

[0007] Fifth, some superior germplasm resources suffer from genetic baggage: for example, donor materials carrying the GS3 long-grain allelic variant often also carry the COLD1 cold-intolerant genotype, resulting in low-temperature sensitivity and limiting their application in japonica rice breeding. COLD1 encodes a G protein signaling regulator, and its japonica rice-derived alleles can significantly improve rice cold resistance (Ma et al., COLD1 Confers Chilling Tolerance in Rice, Cell, 2015); current technologies lack methods to repair or compensate for such genetic defects while aggregating superior genes.

[0008] Sixth, there is a lack of systematic verification of heat and cold resistance in the context of multi-gene aggregation: Although the heat resistance of GS3 and the cold resistance of COLD1 have been reported, the existing research is limited to single or double genes, and there is no systematic study on the heat and cold resistance performance of multi-gene aggregation such as GS3, PigmR, fgr, ALS and COLD1 in the context of japonica rice. Summary of the Invention

[0009] Purpose of the invention: The purpose of this invention is to provide a breeding method for cultivating polymer lines to improve japonica rice.

[0010] Technical solution: In order to achieve the above objectives, the present invention provides a breeding method for improving japonica rice by cultivating a hybrid line, the method comprising hybridizing the GS3 mutant gene, PigmR gene, fgr mutant gene, ALS mutant gene and COLD1 mutant gene on japonica rice.

[0011] The nucleotide sequence of the GS3 mutant gene is shown in SEQ ID NO.1, the nucleotide sequence of the PigmR gene is shown in SEQ ID NO.2, the nucleotide sequence of the fgr mutant gene is shown in SEQ ID NO.3, the nucleotide sequence of the ALS mutant gene is shown in SEQ ID NO.4, and the nucleotide sequence of the COLD1 mutant gene is shown in SEQ ID NO.5.

[0012] The breeding method for improving japonica rice by cultivating polymer lines includes the following steps:

[0013] (1) Select rice varieties carrying one or more of the GS3 mutant gene, PigmR gene, fgr mutant gene, ALS mutant gene or COLD1 mutant gene as donor parents or recipient parents.

[0014] Furthermore, the parent carrying the GS3 mutant gene is Yangchan 1901, which also carries the COLD1 cold-intolerant gene; the parent carrying the PigmR gene is Jinxiangyu 1, the parent carrying the fgr mutant gene is Jinxiangyu 1, and the parent carrying the ALS mutant gene is Jinjing 818. All the parents carrying the PigmR, fgr, and ALS genes carry the COLD1 cold-resistant gene.

[0015] (2) The donor parent and the recipient parent are hybridized, and then backcrossed. The five-gene hybrid single plants carrying the GS3 mutant gene, PigmR gene, fgr mutant gene, ALS mutant gene and COLD1 mutant gene are screened by DNA detection.

[0016] The hybridization mentioned above includes single crosses or multiple crosses.

[0017] Furthermore, the hybridization scheme is as follows: Yangchan 1901 is used as the female parent and crossed with Jinxiangyu 1 to obtain F1; Jinjing 818 is used as the female parent and crossed with Nanjing 9108 to obtain F1; F1 carrying different target genes are recrossed to construct an aggregated F1 population; in F2 and subsequent backcross generations, five-gene aggregated single plants carrying the GS3 long-grain mutant gene, PigmR disease resistance gene, fgr fragrance mutant gene, ALS herbicide resistance mutant gene and COLD1 cold-resistant mutant gene are screened generation by generation.

[0018] (3) Homozygous polymorphic lines were obtained by continuous self-pollination of five-gene polymorphic single plants. Phenotypic identification and screening were carried out to obtain polymorphic lines that simultaneously possess long grain length, high thousand-grain weight, resistance to rice blast, fragrance, resistance to ALS inhibitor herbicides, and high seed setting rate under high temperature and low temperature stress.

[0019] The phenotypic identification includes high temperature stress, which requires setting an average daily temperature of ≥30℃ for at least 5 days during the grain-filling stage and measuring the seed setting rate under high temperature stress; the phenotypic identification also includes low temperature stress, which requires setting an average daily temperature of ≤16℃ for at least 7 days during the heading stage and measuring the seed setting rate under low temperature stress.

[0020] Furthermore, other phenotypic identifications are as follows:

[0021] Particle shape and thousand-grain weight determination: Measure particle length, particle width, length-to-width ratio and thousand-grain weight, and compare with the recipient parent.

[0022] Rice blast resistance identification: The resistance level of the polymer line was evaluated by inoculating a mixture of multiple physiological races of rice blast fungus using an artificial inoculation method.

[0023] Detection of aroma compounds: The content of 2-AP in the kernels was determined by gas chromatography-mass spectrometry (GC-MS).

[0024] Herbicide resistance identification: Imidazoline ketone herbicides (methoxydimethalin) were sprayed during the seedling stage, and the survival rate of the plants was investigated.

[0025] Among them, the characteristic of increased thousand-grain weight mentioned in step (3) means that the thousand-grain weight of the improved japonica rice of the polymer line is at least 9.7% higher than that of the control line without the GS3 mutant gene;

[0026] The improved japonica rice produced by the polymer system has a grain length ≥8.0 mm and a thousand-grain weight ≥25.0 g.

[0027] Among them, the high seed setting rate under high temperature stress mentioned in step (3) means that the seed setting rate of the improved japonica rice under high temperature stress is at least 15% higher than that of the recipient parent.

[0028] Among them, the high seed setting rate under low temperature stress mentioned in step (3) means that the seed setting rate of the improved japonica rice under low temperature stress is at least 25% higher than that of the donor parent carrying the GS3 mutant gene.

[0029] Beneficial effects: Compared with the prior art, the present invention has the following beneficial effects:

[0030] (1) The improved japonica rice obtained by the technical solution of the present invention has a grain length ≥8.0 mm, a thousand-grain weight ≥25.0 g, resistance to multiple physiological races of rice blast, 2-AP content ≥60 ng / g, resistance to ALS inhibitor herbicides, a seed setting rate ≥80% under high temperature stress during heading and flowering, and a seed setting rate ≥60% under low temperature stress during booting. It also simultaneously improves six key traits: grain shape, rice blast resistance, aroma, herbicide resistance, heat resistance and low temperature resistance, filling the gap in the existing technology.

[0031] (2) This invention creatively solves the problem of yield reduction caused by the PigmR disease resistance gene and compensates for the negative effect of PigmR leading to a decrease in thousand-grain weight in the existing technology. The thousand-grain weight of the five gene aggregation lines of this invention, namely GS3, PigmR, fgr, ALS and COLD1, is more than 9.7% higher than that of the four gene aggregation lines (without carrying the GS3 long grain genotype), achieving a synergistic improvement in disease resistance and high yield.

[0032] (3) The genetic defect of cold intolerance of COLD1 carried by the GS3 donor parent was discovered and repaired for the first time. Molecular marker-assisted selection was used to target the COLD1 gene, so that the final polymer line carried the cold-resistant COLD1 allele from the background of japonica rice. The seed setting rate of the improved japonica rice under low temperature stress was significantly increased by 25% compared with its GS3 donor parent, and the application barrier of the donor material being intolerant to low temperature was successfully overcome.

[0033] (4) The heat resistance function of GS3 under the background of multi-gene aggregation was verified for the first time. The seed setting rate of the aggregated line of this invention was 15% higher than that of the recipient parent under high temperature stress during the heading and flowering period, providing new germplasm resources for heat-resistant breeding of japonica rice.

[0034] (5) Provides seed source support for green and efficient production of japonica rice: broad-spectrum disease resistance reduces pesticide use, herbicide resistance simplifies field management, long-grain fragrant rice enhances commercial value, and heat and low temperature resistance enhances adaptability to climate change. Attached Figure Description

[0035] Figure 1 A flowchart of the breeding route;

[0036] Figure 2 The figure shows the results of the comparative analysis of grain length and thousand-grain weight of the breeding parents;

[0037] Figure 3 The graph shows the results of the comparative analysis of particle length and thousand-particle weight of the polymer system.

[0038] Figure 4 A graph showing the results of a comparative analysis of thousand-grain weight among different gene combination types;

[0039] Figure 5 Figure showing the results of a comparative analysis of rice blast resistance in polymorphic rice lines;

[0040] Figure 6 Figure showing the resistance performance of polymeric methomyl-methyl herbicide;

[0041] Figure 7 This is a graph showing the comparative analysis results of the settling rate of polymer systems under high-temperature treatment;

[0042] Figure 8 Figure showing the comparative analysis results of the settling rate of polymer systems under low-temperature stress;

[0043] Figure 9 This is a diagram showing the results of salt stress on polymeric plants. Detailed Implementation

[0044] The technical solution provided by the present invention will be described in detail below with reference to the embodiments.

[0045] Example 1

[0046] 1. Parental materials and molecular markers

[0047] In this embodiment, the GS3 (Os03g0407400, LOC9269602) long-particle donor is material Yangchan 1901 (https: / / ngdc.cncb.ac.cn / gsa / browse / CRA042977), which carries a loss-of-function allele with a mutation in exon 2 A / C (vg0316733441) of the GS3 gene. The GS3 mutant gene sequence is shown in SEQ ID NO.1. The Yangchan 1901 donor material was also identified as carrying the COLD1 (Os04g0600800, LOC4336878) cold-intolerant genotype (vg0430315214), the sequence of which is shown in SEQ ID NO.5. The PigmR (KU904633) donor is Jinxiangyu 1 (Su-Shen Dao 20200042, Variety Rights No.: CNA20201001835) carrying the complete coding region of the PigmR gene. The PigmR gene sequence is shown in SEQ ID NO.2. Jinxiangyu 1 also carries the COLD1 cold-resistant genotype, and the COLD1 cold-resistant gene sequence is shown in SEQ ID NO.5. The fgr (Os08g0424500, LOC4345606) donor is Nanjing 9108 (Su-Shen Dao 201306, Variety Rights No.: CNA20101060.9) fragrant rice variety carrying the fgr loss-of-function mutation (7bp deletion in exon 2, sequence shown in SEQ ID NO.3). The parents of Nanjing 9108 also carry the COLD1 cold-resistant genotype (SEQ ID NO.5). The ALS herbicide-resistant donor is a variety carrying ALS. The material with the S627N mutation is Jinjing 818 (National Approval Rice 20180061, Variety Rights No.: CNA20141476.3). The ALS S627N mutation gene sequence is shown in SEQ ID NO.4. The parents of Jinjing 818 also carry the COLD1 cold-resistant genotype (SEQ ID NO.5).

[0048] The GS3 mutant gene is as follows (SEQ ID NO.1, base A is a favorable mutation for long-grained morphology):

[0049] ATGGCAATGGCGGCGGCGCCCCGGCCCAAGTCGCCGCCGGCGCCGCCCGACCCATGCGGCCGCCACCGCCTCCAGCTCGCCGTCGACGCGCTCCACCGCGAGATCGGATTCCTCGAGGGTGAAATAAATTCAATCGAAGGGATCCACGCTGCCTCCAGATGCTG[C / A]AGAGAGGTTGACGAATTCATCGGAAGAACTCCTGATCCATTCATAACGATAGCAAGTGCGTGCTGCCTCAGCTACCTCTCCTGGATCTGCTGCTGCAGCAGCGCCGCCGGCGGCTGCTCATCCTCCTCCTCCTCCTCCTTCAACCTCAAGAGGCCGAGCTGCTGCTGCAACTGCAACTGCAACTGCTGCTCCTCCTCCTCCTCCTCATGTGGGGCGGCGTTAACGAAGAGTCCGTGTCGCTGCCGCCGCCGCAGCTGCTGCTGCCGTCGCTGCTGCTGCGGCGGCGTCGGCGTCCGCGCGTGCGCGAGCTGCAGCTGCTCCCCGCCGTGCGCGTGCTGCGCGCCGCCGTGCGCGGGATGCTCGTGCCGCTGCACCTGCCCGTGCCCGTGCCCCGGCGGCTGCTCCTGCGCGTGCCCGGCGTGCAGGTGCTGCTGCGGCGTCCCTCGTTGCTGCCCCCCCTGCTTGTGA

[0050] The PigmR gene is as follows (SEQ ID NO.2):

[0051]

[0052] The fgr mutant gene is as follows (SEQ ID NO.3, 7bp deletion is a favorable mutation type for increased aroma, i.e., fgr-E2):

[0053]

[0054] The ALS mutant gene is as follows (SEQ ID NO.4, base A is a favorable mutation for resistance to imidazole herbicides):

[0055]

[0056] The following are the cold-resistant mutant genes of COLD1 (SEQ ID NO.5, base A indicates the cold-resistant variant type):

[0057]

[0058] 2. Hybridization

[0059] Using Yangchan 1901 as the female parent, it was crossed with Jinxiangyu 1 to obtain F1. Using Jinjing 818 as the female parent, it was crossed with Nanjing 9108 to obtain F1. The two F1 strains were then repeatedly crossed to obtain the recross F1. The recross F1 was then self-crossed to obtain the F2 population. The breeding process is as follows: Figure 1 As shown. DNA was extracted from the leaves of F2 single plants and sent to Wuhan Jingtai Biotechnology Co., Ltd. for sequencing. The following target plants were obtained through screening:

[0060] (1) Screening was conducted to identify 5-gene aggregation lines simultaneously carrying GS3 (long grain genotype), PigmR (positive), fgr-E2 (homozygous deletion), ALS (S627N mutant), and COLD1 (cold-resistant type). Parental grain length and thousand-grain weight were compared as follows: Figure 2 As shown, two homozygous polymeric lines were obtained through continuous self-pollination, numbered GPBAC-1 and GPBAC-2.

[0061] (2) Select the four-gene polymeric lines carrying PigmR (positive), fgr-E2 (homozygous deletion), ALS (S627N mutant) and COLD1 (cold-resistant genotype) as control lines (excluding GS3 long grain genotype), and obtain two homozygous polymeric lines by continuous self-pollination, numbered PBAC-CK1 and PBAC-CK2.

[0062] (3) Select the four-gene polymeric line carrying GS3 long grain type, fgr-E2 (homozygous deletion), ALS (S627N mutant type) and COLD1 (cold resistant genotype) as the control line (not carrying PigmR), and obtain the homozygous polymeric line by continuous self-pollination, which is numbered GBAC-CK1.

[0063] (4) Select the three-gene polymorphic lines that simultaneously carry fgr-E2 (homozygous deletion), ALS (S627N mutant) and COLD1 (cold-resistant genotype) as control lines (not carrying PigmR and GS3 long grain genotypes), and obtain homozygous polymorphic lines by continuous self-pollination, numbered BAC-CK.

[0064] 3. Phenotypic identification results

[0065] (1) Particle shape and thousand-grain weight

[0066] Grain length and thousand-grain weight were measured using a TS-G fully automated phenotypic analyzer (Hangzhou Shangsheng Instruments) on the 5-gene aggregated single plants GPBAC-1 and GPBAC-2, and the 4-gene aggregated single plant control lines PBAC-CK1 and PBAC-CK2 (which do not have the GS3 long-grain genotype). Specifically, 500–1000 plump, undamaged rice grains were randomly selected and evenly spread on a sample scanning plate (avoiding grain overlap). Images were then photographed using a scanner or high-resolution camera. The images were imported into a rice variety evaluation model for automatic identification, and the total number of grains N and the length a of each grain were calculated. i (Unit: mm). Then, all the grains were weighed using an electronic balance (model: FA2004, accuracy 0.0001 g) to obtain the total weight b (unit: g).

[0067] Based on the above data, calculate the following trait indicators:

[0068] Average grain length (GL, mm):

[0069]

[0070] 1000-grain weight (TGW, g):

[0071]

[0072] The results are shown in Table 1 and Figure 3 As shown, the thousand-grain weight of the polymer lines GPBAC-1 and GPBAC-2 was 2.5-3.2 g (+12.2%~+9.7%) higher than that of the four-gene polymer lines PBAC-CK1 and PBAC-CK2 (excluding the GS3 long-grain genotype), and the grain length was 0.16-0.56 mm (+2.0%~+6.8%) higher. The significant increase in thousand-grain weight and grain length proves that the GS3 long-grain allele successfully compensated for the negative yield effect caused by PigmR.

[0073] Table 1 Particle type and thousand-grain weight

[0074]

[0075] To investigate the effects of GS3 and PigmR on grain weight and length in more detail, we compared pairwise aggregate lines with different gene combinations. The results are as follows: Figure 4As shown: A and C represent the negative effects of the PigmR gene on grain length and thousand-grain weight yield; B indicates that rice lines introduced with both GS3 and PigmR can significantly increase the thousand-grain weight; and the co-introduction of GS3 and PigmR genes not only compensates for the thousand-grain weight loss caused by PigmR introduction, as shown in D, but also, as shown in E, significantly increases the thousand-grain weight compared to lines introduced with GS3 alone. This indicates that the co-introduction of GS3 and PigmR into rice lines can synergistically increase the thousand-grain weight of the grains.

[0076] In summary, the thousand-grain weight of the GS3, PigmR, fgr, ALS and COLD1 5 gene aggregation lines was more than 9.7% higher than that of the 4 gene aggregation lines control (which did not carry the GS3 long grain genotype), achieving a synergistic improvement in disease resistance and yield.

[0077] (2) Identification of rice blast resistance

[0078] 1 ml of a mixed bacterial suspension of rice blast fungus was artificially inoculated into the polymer lines GPBAC-1 and GBAC-CK1 respectively. (The rice blast fungus suspension was purchased from the Plant Protection Institute of Jiangsu Academy of Agricultural Sciences, with a concentration of 10). 5 (Spores / mL). The analysis of rice blast resistance was based on the grading standards for single-panicle loss rate of rice blast in the "Technical Specifications for Identification and Evaluation of Rice Blast Resistance in Rice Variety Trials" (NY / T2646-2014). The classification standards are as follows: Grade 0, disease-free; Grade 1, disease on small branches, loss rate ≤5.0% per panicle; Grade 3, disease on the main axis or panicle neck, loss rate 5.1%-20.0% per panicle; Grade 5, disease on the main axis or panicle neck, grains partially shriveled, loss rate 20.1%-50.0% per panicle; Grade 7, disease on the panicle neck, most grains shriveled, loss rate 50.1%-70.0% per panicle; Grade 9, disease on the panicle, loss rate >70.0% per panicle. Results are as follows... Figure 5 The results showed that the average disease grade of the polymer line GBAC-CK1, which does not carry PigmR, was 7-9 (susceptible), while the average disease grade of the polymer line GPBAC-1 was 1-2 (resistant). This indicates that PigmR is normally expressed in the polymer lines, has broad-spectrum disease resistance, and its disease resistance function is not affected by other genes.

[0079] (3) Detection of aroma substance content

[0080] GC-MS results showed that the 2-AP content in Yangchan 1901 rice was 0, while the 2-acetyl-1-pyrroline (2-AP) content in the 5-gene polymerase lines GPBAC-1 and GPBAC-2 rice was 60.01 ng / g and 78.25 ng / g, respectively, meeting the standard for fragrant rice.

[0081] (4) Herbicide resistance identification

[0082] Spraying methoxyfenozide (305 g / ha of active ingredient) during the seedling stage and investigating 14 days later yielded the following results: Figure 6 As shown, all parent donor lines, Yangchan 1901, died, while the polymer lines GPBAC-1 and GPBAC-2 had a 100% survival rate and grew normally. This indicates that the herbicide resistance sites in ALS function normally.

[0083] (5) Heat resistance test

[0084] High-temperature stress was applied during the heading and flowering stage. The treatment group experienced natural high temperatures (daily average temperature greater than 30℃, maximum temperature greater than 35℃, lasting for 5 days), while the control group experienced natural conditions (daily average temperature 26.8℃). Results Figure 7 As shown, the average seed setting rate of the polygenic line GPBAC-1 under high temperature stress was 82%, while the average seed setting rate of the control line PBAC-CK1 (which does not carry the GS3 long grain genotype) was 67%. The improved japonica rice of the polygenic line had a 15% higher seed setting rate under high temperature stress than the line without the GS3 long grain genotype, indicating that the GS3 long grain allele can still effectively exert its heat resistance function in the context of multi-gene polygenic integration.

[0085] (6) Low temperature resistance assessment

[0086] By delaying sowing and transplanting, the rice seedlings were subjected to natural low-temperature stress (average daily temperature of 16℃ for 7 consecutive days) during the booting stage, and the results were as follows: Figure 8 As shown: the seed setting rate of the donor parent Yangchan 1901 after low temperature stress treatment was 37%; the seed setting rates of the polymer lines GPBAC-1 and GPBAC-2 carrying the COLD1 gene ranged from 62% to 69%, with an average of 66%. The seed setting rate of the five-gene polymer lines under low temperature stress was at least 25% higher than that of the GS3 mutant gene donor Yangchan 1901, proving that the present invention successfully repaired the genetic defect of the GS3 donor parent's intolerance to low temperatures by introducing the COLD1 cold-resistant genotype.

[0087] (7) Salt and alkali tolerance test

[0088] Salt tolerance was assessed using hydroponics in a salt pond with a salt concentration of 5 parts per thousand and a pH of 5.5. The results are as follows: Figure 9 As shown, the donor parent line Yangchan 1901 (carrying the GS3 long grain genotype) and the polymer line GPBAC-1 (carrying the GS3 long grain genotype) can head under salt stress treatment, while the control line PBAC-CK1 (not containing the GS3 long grain genotype) cannot head under salt stress treatment.

[0089] 4. Comprehensive evaluation and variety selection

[0090] Based on multiple indicators, superior varieties were screened. Among them, GPBAC-1 was selected as a high-yielding, high-quality, efficient, heat-resistant, low-temperature resistant and herbicide-resistant new japonica rice line because it met the following criteria: grain length ≥8.0 mm, thousand-grain weight ≥25.0 g, resistance to multiple physiological races of rice blast reaching level 2, 2-AP content ≥60.01 ng / g, 100% resistance to ALS inhibitor herbicides, high-temperature seed setting rate ≥80%, and low-temperature seed setting rate ≥62%.

Claims

1. A breeding method for cultivating polytropic lines to improve japonica rice, characterized in that, The method involves aggregating the GS3 mutant gene, PigmR gene, fgr mutant gene, ALS mutant gene, and COLD1 mutant gene on japonica rice.

2. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 1, characterized in that, The GS3 mutant gene sequence is shown in SEQ ID NO.1, the PigmR gene sequence is shown in SEQ ID NO.2, the fgr mutant gene sequence is shown in SEQ ID NO.3, the ALS mutant gene sequence is shown in SEQ ID NO.4, and the COLD1 mutant gene sequence is shown in SEQ ID NO.

5.

3. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 1, characterized in that, Includes the following steps: (1) Select rice varieties carrying one or more of the GS3 mutant gene, PigmR gene, fgr mutant gene, ALS mutant gene or COLD1 mutant gene as the donor parent or recipient parent. (2) The donor parent and the recipient parent are hybridized, and then backcrossed. The five-gene hybrid single plants carrying the GS3 mutant gene, PigmR gene, fgr mutant gene, ALS mutant gene and COLD1 mutant gene are screened by DNA detection. (3) Homozygous polymorphic lines were obtained by continuous self-pollination of five-gene polymorphic single plants. Phenotypic identification and screening were carried out to obtain polymorphic lines that simultaneously possess long grain length, high thousand-grain weight, resistance to rice blast, fragrance, resistance to ALS inhibitor herbicides, and high seed setting rate under high temperature and low temperature stress.

4. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 3, characterized in that, The hybridization described in step (2) includes single cross or multiple cross.

5. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 3, characterized in that, The phenotypic identification mentioned in step (3) includes high temperature stress, which requires setting the average daily temperature ≥30℃ for at least 5 days during the grouting period and measuring the grain setting rate under high temperature stress.

6. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 3, characterized in that, The phenotypic identification described in step (3) also includes low temperature stress, which requires setting a low temperature stress treatment with an average daily temperature of ≤16℃ for at least 7 days during the heading stage, and measuring the seed setting rate under low temperature stress.

7. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 3, characterized in that, The high thousand-grain weight mentioned in step (3) means that the thousand-grain weight of the improved japonica rice of the polymer line is at least 9.7% higher than that of the control line that does not carry the GS3 mutant gene of claim 1 or 2.

8. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 3, characterized in that, The improved japonica rice of the polymer system described in step (3) has a grain length ≥8.0 mm and a thousand-grain weight ≥25.0 g.

9. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 3, characterized in that, The high seed setting rate under high temperature stress mentioned in step (3) means that the seed setting rate of the improved japonica rice under high temperature stress is at least 15% higher than that of the line without the GS3 long grain genotype.

10. The breeding method for improving japonica rice by cultivating polytropic lines according to claim 3, characterized in that, The high seed setting rate under low temperature stress mentioned in step (3) means that the seed setting rate of the improved japonica rice under low temperature stress is at least 25% higher than that of the parent carrying the GS3 mutant gene donor as described in claims 1 and 2 or the GS3 mutant gene donor as described in claim 3.

Images