High-efficiency chitinase based on domain recombination and preparation method and application thereof

By constructing a chitinase ChiB, the problem of insufficient catalytic activity and binding capacity of existing chitinases on highly crystalline natural chitin substrates is solved, realizing the efficient degradation and resource utilization of highly crystalline natural chitin, and possessing good environmental adaptability and industrial application potential.

CN122357504APending Publication Date: 2026-07-10JIANGSU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGSU UNIV
Filing Date
2026-05-06
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing chitinases have insufficient catalytic activity and substrate binding capacity on highly crystalline natural chitin substrates, making it difficult to achieve efficient degradation.

Method used

The binding and catalytic domains of the chitinase genes chiCHam and chiAHas from the halophilic archaea Halomicrobium mukohataei ZP60 and Halocatena salina AD-1T were fused using overlap extension PCR to construct the fused chitinase ChiB, which enhances its degradation efficiency for highly crystalline natural chitin.

Benefits of technology

It significantly improves the enzyme's binding and catalytic ability to highly crystalline natural chitin substrates, enhances the utilization rate of chitin resources, and possesses salt tolerance and resistance to various metal ions, organic solvents, and surfactants, making it suitable for preparing high-value-added products such as chitosan oligosaccharides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122357504A_ABST
    Figure CN122357504A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering and relates to a fusion-type halophilic archaea chitinase, its preparation method, and its applications. Based on chitinase domains from different halophilic archaea, this invention uses overlap extension PCR technology to fuse a chitin-binding domain with strong substrate-binding ability with a catalytic domain with high catalytic activity, thereby constructing a fusion gene. chiB A fusion-type chitinase was obtained through expression and purification. This fusion-type chitinase possesses both catalytic activity and substrate-binding ability, exhibiting excellent degradation efficiency for natural chitin substrates, as well as good salt tolerance and resistance to metal ions, organic solvents, and surfactants. The prepared enzyme can not only be used for chitin degradation, but the degradation products can also be used to prepare chitosan oligosaccharides or N-acetylglucosamine, showing broad market application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a method for preparing halophilic archaeal chitinase constructed by fusing a catalytic domain with a chitin-binding domain and its application. Background Technology

[0002] Chitin is a linear polysaccharide polymer composed of N-acetyl-D-glucosamine as its basic structural unit, linked by β-1,4-glycosidic bonds. Chitin is the second largest natural biopolymer on Earth after cellulose, primarily found in the exoskeletons of crustaceans (such as shrimp and crab) and the cell walls of fungi. It is estimated that approximately 6 to 8 million tons of seafood processing waste, mainly composed of crab, shrimp, and lobster shells, are generated globally each year. Currently, these shrimp and crab shell wastes are mainly used for the development of low-value-added products such as animal feed. With the active exploration of non-lignocellulose biomass feedstocks in fourth-generation bioethanol production, chitin is considered a potential alternative substrate, providing a new approach to the utilization of shrimp and crab shell waste. However, the highly crystalline structure of chitin limits its application potential in bioethanol production; pretreatment of chitin can significantly improve conversion efficiency. Compared to chitin itself, its degradation products, chitin oligosaccharides or monosaccharides, exhibit a wide range of biological functions. Chitosan oligosaccharides possess various physiological activities, including antibacterial, antioxidant, immunomodulatory, lipid-lowering, and blood pressure-lowering effects. They have been approved as "new food raw materials" and show broad application prospects in agriculture, medicine, health care, biomedicine, and food industries. Therefore, hydrolyzing chitin is an effective way to achieve high-value utilization of chitin resources.

[0003] Halophilic archaea are unique life forms capable of surviving under a variety of extreme conditions. The enzymes they produce typically possess salt tolerance, organic solvent tolerance, and metal ion tolerance. These advantageous physicochemical properties make halophilic archaea and their enzymes suitable for various industrial production processes and biotechnological applications. Therefore, halophilic archaea provide an important resource for the development of broadly adaptable chitinases. However, most reported chitinases still have significant limitations in practical applications: on the one hand, their chitin-binding domains have weak binding capacity to insoluble chitin substrates, making them difficult to effectively act on natural chitin; on the other hand, their degradation efficiency for highly crystalline natural chitin is low. Furthermore, existing chitinases generally cannot simultaneously possess both high catalytic activity and strong substrate binding capacity.

[0004] Current research largely focuses on the screening and characterization of chitinases, with a lack of studies on improving enzyme catalytic performance through protein engineering and domain fusion strategies. Therefore, developing a fusion chitinase possessing both high catalytic activity and strong substrate binding capacity for natural chitin substrates is of great significance for improving the efficient conversion and utilization of chitin resources. Summary of the Invention

[0005] To address the shortcomings of existing chitinases in simultaneously possessing high catalytic activity and strong substrate binding capacity, this invention provides a fusion chitinase derived from halophilic archaea, constructed based on a domain fusion strategy, and its preparation method. This invention recombines the domains of chitinases from different halophilic archaea to construct a fusion chitinase that combines high catalytic activity with strong substrate binding capacity, thereby significantly improving its degradation efficiency for highly crystalline natural chitin substrates.

[0006] This invention is based on halophilic archaea. Halomicrobium mukohataei ZP60 and Halocatena salina AD-1 T The two chitinase genes in the genome are named... chiC Ham and chiA Has The nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively, and the encoded amino acid sequences are shown in SEQ ID No. 6 and SEQ ID No. 7, respectively. chiC Ham The encoded chitinase has a strong binding capacity to natural chitin substrates, while chiA Has The encoded chitinase exhibits high catalytic activity. Protein domains perform specific biological functions; domains often possess independent catalytic activity or substrate recognition capabilities, a characteristic that makes them valuable in recombinant enzyme engineering and combinatorial biosynthesis research. Chitinases derived from halophilic archaea typically contain multiple domains, including a core catalytic domain and auxiliary modules such as a chitin-binding domain. The chitin-binding domain is responsible for enzyme attachment and binding to the substrate, while the catalytic domain catalyzes the hydrolysis reaction. Based on this, this invention utilizes overlap extension PCR technology to... chiC Ham Chitin-binding structural domains in chiA Has The catalytic domains in the gene were fused to construct a fusion gene. chiBIts nucleotide sequence is shown in SEQ ID No. 3, and the encoded fusion chitinase is named ChiB, with its amino acid sequence shown in SEQ ID No. 8. The halophilic archaea used in this study... Halomicrobium mukohataei ZP60 and Halocatena salina AD-1 T These are routinely disclosed strains, deposited at the China General Microbiological Culture Collection Center (CGMCC), with CGMCC No. 1.6192 and CGMCC No. 1.13724, respectively.

[0007] This invention relates to a method for preparing the above-mentioned chitinase fusion, specifically comprising the following steps: (1) Construct pTA04- chiB Recombinant expression plasmid; Based on halophilic archaea Halomicrobium mukohataei ZP60 and Halocatena salina AD-1 T Two chitinase genes chiC Ham and chiA Has Its nucleotide sequence is shown in SEQ ID No. 1 and SEQ ID No. 2; using overlap extension PCR technology, the nucleotide sequence is... chiC Ham Chitin-binding structural domains and chiA Has The catalytic domains in the structure are fused (the specific fusion operation is as follows: first, design extension primers, and then obtain the catalytic domains in the structure through the first PCR amplification). chiA Has Product 1 (sequence shown in SEQ ID No. 4), containing the catalytic domain, was amplified by a second PCR to obtain a product containing... chiC Ham Product 2 (sequence shown in SEQ ID No. 5), containing the chitin-binding domain, was used as a template for a third PCR amplification with purified product 1 and product 2 to obtain a product that combines the chitin-binding domain with... chiA Has Catalytic domain and chiC Ham The product of chitin-binding domains (i.e., the fusion of two domains) is named... chiB Its nucleotide sequence is shown in SEQ ID No. 3; then, the amplified target gene fragment was ligated to the pTA04 vector using molecular cloning technology to construct the recombinant plasmid pTA04- chiB ; The extension primer: 1-F: 5'-GGCGCGATCCCGGAGAACGGGGGCGACCGATTCGACC-3' 2-R: 5'-GGTCGAATCGGTCGCCCCGTTCTCCGGGATCGCGCC -3' The specific procedures for the three PCR tests are as follows: First PCR (to obtain samples with...) chiA Has Product of catalytic domain (I): Primer 1-F: 5'- GGCGCGATCCCGGAGAACGGGGCGACCGATTCGACC -3'; 1-R- Sph I: 5'-ATAGCATGCTACGGTTTGATTGATCGT-3'.

[0008] PCR amplification system (25 µL): 2 × PCR Master mix (12.5 µL), 1-F (10 µM, 1 µL), 1-R- Sph I (10 µM, 1 µL), DNA template (2 µL), ddH2O (8.5 µL). The PCR amplification program was set as follows: Step 1: Denaturation pre-determination at 95 °C for 5 min; Step 2: Determination at 95 °C for 30 s; Step 3: Annealing at 50 °C for 30 s; Step 4: Extension at 72 °C for 1 min (Steps 2 to 4 were repeated 30 times); Step 5: Extension at 72 °C for 10 min; Step 6: Cooling down to 4 °C.

[0009] Second PCR (to obtain samples with...) chiC Ham Product of chitin-binding structural domain (II) Primer 2-F- Eco RI: 5'-CGCGAATTCCAGCAAGAGTACCCGACG -3'; 2-R: 5'-GGTCGAATCGGTCGCCCCGTTCTCCGGGATCGCGCC-3'.

[0010] PCR amplification system (25 µL): 2 × PCR Master mix (12.5 µL), 2-F- EcoRI (10 µM, 1 µL), 2-R (10 µM, 1 µL), DNA template (2 µL), ddH2O (8.5 µL). The PCR amplification program was set as follows: Step 1: Denaturation pre-determination at 95 °C for 5 min; Step 2: Determination at 95 °C for 30 s; Step 3: Annealing at 50 °C for 30 s; Step 4: Extension at 72 °C for 1.5 min (Steps 2 to 4 were repeated 30 times); Step 5: Extension at 72 °C for 10 min; Step 6: Cooling down to 4 °C.

[0011] The third PCR (achieving the fusion of the chitin-binding domain and the catalytic domain): Primer 2-F- Eco RI: 5'-CGCGAATTCCAGCAAGAGTACCCGACG -3'; 1-R- Sph I: 5'-ATAGCATGCTACGGTTTGATTGATCGT-3'.

[0012] PCR amplification system (25 µL): 2 × PCR Master mix (12.5 µL), 2-F- Eco RI (10 µM, 1 µL), 1-R- Sph I (10 µM, 1 µL), DNA template (2 µL), ddH2O (8.5 µL). The PCR amplification program was set as follows: Step 1: Denaturation pre-determination at 95 °C for 5 min; Step 2: Determination at 95 °C for 30 s; Step 3: Annealing at 50 °C for 30 s; Step 4: Extension at 72 °C for 2 min (Steps 2 to 4 were repeated 30 times); Step 5: Extension at 72 °C for 10 min; Step 6: Cooling down to 4 °C.

[0013] (2) Transformation of recombinant plasmids Haloferax volcanii ; The recombinant plasmid pTA04- obtained in step (1) chiB The halophilic archaea were transformed into a host cell, and the recombinant host cells were inoculated into Hv-YPC liquid medium for culture. The cell slurry that reached the stationary phase was centrifuged, and the cells were collected and stored for later use. (3) Purification by fusion of halophilic archaea with chitinase; The bacterial cells collected in step (2) were resuspended in cell lysis buffer, the cells were sonicated and the supernatant was collected by centrifugation and purified by nickel affinity chromatography. Imidazole was removed by AKTA desalting column to obtain high-purity halophilic archaea fusion chitinase ChiB.

[0014] Preferably, the halophilic archaea expression host in step (2) is Haloferax volcanii Purchased from the Japan Microbial Culture Collection (JCM), with culture accession number JCM 8879.

[0015] Preferably, the Hv-YPC liquid culture medium in step (2) consists of the following components per liter: 5.0 g yeast extract, 1.0 g soybean peptone, 1.0 g acid-hydrolyzed casein, 4.2 g KCl, 33.0 g MgSO4·7H2O, 30.0 g MgCl2·6H2O, 144.0 g NaCl, 12.0 mL 1 M, pH 8.0 Tris-HCl, and 0.33 g CaCl2. The above components are diluted to 1 L with distilled water, and the pH is adjusted to 7.5.

[0016] Preferably, the culture conditions in step (2) are 37 ℃, 160 rpm, and culture for 3-4 days; the centrifugation conditions are 4 ℃, 8000 rpm, and centrifugation for 10-15 min.

[0017] Preferably, the storage temperature in step (2) is -20 ℃.

[0018] Preferably, the cell lysis buffer in step (3) consists of: 2 M NaCl, 50 mM Tris-HCl, and pH 8.0.

[0019] Preferably, the conditions for ultrasonic cell disruption in step (3) are: ultrasonic time 3 s, interval 5 s, power 200W, and total time 30 min.

[0020] Preferably, the purification steps of nickel column affinity chromatography in step (3) are as follows: wash the column with 20 column bed volumes of ddH2O, and then equilibrate the nickel column with 20 column bed volumes of cell lysis buffer; centrifuge the cell lysis buffer and take the supernatant to load onto the column; elute the impurities with 20 ml of buffer I; and elute the target protein with 10 ml of buffer II.

[0021] Preferably, the components of buffer I are: 40 mM imidazole, 2 M NaCl, 50 mM Tris-HCl, pH 8.0.

[0022] Preferably, the components of buffer II are: 100 mM imidazole, 2 M NaCl, 50 mM Tris-HCl, pH 8.0.

[0023] Preferably, the step of removing imidazole by the AKTA desalting column in step (3) is as follows: concentrate the enzyme solution purified by nickel column affinity chromatography, and remove imidazole by the AKTA desalting column using buffer III.

[0024] Preferably, the components of buffer III are: 2 M NaCl, 50 mM Tris-HCl, pH 8.0.

[0025] The halophilic archaea fusion chitinase ChiB prepared by this invention can be applied to the degradation of chitin resources, including chitin powder and shell powder of crustaceans; the degradation products can be used to make functional foods and fortify nutrients, specifically for the preparation of chitin oligosaccharides or N-acetylglucosamine.

[0026] Preferably, the degradation reaction system consists of chitin resources, chitinase ChiB, and enzyme activity assay buffer; each 100 μL of the reaction system contains 0.3 mg of chitin resources, 1 μg of chitinase ChiB, and the remainder of enzyme activity assay buffer; wherein, the chitin resources include chitin powder, shrimp shell powder, or crab shell powder; the enzyme activity assay buffer is composed of 1-3 M NaCl, pH 6.0, and 0.1 M phosphate buffer. Specific operation: The reaction system is reacted in a water bath at 45-50 ℃ for 30-40 min; after the reaction is completed, the reaction is terminated under a metal bath at 100 ℃ for 3 min, thereby achieving the degradation of chitin resources.

[0027] This invention is used for the degradation of chitin resources, which can effectively improve the utilization rate of chitin resources.

[0028] The beneficial effects of this invention are: (1) The present invention will chiC Ham The chitin-binding domain in the middle has a strong ability to bind to natural chitin substrates, and... chiA Has By constructing a chitinase ChiB with two fusion domains—a catalytically active domain—using overlap-extension PCR, a chitinase with two domains was developed. Based on this, synergistic optimization of the two functional domains was achieved, significantly enhancing the enzyme's binding and catalytic abilities to highly crystalline natural chitin substrates, resulting in a significant improvement in the degradation efficiency of highly crystalline natural chitin substrates. (2) The fusion chitinase described in this invention has good environmental adaptability, including salt tolerance and tolerance to a variety of metal ions, organic solvents and surfactants. It can play a stable role in complex systems and is used to prepare high value-added products such as chitin oligosaccharides, and has good industrial application potential. Attached Figure Description

[0029] Figure 1 To successfully construct plasmid pTA04- chiB The enzyme digestion verification diagram.

[0030] Figure 2 pTA04- chiB Transformation Haloferax volcanii Transformer verification diagram.

[0031] Figure 3 This is an SDS-PAGE electrophoresis image of ChiB purified by nickel column affinity chromatography.

[0032] Figure 4 The graph shows the effect of temperature on the catalytic activity of ChiB.

[0033] Figure 5 The graph shows the effect of NaCl concentration on the catalytic activity of ChiB.

[0034] Figure 6 The graph shows the effect of pH on the catalytic activity of ChiB.

[0035] Figure 7 The figure shows the stability analysis results of ChiB at different temperatures.

[0036] Figure 8 The figure shows the stability analysis results of ChiB at different NaCl concentrations.

[0037] Figure 9 The figure shows the stability analysis results of ChiB under different pH conditions.

[0038] Figure 10 The graph shows the effects of different metal ions, organic solvents, and surfactants on the catalytic activity of ChiB.

[0039] Figure 11 This is a comparison of the degradation activities of ChiB and the original enzyme on colloidal chitin.

[0040] Figure 12 This is a comparison chart of the degradation capabilities of ChiB and the original enzyme for insoluble chitin powder.

[0041] Figure 13 This is a graph showing the binding capacity of ChiB and the original enzyme to insoluble chitin. Detailed Implementation

[0042] The present invention will be further described below with reference to the accompanying drawings and specific implementation examples. Example 1:

[0043] Recombinant plasmids were constructed based on restriction endonucleases. (1) Obtaining the target gene after domain fusion based on overlap extension PCR technology Inoculation loop picking Halocatena salina AD-1 TThe bacterial cells were placed in 50 µL ddH2O and boiled at 100 °C for 10 min to lyse the cells. This was used as the first template for DNA amplification to perform the first PCR, and the first PCR product was obtained (the sequence is shown in SEQ ID No. 4). Inoculation loop picking Halomicrobium mukohataei ZP60 cells were added to 50 µL ddH2O and boiled at 100 °C for 10 min to lyse the cells. This was used as a second template for DNA amplification to perform a second PCR, yielding the second PCR product (sequence shown in SEQ ID No. 5).

[0044] After the first two PCR products were detected by agarose gel electrophoresis under UV light, the target fragment was excised and purified using a DNA gel extraction kit. This purified fragment was then used as a template for the third PCR. The third PCR product was also purified using a DNA gel extraction kit to obtain the purified third PCR product (sequence shown in SEQ ID No. 3).

[0045] The specific procedures for the three PCR tests are as follows: First PCR (to obtain samples with...) chiA Has Product of catalytic domain (I): Primer 1-F: 5'- GGCGCGATCCCGGAGAACGGGGCGACCGATTCGACC -3'; 1-R- Sph I: 5'-ATAGCATGCTACGGTTTGATTGATCGT-3'.

[0046]

[0047] Second PCR (to obtain samples with...) chiC Ham Product of chitin-binding structural domain (II) Primer 2-F- Eco RI: 5'-CGCGAATTCCAGCAAGAGTACCCGACG -3'; 2-R: 5'-GGTCGAATCGGTCGCCCCGTTCTCCGGGATCGCGCC-3'.

[0048]

[0049] The third PCR (achieving the fusion of the chitin-binding domain and the catalytic domain): Primer 2-F- EcoRI: 5'-CGCGAATTCCAGCAAGAGTACCCGACG -3'; 1-R- Sph I: 5'-ATAGCATGCTACGGTTTGATTGATCGT-3'.

[0050]

[0051] (2) Enzyme digestion of the target gene and vector The purified third PCR product was used with the pTA04 vector in a metal bath. Eco RI and Sph The target gene was double-digested with restriction endonucleases at 37 °C for 30 min. The digested products were then purified again using a DNA gel extraction kit to obtain the digested and purified target gene. chiB (The nucleotide sequence is shown in SEQ ID No. 3) and the vector.

[0052] (3) Ligation of the target fragment with the pTA vector target gene chiB The pTA04 vector was ligated with T4 DNA ligase at 16 °C for 2 h.

[0053] Connection system (10 µL):

[0054] (4) Transformation of Escherichia coli DH5α Add 10 µL of the ligation system to 100 µL of E. coli DH5α competent cells, incubate on ice for 30 min, heat shock at 42℃ for 90 s in a metal bath, remove and incubate on ice again for 2 min. Then, in a clean bench, add 500 µL of LB liquid medium to the competent cells containing the ligation system and incubate on a shaker for 50 min (37 ℃, 160 rpm). Take 200 µL of the bacterial culture and spread it evenly on LB agar plates containing ampicillin. Incubate overnight at 37℃ (12-15 h) to obtain positive transformants that are verified by PCR.

[0055] (5) Plasmid extraction and validation Add the PCR-verified positive transformants to LB liquid medium supplemented with ampicillin and incubate overnight (37 °C, 12-15 h). Extract the plasmid using a plasmid DNA mini-extraction kit and perform enzyme digestion verification. Observe the enzyme digestion products under UV light by agarose gel electrophoresis to determine whether the plasmid has been successfully constructed.

[0056]

[0057] The enzyme digestion products were verified by agarose gel electrophoresis, such as... Figure 1 The image shown is a diagram verifying the successful plasmid digestion; lane M represents the DNA marker, and lane 1 indicates the result of double plasmid digestion; from Figure 1 This shows that the target gene can be obtained after plasmid digestion with enzymes. chiB The plasmid was successfully constructed using the pTA04 vector. After sequencing verification, the plasmid was stored at -20 °C. Example 2:

[0058] halophilic archaea chitinase gene chiB expression Transform the correct recombinant plasmid into the target cell using PEG-mediated transformation. Haloferax vocanii In this study, the red transformants on Hv-YPC plates were verified by PCR under the same conditions as the third PCR in Example 1 (1), and the correct positive transformants were finally obtained. The obtained correct positive transformants were then inoculated into Hv-YPC liquid culture medium. The liquid culture medium containing the positive transformants was incubated at 37 °C and 160 rpm for 3 days. Then, 1% (v / v) of the inoculum was inoculated into 200 mL of Hv-YPC liquid culture medium. After incubation until the stationary phase, the culture was centrifuged, and the centrifuged cells were stored at -20 °C. Figure 2 As shown, it is pTA04- chiB Transformation Haloferax volcanii Transformant validation diagram, where lane M represents the DNA marker and lane 1 indicates the transformant validation result; from Figure 2 This shows that the recombinant plasmid was successfully transformed into... Haloferax vocanii middle. Example 3:

[0059] Purification of halophilic archaea chitinase ChiB (amino acid sequence shown in SEQ ID No. 8) (1) The bacterial cells collected in Example 2 were resuspended in 40 mL of cell lysis buffer (2 M NaCl, 50 mM Tris-HCl, pH 8.0), and sonicated on ice. The supernatant was collected by centrifugation at 4 °C for subsequent purification.

[0060] (2) Wash the column with 20 times the column bed volume of ddH2O, and then equilibrate the nickel column with 20 times the column bed volume of cell lysis buffer.

[0061] (3) Load the supernatant onto the column and repeat twice.

[0062] (4) Add 20 mL of buffer I to wash away the impurities and keep 1 mL of sample.

[0063] (5) Add 10 mL of buffer II to elute the target protein, collect 1 mL of eluent from each tube to obtain the fused chitinase, and store at 4 °C.

[0064] (6) The fusion chitinase obtained in step (5) was concentrated and desalted using AKTA buffer III to obtain high-purity fusion chitinase ChiB (amino acid sequence as shown in SEQ ID No. 8), and stored at 4 °C.

[0065] The obtained proteins were analyzed by SDS-PAGE, such as... Figure 3 The image shows an SDS-PAGE electrophoresis image of ChiB purified by nickel column affinity chromatography, where: lane M: marker; lane 1: supernatant after cell lysis and centrifugation; lane 2: sample loading eluent; lane 3: contaminating proteins eluted with buffer I; lane 4: target protein eluted with buffer II; from Figure 3 As can be seen, buffer II can elute chitinase ChiB, and the band is relatively simple. Example 4:

[0066] Enzyme activity assay The catalytic activity of chitinase ChiB was determined using chitin as a substrate. The reaction system consisted of 1 mg chitin, 1 μg chitinase ChiB, and enzyme activity assay buffer to a final volume of 100 μL. The enzyme activity assay buffer contained 2 M NaCl, 50 mM Tris-HCl, and pH 8.0.

[0067] Specific procedures: The reaction system was reacted in a 37 ℃ water bath for 30 min; no chitinase was added to the control group (it was replaced by an equal amount of buffer III); after the reaction was completed, the reaction was terminated under a 100 ℃ metal bath condition for 3 min.

[0068] After terminating the reaction, centrifuge and collect 40 μL of the supernatant. Add 80 μL of 0.05% (M / V) potassium ferricyanide solution (prepared with 0.5 M Na2CO3) to the supernatant of both the experimental and control groups, mix well, incubate at 100 ℃ for 10 min, centrifuge, and measure the absorbance of the supernatant at 420 nm. Use ddH2O as a blank control.

[0069] A standard curve was prepared using N-acetylglucosamine (GlcNAc), and the concentration of reducing sugars in the reaction solution was calculated.

[0070] Enzyme activity (U): The amount of reducing sugar produced per minute under the above conditions is defined as one unit of activity. Example 5:

[0071] Analysis of optimal reaction conditions for ChiB; (1) The optimal reaction temperature of chitinase ChiB is determined in the range of 20~70 ℃; The reaction temperatures were set at 20, 30, 35, 40, 45, 50, 55, 60, 65, and 70 °C. The enzyme activity determination method was the same as in Example 4, except for the reaction temperature. The relative enzyme activity at other temperatures was calculated with the highest enzyme activity as 100%, and each group was tested in triplicate. Figure 4 The graph shows the effect of temperature on the catalytic activity of ChiB. The results indicate that the optimal reaction temperature for ChiB is 45 °C.

[0072] (2) The optimal reaction concentration of chitinase ChiB was determined within the range of 0~4 M NaCl; Chitinase activity was measured at final NaCl concentrations of 0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, and 4.0 M in enzyme activity assay buffers. The assay method was the same as in Example 4, except for the change in the final NaCl concentration. The relative enzyme activity of other salt concentrations was calculated with the highest enzyme activity as 100%, and each group was tested in triplicate. Figure 5 The graph shows the effect of NaCl concentration on the catalytic activity of ChiB. The results indicate that the optimal NaCl concentration for the reaction of chitinase ChiB is 2.0 M.

[0073] (3) The optimal reaction pH for chitinase ChiB is measured in the range of 3.0 to 10.5; Prepare 0.1 M citrate-trisodium citrate buffer solutions with pH ranges of 3.0–6.0; 0.1 M phosphate buffer solutions with pH ranges of 6.0–7.5; 0.1 M Tris-HCl buffer solutions with pH ranges of 7.5–9.0; and 0.1 M CHES-NaOH buffer solutions with pH ranges of 9.0–10.5. For each buffer system with different pH values, the activity of chitinase ChiB was measured at the optimal reaction temperature of 45 °C and the optimal NaCl concentration of 2.0 M. The method for measuring enzyme activity was the same as in Example 4, except that the Tris-HCl at pH 8.0 and 50 mM was replaced. The relative enzyme activity at other pH values ​​was calculated with the highest enzyme activity as 100%, and each group underwent three parallel experiments. Figure 6 The graph shows the effect of pH on the catalytic activity of ChiB. The results indicate that the optimal reaction pH for ChiB is 6.0 phosphate buffer.

[0074] The optimal reaction conditions for the halophilic archaeal chitinase ChiB are 45 °C, 2.0 M NaCl, and phosphate buffer at pH 6.0. Example 6:

[0075] ChiB stability analysis; (1) Analysis of the thermal stability of chitinase ChiB; Chitinase ChiB was incubated at 30, 40, 50, and 60 °C for 0, 30, 60, and 90 min, and the residual enzyme activity was measured under optimal reaction conditions. For each temperature gradient, the enzyme activity at 0 min was taken as 100%, and the relative enzyme activity at other time points was calculated. Each group underwent three parallel experiments. Figure 7 The figure shows the stability analysis results of ChiB at different temperatures. The results show that the enzyme can still retain more than 80% of its activity after incubation at 30 and 40 °C for 90 min, which indicates that it has good thermal stability.

[0076] (2) NaCl stability analysis of chitinase ChiB; Chitinase ChiB was placed in optimal pH buffers containing 0.2, 1.0, 2.0, 3.0, and 4.0 M NaCl and incubated at room temperature for 0, 30, 60, and 90 min, respectively. Residual chitinase activity was measured under optimal reaction conditions. For each NaCl gradient, the enzyme activity at 0 min was taken as 100%, and the relative enzyme activity at other time points was calculated. Each group underwent three parallel experiments. Figure 8 The figure shows the stability analysis results of ChiB at different NaCl concentrations. The results show that the enzyme can still maintain more than 95% of its activity after incubation for 90 min at NaCl concentrations of 2.0, 3.0 and 4.0 M, indicating good NaCl stability.

[0077] (3) pH stability analysis of chitinase ChiB; The enzyme was placed in buffers containing 2 M NaCl at pH 6.0 (citrate-trisodium citrate buffer), pH 7.0 (phosphate buffer), pH 8.0 (Tris-HCl buffer), and pH 9.0 (CHES-NaOH buffer). After incubation at room temperature for 0, 30, 60, and 90 min, the residual chitinase activity was measured under optimal reaction conditions. For each pH gradient, the relative enzyme activity at 0 min was calculated as 100%, and each group was tested in triplicate. Figure 9 The figure shows the stability analysis results of ChiB under different pH conditions. The results show that after incubation for 90 min at pH 6.0, pH 7.0, pH 8.0 and pH 9.0, the relative enzyme activity remained above 90%. The enzyme has good stability under acidic, neutral and alkaline conditions, indicating that the enzyme has good pH stability. Example 7:

[0078] ChiB tolerance analysis; (1) Analysis of the tolerance of chitinase ChiB to metal ions, organic solvents and surfactants; Adding 10 mM of different metal ions Ca to the reaction system 2+、Sr 2+ Zn 2+ K + Ni 2+ Mg 2+ Ba 2+ Mn 2+ Cu 2 + Fe 3+ Co 2+ Enzyme activity was determined under optimal reaction conditions, with ddH2O used instead of metal ions in the positive control system. The positive control result was taken as 100% enzyme activity. The relative enzyme activity of the reaction systems containing metal ions was compared, with three parallel experiments per group. Figure 10 The graph shows the effect of different metal ions on the catalytic activity of ChiB. The results show that K + Mg 2+ It promotes the activity of this enzyme, of which K + It can increase enzyme activity by about 10%; Ba 2+ Zn 2+ Cu 2+ Fe 3+ 、Sr 2+ It has almost no effect on enzyme activity; Ca 2+ Ni 2+ Mn 2+ Co 2+ It has varying degrees of inhibitory effect on this enzyme, among which Ni 2+ and Mn 2+ The inhibitory effect was strongest, inhibiting nearly 50% of the ChiB enzyme activity. The relative enzyme activity of ChiB in other metal ions remained above 85%, indicating that the enzyme exhibits good tolerance to metal ions under certain conditions. The reaction system was supplemented with 15% (v / v) methanol, ethanol, isopropanol, acetone, glycerol, DMF, DMSO, Tween 20, Tween 80, 10% SDS, PEG600, and Triton X-100. Enzyme activity was measured under optimal reaction conditions. In the positive control system, ddH2O replaced organic solvents and surfactants. The positive control result was considered 100% enzyme activity. The relative enzyme activities containing organic solvents and surfactants were compared, with three parallel experiments per group. Figure 11The graph shows the effect of different organic solvents and surfactants on the catalytic activity of ChiB. The results show that 10% SDS promotes enzyme activity. Methanol has almost no effect on enzyme activity. Other organic solvents and surfactants exhibit varying degrees of inhibition on the enzyme. The relative enzyme activity of ChiB in glycerol can still maintain more than 85% of its activity; the relative enzyme activity of ChiB in ethanol, DMF, DMSO, and Triton X-100 can still maintain more than 40% of its activity; and in isopropanol, it can maintain more than 20% of its activity. ChiB is relatively sensitive to acetone, Tween 20, Tween 80, and PEG600, indicating that the enzyme has good tolerance to organic solvents and surfactants. Example 8:

[0079] Comparative experiment on the degradation activities of ChiB and the original enzyme on colloidal chitin; Determination of chitinases ChiB (fusion enzyme) and ChiC using colloidal chitin as substrate Ham and ChiA Has The catalytic activity was determined. The reaction system consisted of 0.3 mg chitin, 1 μg chitinase, and enzyme activity assay buffer to a final volume of 100 μL. The enzyme activity assay buffer contained 2 M NaCl, 50 mM Tris-HCl, and pH 8.0. The ChiC used in the comparative experiment... Ham and ChiA Has The corresponding genes were cloned into expression vectors, with primer sequences ChiC, respectively. Ham :F: 5'CGCGAATTCCAGCAAGAGTACCCGACG 3'; R: 5' ATAGGATCCGCTGTCGCTCGTGAACTC 3'. AH Has F: 5' CGCGAATTCGCGGACTGTAGCGACGTC 3'; R: 5' ATAGCATGCTACGGTTTGATTGATCGT 3'. The enzymes were then expressed and purified using the same methods as in Examples 2 and 3. SDS-PAGE analysis showed that the purity of the obtained enzymes was essentially consistent. Figure 11 Chitinases ChiB and ChiC Ham and ChiA Has The activity comparison results showed that ChiB had significantly higher degradation activity for colloidal chitin than ChiC. Ham , with ChiA Has There was also a slight improvement compared to the previous year, indicating that the fusion domain can enhance the enzyme's ability to degrade substrates. Example 9:

[0080] Comparison of the degradation capabilities of ChiB and the original enzyme on insoluble chitin powder; Determination of chitinases ChiB (fusion enzyme) and ChiC using powdered chitin as substrate Ham and ChiA Has Catalytic activity of insoluble substrates. Reaction system: including 0.3 mg powdered chitin, 1 μg chitinase, and enzyme activity assay buffer to a final volume of 100 μL; the enzyme activity assay buffer consisted of 2 M NaCl, 50 mM Tris-HCl, and pH 8.0. Figure 12 Chitinases ChiB and ChiC Ham and ChiA Has The comparison of catalytic degradation abilities of insoluble powdered chitin showed that ChiB exhibited a more significant catalytic advantage among recalcitrant substrates, with its degradation activity for powdered chitin being significantly higher than that of ChiC. Ham and ChiA Has , and ChiC Ham and ChiA Has The differences between them are not significant, indicating that the fusion domain can significantly enhance the enzyme's catalytic ability to degrade recalcitrant substrates. Example 10:

[0081] Experiment on the binding ability of ChiB and the original enzyme to insoluble chitin; Take chitinases ChiB and ChiC Ham and ChiA Has 3 μg of each sample was placed in a solution of 5 mg of shrimp shell powder resuspended in buffer III. The reaction mixture was brought to a final volume of 300 μL using buffer III. For the control group, the mixture was immediately centrifuged at 12,000 rpm at 4 °C, and 200 μL of supernatant was collected. For the experimental group, the mixture was incubated at 0 °C and 220 rpm for 20 hours, followed by centrifugation at 4 °C and 12,000 rpm, and 200 μL of supernatant was collected. All three groups were replicated. The supernatant was precipitated using TCA precipitation, and the resulting protein was analyzed by SDS-PAGE. Gray-scale analysis was performed using GelAnalyzer 23.1.1. Figure 13 The results of the substrate binding capacity experiment are shown. Lane 1 is the control group (binding for 0 h), and lane 2 is the experimental group (binding for 20 h). Gray-scale analysis shows that the binding rate of ChiB is around 85%, slightly higher than that of ChiC. Ham (Binding rate is approximately 78%), compared to ChiA Has It exhibits a stronger substrate binding ability.

[0082] Note: The above embodiments are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention. Therefore, although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention. All technical solutions and improvements that do not depart from the spirit and scope of the present invention should be covered within the scope of the claims of the present invention.

[0083] chiC Ham Nucleotide sequence: SEQ ID No. 1 chiA Has Nucleotide sequence: SEQ ID No. 2 chiB Nucleotide sequence: SEQ ID No. 3 First PCR product sequence: SEQ ID No. 4 Second PCR product sequence: SEQ ID No. 5 ATGCAGCAAGAGTACCCGACGTGGGATGCGAGCGCGACCTACACGGAGGGTGACCGGGTCGTCTACGAGGGGACGATCTACGAGGCCCAGTGGTGGACACAGGGCGACGAACCCGGTAGCACCCAGTGGGGACCGTGGACCGTCGTCGACTCTTCGGACGGTGGCTCCGACGGGGGGAGTGACGGAGGTAGCGACGACGGGAGCGACGACGGCACGGACGGTGGCAGTGGGGAGACCGACTATCCGGCCTGGGACGCCGGCACCACGTACACCGGCGGCGATCGGGTCGTCTACGAGGGGACGATCTACGAGGCCCAGTGGTGGACTCGGGGAGACGAGCCCGACGCCGGTGGACCGTGGGACGAAGTCGGTCCCGCAGACGGTGGCGGTGGGGACGACGGCAGCGGTGACGACGACAGCGACGATTCAGACGGGGGCACGGGCACACCGGGCGCGATCCCGGAGAACGGGGCGACCGATTCGACC ChiC Ham Amino acid sequence: SEQ ID No. 6 MQQEYPTWDASATYTEGDRVVYEGTIYEAQWWTQGDEPGSTQWGPWTVVDSSDGGSDGGSDGGSDDGSDDGTDGGSGETDYPAWDAGTTYTGGDRVVYEGTIYEAQWWTRGDEPDAGGPWDEVGPADGGGGDDGSGDDDSDDSDGGTGTPGAIPENVFAPFVDVALDDQQALTDAVSNAGTKYFTLAFVNSAGGEPAWAGDSNLIVGESGARLDMQGQIADLRADHGGEVVVSFGGLSGTYLAEAVTSASTLKEKYATVVDRLDAQFIDFDEEQHIRDNPEVIERRNEALALLQEEYPELSISYTLPVMPSGLPEQSSNDVLFVLEDAAQRGVELDAVNLMTMNYGSAFELNGETVVDAAESVHGQLADIYPERSAAERWNAIGLTPMIGQNDVDSNVFYPEDAQTVLDFAQEKNLRWLSFWELVRDNGEGSALYESSQIDQEPYEFSSIFDEFTSDS ChiA Has Amino acid sequence: SEQ ID No.7 MADCSDVSTWDATTAYAGGDRVVSGGALWEAQWWTRGNEPDESDDVWGKLGDCDGPGGGNASPTAAFTATPSSPSPGESVTLDASDATDSDGSIQSYEWTFGDDTTATGQSTDHTYAASGEYTITLTVTDDDGATDSTTQTVSVGDTTSEFKIIGYYPGWKSTSEYDYYPEDVPWDKLTDVKYAFLGVDAQNGIPTIMSDQDRKNLEAFKELKSGPASDTRIHVSIGGWADSKGFSEIAASQDTRQSFAQRSVEIVREYDLDGVDIDWEHPGSQQGNCQCGSNQDYETHIDLLKTLRDALDAAGSEDGRKYWLSVANGGSDWNTGGLRHGEIGEICDYAMIMAYDFTGSWMDVAGLNAPIYGDAHPTENAQYGQTYHNQYYVEYAVDTLWAGEHGETGYWPGQWEYPPAPPAEHDELVLGLPFYGRGFNGTELYGGYTGLPEGTWHHLLEDGAEPTGAFDFGDLEENYIDADGWERHYHQPGEVPYLINESENTLISYDDEQSIAEKVSFAKERGMQGVMFWDLAQDWNETLLDTINQTV Amino acid sequence of ChiB: SEQ ID No.8 MQQEYPTWDASATYTEGDRVVYEGTIYEAQWWTQGDEPGSTQWGPWTVVDSSDGGSDGGSDGGSDDGSDDGTDGGSGETDYPAWDAGTTYTGGDRVVYEGTIYEAQWWTRGDEPDAGGPWDEVGPADGGGGDDGSGDDDSDDSDGGTGTPGAIPENGATDSTTQTVSVGDTTSEFKIIGYYPGWKSTSEYDYYPEDVPWDKLTDVKYAFLGVDAQNGIPTIMSDQDRKNLEAFKELKSGPASDTRIHVSIGGWADSKGFSEIAASQDTRQSFAQRSVEIVREYDLDGVDIDWEHPGSQQGNCQCGSNQDYETHIDLLKTLRDALDAAGSEDGRKYWLSVANGGSDWNTGGLRHGEIGEICDYAMIMAYDFTGSWMDVAGLNAPIYGDAHPTENAQYGQTYHNQYYVEYAVDTLWAGEHGETGYWPGQWEYPPAPPAEHDELVLGLPFYGRGFNGTELYGGYTGLPEGTWHHLLEDGAEPTGAFDFGDLEENYIDADGWERHYHQPGEVPYLINESENTLISYDDEQSIAEKVSFAKERGMQGVMFWDLAQDWNETLLDTINQTV。

Claims

1. A highly efficient fusion chitinase based on domain recombination, characterized in that, The nucleotide sequence of the highly efficient chitinase based on domain recombination is shown in SEQ ID No. 3, or a nucleotide sequence having at least 80% sequence homology and the same function; the amino acid sequence is shown in SEQ ID No. 8, or an amino acid sequence having at least 80% sequence homology and the same function.

2. The method for preparing a highly efficient fusion chitinase based on domain recombination according to claim 1, characterized in that, The chitinase is formed by the fusion of a catalytic domain and a chitin-binding domain, wherein the catalytic domain has chitin hydrolytic activity, and the chitin-binding domain is a domain capable of binding chitin substrates; the preparation steps are as follows: (1) Obtain the nucleotide sequences encoding the catalytic domain and the chitin-binding domain; construct the fusion gene using gene recombination methods; (2) The fusion gene is introduced into a host cell for expression; (3) The fusion chitinase was obtained by separation and purification.

3. The method for preparing a highly efficient fusion chitinase based on domain recombination according to claim 2, characterized in that, The specific steps are as follows: (1) Based on halophilic archaea Halomicrobium mukohataei ZP60 and Halocatena salina AD-1 T Two chitinase genes chiC Ham and chiA Has Its nucleotide sequence is shown in SEQ ID No. 1 and SEQ ID No. 2; Using overlap extension PCR technology, chiC Ham Chitin-binding domains in and chiA Has The catalytic domain in the structure was fused: First, extension primers were designed, and the first PCR amplification was performed to obtain the catalytic domain. chiA Has The nucleotide sequence of product one of the catalytic domains is shown in SEQ ID No. 4; The second PCR amplification yielded the following... chiC Ham Product 2, containing the chitin-binding domain, has the nucleotide sequence shown in SEQ ID No.

5. Using purified product 1 and product 2 as templates, a third PCR amplification was performed to obtain a product possessing both chitin-binding domain and... chiA Has Catalytic domain and chiC Ham The product of chitin binding domains, that is, the fusion product of two domains, is named chiB Its nucleotide sequence is shown in SEQ ID No. 3; then, the amplified target gene fragment was ligated to the pTA04 vector using molecular cloning technology to construct the recombinant plasmid pTA04- chiB ; (2) The recombinant plasmid pTA04- obtained in step (1) chiB The halophilic archaea were transformed into a host cell, and the recombinant host cells were inoculated into Hv-YPC liquid medium for culture. The cell slurry that reached the stationary phase was centrifuged, and the cells were collected and stored for later use. (3) The bacterial cells collected in step (2) were resuspended with cell lysis buffer, the cells were sonicated and the supernatant was collected by centrifugation and purified by nickel affinity chromatography. Imidazole was removed by AKTA desalting column to obtain high purity halophilic archaea fusion chitinase ChiB.

4. The method for preparing a highly efficient fusion chitinase based on domain recombination according to claim 3, characterized in that, The halophilic archaea used in step (1) Halomicrobium mukohataei ZP60 and Halocatena salina AD-1 T The samples were purchased from the China General Microbiological Culture Collection Center, with serial numbers CGMCC 1.6192 and CGMCC 1.13724, respectively.

5. The method for preparing a highly efficient fusion chitinase based on domain recombination according to claim 3, characterized in that, The extension primers mentioned in step (1): 1-F: 5'-GGCGCGATCCCGGAGAACGGGGCGACCGATTCGACC-3' 2-R: 5'-GGTCGAATCGGTCGCCCCGTTCTCCGGGATCGCGCC -3' The specific procedures for the three PCR tests are as follows: The first PCR obtained with chiA Has Product 1 of the catalytic domain: Primer 1-F: 5'- GGCGCGATCCCGGAGAACGGGGCGACCGATTCGACC -3'; 1-R- Sph I:5’- ATAGCATGCTACGGTTTGATTGATCGT -3’; 25 µL PCR amplification system: 2 × PCR Master mix: 12.5 µL, 1-F: 10 µM, 1 µL, 1-R- Sph I: 10µM, 1µL, DNA template 2µL, balance ddH2O; PCR amplification program settings are as follows: Step 1: Denaturation pre-determination at 95 ℃ for 5 min; Step 2: Determination at 95 ℃ for 30 s; Step 3: Annealing at 50 ℃ for 30 s; Step 4: Extension at 72 ℃ for 1 min; Steps 2 to 4 are repeated 30 times; Step 5: Extension at 72 ℃ for 10 min; Step 6: Cool down to 4 ℃; The second PCR obtained with chiC Ham Product 2 of chitin-binding structural domains: Primer 2-F- Eco RI: 5’- CGCGAATTCCAGCAAGAGTACCCGACG -3’; 2-R: 5'-GGTCGAATCGGTCGCCCCGTTCTCCGGGATCGCGCC -3'; 25 µL PCR amplification system: 2 × PCR Master mix: 12.5 µL, 2-F- Eco RI: 10 µM, 1 µL; 2-R: 10 µM, 1 µL; DNA template: 2 µL; balance: ddH2O; PCR amplification program was set as follows: Step 1: Denaturation pre-determination at 95 ℃ for 5 min; Step 2: Determination at 95 ℃ for 30 s; Step 3: Annealing at 50 ℃ for 30 s; Step 4: Extension at 72 ℃ for 1.5 min; Steps 2 to 4 were repeated 30 times; Step 5: Extension at 72 ℃ for 10 min; Step 6: Cooling down to 4 ℃; The third PCR operation achieved the fusion of the chitin-binding domain and the catalytic domain: Primer 2-F- Eco RI: 5’- CGCGAATTCCAGCAAGAGTACCCGACG -3’; 1-R- Sph I:5’- ATAGCATGCTACGGTTTGATTGATCGT -3’; 25 µL PCR amplification system: 2 × PCR Master mix: 12.5 µL, 2-F- Eco RI: 10 µM, 1 µL, 1-R- Sph I: 10 µM, 1 µL, DNA template 2 µL, balance ddH2O; PCR amplification program settings are as follows: Step 1: Denaturation pre-determination at 95 ℃ for 5 min; Step 2: Determination at 95 ℃ for 30 s; Step 3: Annealing at 50 ℃ for 30 s; Step 4: Extension at 72 ℃ for 2 min; Steps 2 to 4 are repeated 30 times; Step 5: Extension at 72 ℃ for 10 min; Step 6: Cool down to 4 ℃.

6. The method for preparing the highly efficient fusion chitinase based on domain recombination according to claim 3, characterized in that, The halophilic archaea expression host mentioned in step (2) is Haloferax volcanii Purchased from the Japan Culture Collection (JCM), with culture accession number JCM 8879; The Hv-YPC liquid culture medium consists of the following components per liter: yeast extract 5.0 g, soybean peptone 1.0 g, acid-hydrolyzed casein 1.0 g, KCl 4.2 g, MgSO4·7H2O 33.0 g, MgCl2·6H2O 30.0 g, NaCl 144.0 g, 1M, pH 8.0 Tris-HCl 12.0 mL, and CaCl2 0.33 g. The above components are diluted to 1 L with distilled water, and the pH is adjusted to 7.

5. The culture conditions are 37 ℃, 160 rpm, culture for 3-4 days; the centrifugation conditions are 4 ℃, 8000 rpm, centrifugation for 10-15 min; the storage temperature is -20 ℃.

7. The method for preparing the highly efficient fusion chitinase based on domain recombination according to claim 3, characterized in that, The cell lysis buffer in step (3) consists of 2 M NaCl, 50 mM Tris-HCl, and pH 8.0; the conditions for ultrasonic cell disruption are: ultrasonic time 3 s, interval 5 s, power 200 W, and total time 30 min. The purification steps of the nickel column affinity chromatography are as follows: wash the column with 20 column volumes of ddH2O, then equilibrate the nickel column with 20 column volumes of cell lysis buffer; centrifuge the cell lysis buffer and load the supernatant onto the column; elute contaminating proteins with 20 ml of buffer I; and elute the target protein with 10 ml of buffer II. The components of buffer I are: 40 mM imidazole, 2 M NaCl, 50 mM Tris-HCl, pH 8.0; The components of buffer II are: 100 mM imidazole, 2 M NaCl, 50 mM Tris-HCl, pH 8.0; The step of removing imidazole using the AKTA desalting column is as follows: concentrate the enzyme solution purified by nickel column affinity chromatography, and remove imidazole using Buffer III via the AKTA desalting column; The components of buffer III are: 2 M NaCl, 50 mM Tris-HCl, pH 8.

0.

8. The application of the highly efficient fusion chitinase based on domain recombination according to claim 1 or the highly efficient fusion chitinase based on domain recombination prepared by the method of any one of claims 2-7 in the degradation of chitin resources, characterized in that, The chitin resources include chitin powder and shell powder from crustaceans.

9. The application according to claim 8, characterized in that, The degradation reaction system consists of chitin resources, chitinase ChiB, and enzyme activity assay buffer. Each 100 μL reaction system contains 0.3 mg of chitin resources, 1 μg of chitinase ChiB, and the remainder of enzyme activity assay buffer. The chitin resources include chitin powder, shrimp shell powder, or crab shell powder. The enzyme activity assay buffer is composed of 1-3 M NaCl and 0.1 M phosphate buffer at pH 6.

0. The chitin degradation products are used to prepare chitin oligosaccharides or N-acetylglucosamine.

10. The application according to claim 9, characterized in that, The specific operation is as follows: the reaction system is reacted in a water bath at 40~50 ℃ for 30~40 min; after the reaction is completed, the reaction is terminated in a metal bath at 95~100 ℃ for 3-5 min, thereby achieving the degradation of chitin resources.