A genetically engineered cantharidin-producing bacterium and a construction method and application thereof
By introducing key genes of the cantharidin synthesis pathway and optimizing the ERG7 gene into Yersinia lipophila, a high-yield cantharidin genetically engineered strain was constructed, solving the problems of low cantharidin synthesis efficiency and limited yield in existing technologies. This resulted in efficient and stable cantharidin production, suitable for industrial applications.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HANGZHOU GENEGROW BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-05-06
- Publication Date
- 2026-07-10
Smart Images

Figure CN122357597A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of microbial metabolic engineering and synthetic biology, and in particular to a high-yield cantharidin-producing genetically engineered bacterium, its construction method, and its applications. Background Technology
[0002] Canthaxanthin is a high-value-added ketocarotenoid with strong antioxidant, photoprotective, and color-stabilizing bioactivities. It is widely used in food coloring, aquatic feed, cosmetics, and health products, and market demand continues to grow. Currently, canthaxanthin mainly relies on chemical synthesis, which suffers from significant environmental pollution, low product purity, and limited safety. Natural extraction methods have limited raw material sources, low extraction efficiency, and high costs, making large-scale supply difficult. Microbial synthesis of canthaxanthin offers advantages such as being green, efficient, safe, and easily scalable, making it an ideal alternative to traditional production methods.
[0003] Yarrowia lipolytica ( Yarrowia lipolytica Yeast extract is a recognized food-grade chassis microorganism with abundant acetyl-CoA supply, high mevalonic acid (MVA) pathway flux, strong lipid storage capacity, and suitability for high-density fermentation, making it an excellent host for heterologous carotenoid synthesis. However, in the heterologous synthesis of canthaxanthin in Yersinia lipolytica, β-carotene ketolase is the rate-limiting enzyme for canthaxanthin synthesis; insufficient expression leads to incomplete conversion and high levels of byproducts. Secondly, the competition between endogenous ergosterol synthesis and the target product synthesis for common precursors is a core bottleneck restricting yield improvement. 2,3-Oxysqualene, as an important isoprene precursor, is synthesized by lanosterol synthase (… ERG7 The large amount of lysine precursors flowing to ergosterol synthesis under the catalysis of (encoding) leads to a severe shortage of canthaxanthin precursors.
[0004] Traditional downward adjustment ERG7 The strategies often employ promoter replacement, gene knockout, or transcriptional repression, which can easily lead to strain growth defects, poor fermentation stability, and difficulty in adapting to industrial production.
[0005] Therefore, this invention aims to develop a genetically engineered bacterium that produces canthaxanthin with high yield, low by-products, and robust growth, thereby providing technical support for the large-scale industrial production of canthaxanthin. Summary of the Invention
[0006] The purpose of this invention is to provide a high-yield canthaxanthin genetically engineered bacterium, its construction method, and its applications, to solve the problems existing in the prior art. The high-yield canthaxanthin genetically engineered bacterium provided by this invention can significantly improve the synthesis efficiency and production yield of canthaxanthin.
[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a method for constructing a genetically engineered bacterium that produces high levels of cantharidin, comprising the following steps: The key gene was introduced into a yeast chassis strain and overexpressed to obtain the basic canthaxanthin production strain; The key genes include carB Gene, carRP Gene, crBKT Gene, HMG1 Genes and GGS1 Gene; Through repeated gene introduction optimization, the quality of the cantharidin-producing strain was improved. crBKT The copy number of the gene was used to obtain the strain with optimized copy number. For the strain with optimized copy number ERG7 The gene underwent site-directed mutagenesis to shrink the substrate binding pocket, resulting in the high-yield cantharidin-producing genetically engineered bacterium. The carB The nucleotide sequence of the gene is shown in SEQ ID NO.1; carRP The nucleotide sequence of the gene is shown in SEQ ID NO.2; crBKT The nucleotide sequence of the gene is shown in SEQ ID NO.3; HMG1 The gene's GenBank ID is NP_732900.1; GGS1 The gene's GenBank accession number is XP_045941587.1; the... ERG7 The gene's GenBank accession number is XM_504990.3.
[0008] Furthermore, the yeast strain in the yeast chassis is Yersinia lipolytica.
[0009] Furthermore, after repeated gene introduction optimization, the aforementioned crBKT The gene has a copy number of 2-4.
[0010] Preferably, after repeated gene introduction optimization, the crBKT The gene has a copy number of 3.
[0011] Furthermore, the site-directed mutagenesis involves mutating the ERG7 protein to ERG7. F713T mutant, ERG7 I719K mutant or ERG7 Y721K Mutant.
[0012] Preferably, the site-directed mutagenesis involves mutating the ERG7 protein to ERG7. Y721K Mutant.
[0013] Furthermore, the key gene was overexpressed using a recombinant plasmid.
[0014] The present invention also provides a high-yield cantharidin genetically engineered bacterium constructed according to the above-described construction method.
[0015] The present invention also provides the application of the above-mentioned high-yield canthaxanthin genetically engineered bacteria in the fermentation production of canthaxanthin.
[0016] The present invention also provides a method for producing cantharidin by fermentation, comprising the step of fermenting and culturing the above-mentioned high-cantharidin-producing genetically engineered bacteria to prepare the cantharidin.
[0017] The present invention discloses the following technical effects: This invention introduces the canthaxanthin synthesis pathway into Yersinia lipophila. carB , carRP , crBKT Genes and key genes in the mevalonate overexpression pathway HMG1 , GGS1 A basic canthaxanthin-producing bacterium was constructed. The dosage of key genes in the canthaxanthin synthesis pathway was optimized in this bacterium, and 3 copies were identified. crBKT For optimal expression; simultaneously targeting the lanosterol synthase gene ERG7 By performing site-directed mutagenesis to shrink the substrate binding pocket, mildly downregulating enzyme activity to weaken competing pathways and expand the precursor pool, a robust, high-yielding, and low-byproduct engineered strain was obtained. Fermentation experiments verified that the engineered strain could achieve a cantharidin fermentation yield of 5.9 g / L, significantly improving the synthesis efficiency and economic viability of cantharidin.
[0018] The genetically engineered bacteria constructed in this invention exhibits full-constitutive expression, requires no inducer, has low fermentation cost, is easy to control, and is readily scalable, making it suitable for large-scale production and possessing enormous application potential in the field of cantharidin biosynthesis. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 A schematic diagram of the metabolic pathway for heterologous biosynthesis of canthaxanthin in Yersinia lipophila; Figure 2 A statistical chart showing the yield of cantharidin produced by shake-flask fermentation of genetically engineered strains BMH01~08. Detailed Implementation
[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0026] This invention introduces the canthaxanthin synthesis pathway into Yersinia lipophila. carB , carRP , crBKT Genes and key genes in the mevalonate overexpression pathway HMG1 , GGS1 A basic canthaxanthin-producing bacterium was constructed. The dosage of key genes in the canthaxanthin synthesis pathway was optimized in this bacterium, and 3 copies were identified. crBKT For optimal expression; simultaneously targeting the lanosterol synthase gene ERG7 By performing site-directed mutagenesis to shrink the substrate binding pocket, mildly downregulating enzyme activity to weaken competitive pathways and expand the precursor pool, a robust, high-yielding, and low-byproduct engineered bacterium was ultimately obtained. Figure 1 ).
[0027] The nucleotide sequence of the hp4d promoter is published in the literature "Madzak C, Tréton B and Roland SB. Strong hybrid promoters and integrative expression / secretion vectors forquasi-constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica. J Mol Microbiol Biotechnol. (2000) 2(2): 207-216".
[0028] The nucleotide sequence of the CYC1 terminator is published in the literature "Kathleen A. Curran, Nicholas J. Morse, Kelly A. Markham, Allison M. Wagman, Akash Gupta, and Hal S. Alper. Short Synthetic Terminators for Improved Heterologous Gene Expression in Yeast. ACS Synth Biol. (2015)4(7):824-832".
[0029] carB The nucleotide sequence of the gene is shown in SEQ ID NO.1; carRP The nucleotide sequence of the gene is shown in SEQ ID NO.2; crBKT The nucleotide sequence of the gene is shown in SEQ ID NO.3; HMG1 The gene's GenBank accession number is NP_732900.1; GGS1 The gene's GenBank accession number is XP_045941587.1.
[0030] The vector pUC19-rDNA-HisG has been disclosed in invention patent application number 202011361363.X; the plasmid pINA1269HMG1GGS2 has been disclosed in invention patent application number 202410844558.1; the plasmid pUC19-loxP-URA is described in accordance with the "Madzak C, Tréton B and Roland SB. Strong hybrid promoters and integrative expression / secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast" patent. Yarrowia lipolytica The plasmids pHR_E1-3_hrGFP and pCRISPRyl_E1-3 were prepared according to the method described in "J Mol Microbiol Biotechnol. 2000, 2(2): 207-216". The plasmids pHR_E1-3_hrGFP and pCRISPRyl_E1-3 were prepared according to the method described in "Schwartz, C., Shabbir-Hussain, M., Frogue, K., Blenner, M., Wheeldon, I. 2017. Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol, 6(3), 402-409".
[0031] ERG7 F713T ERG7 I719K and ERG7 Y721K The nucleotide sequences of the coding genes of the mutants are shown in SEQ ID NO. 4-6, respectively.
[0032] SEQ ID NO.1:
[0033] SEQ ID NO.2:
[0034] SEQ ID NO.3: CACGTGATGGGTCCCGGCATCCAGCCGACTTCAGCTCGGCCATGTTCGCGAACAAAGCACTCTCGGTTTGCTCTGCTGGCTGCCGCCTTGACCGCGAGACGCGTTAAACAGTTCACCAAGCAGTTTCGATCGAGGCGAATGGCCGAGGACATTCTCAAACTCTGGCAACGGCAGTACCACTTGCCACGGGAAGATTCCGACAAGCGAACTCTTCGAGAACGTGTGCACCTTTACAGACCTCCTCGTAGTGATCTGGGTGGTATCGCAGTGGCCGTCACCGTCATTGCCTTGTGGGCCACCCTGTTTGTCTACGGTCTGTGGTTCGTCAAGCTGCCCTGGGCATTGAAGGTGGGAGAGACTGCCACATCGTGGGCAACCATCGCTGCTGTCTTCTTCTCCCTGGAGTTCCTGTATACAGGTCTCTTCATCACAACTCACGACGCCATGCACGGGACGATTGCTCTACGAAACCGACGACTCAACGACTTTCTGGGACAACTTGCCATATCGCTATATGCTTGGTTTGACTACTCCGTTTTGCATCGAAAGCATTGGGAGCATCACAACCACACCGGCGAGCCCCGAGTTGACCCCGATTTCCACCGGGGCAACCCGAATCTGGCGGTGTGGTTCGCCCAGTTCATGGTTTCCTACATGACTCTCTCCCAATTCCTCAAGATCGCGGTGTGGTCTAATCTCCTTCTGCTTGCTGGAGCTCCTTTGGCCAACCAGCTGCTCTTTATGACCGCTGCCCCCATTTTAAGCGCCTTCCGACTGTTCTACTACGGAACCTACGTACCTCATCATCCCGAGAAGGGCCATACGGGCGCTATGCCTTGGCAGGTGTCACGTACGTCTTCTGCGAGCAGACTGCAGAGTTTTCTCACCTGTTATCACTTTGATCTGCACTGGGAACACCATAGATGGCCCTACGCCCCTTGGTGGGAGCTCCCCAAGTGCCGACAGATTGCACGCGGAGCTGCTCTCGCCTGAGGATCC。
[0035] SEQ ID NO.4:
[0036] SEQ ID NO.5:
[0037] SEQ ID NO.6:
[0038] Example 1 A strain of *Yarrowia cantharidin* that enhances the MVA metabolic pathway was constructed. The specific construction method is as follows: First, a Yersinia lipophila platform for cantharidin synthesis was constructed, and a non-homologous recombination strategy was used to synthesize... carB , carRP , crBKT The gene was integrated into the genome of Yersinia lipophila, and key genes in the MVA pathway were overexpressed. HMG 1 and GGS1 To increase cantharidin production. Specifically, the expression of these heterologous genes is controlled by the hp4d promoter and the CYC1 terminator, respectively. The hp4d promoter, the target gene ( carB , carRP or crBKT The gene and the CYC1 terminator were sequentially linked to construct the following: carB Gene expression cassettes carRP Gene expression cassettes and crBKT Gene expression cassette. carB Gene expression cassettes carRP Gene expression cassettes and crBKT Gene expression cassettes are created by using restriction enzyme sites. Smi I was ligated into plasmid pUC19-loxP-URA to obtain recombinant plasmid pUC19-loxP-URA-carB-carRP-crBKT, which was then transformed into Yersinia lipophila MYA2613 to obtain expression. carB , carRP and crBKT The engineered strain BMH01.
[0039] Plasmid pINA1269HMG1GGS2 was transformed into strain BMH01 to obtain strain BMH02, which has a significantly improved cantharidin production capacity.
[0040] Example 2 crBKT Copy number gradient optimization is used to improve cantharidin production. The specific construction method is as follows: Includes hp4d promoter and CYC1 terminator crBKT Gene expression cassettes via restriction enzyme sites Eco RI was ligated into plasmid pUC19-rDNA-HisG to obtain recombinant plasmid pUC19-rDNA-HisG-crBKT, which was then transformed into strain BMH02 to obtain plasmid expressing two copies of the gene. crBKT The engineered strain BMH03 produces the gene. Subsequently, by using the same method, three copies of the gene can be expressed. crBKT The engineered strain BMH04 of the gene and expressing four copiescrBKT The engineered strain BMH05 was used. Among them, the engineered strain BMH04 is the optimal cantharidin-producing strain.
[0041] Example 3 Based on active pocket analysis Erg7 Rational mutation design: Homology modeling of the ERG7 protein from *Yersinia lipolytica* was performed, and molecular docking with lanosterol was conducted to locate key regions: identifying the core site within the pocket that directly interacts with the substrate; designing mutagenesis strategies: introducing steric hindrance, replacing large side chain residues with small side chain residues, and narrowing the entry channel to reduce pocket volume and decrease substrate binding efficiency; obtaining rational mutants that significantly reduce enzyme activity without being lethal. Finally, it was predicted that F713, I719, and Y721 near the active site are key residues involved in the cation-π interaction of the reaction, which are potentially beneficial mutation sites, thereby reducing ERG7 activity to accumulate 2,3-epoxysqualene. Endogenous *Yersinia lipolytica* ERG7 The gene's accession number in NCBI is GB: XM_504990.3.
[0042] Example 4 The construction of the ERG7 mutant in the engineered strain of Yersinia lipophila cantharidin is as follows: Using Yersinia lipophila MYA2613 genomic DNA as a template, PCR amplification was performed. ERG7 Full-length gene; ERG7 constructed using site-directed mutagenesis PCR F713T ERG7 I719K and ERG7 Y721K The gene encoding the mutant (SEQ ID NO.4-6).
[0043] The mutant fragments from the three mutants were constructed into plasmid pHR_E1-3_hrGFP via restriction enzyme sites NheⅠ and BssHIⅡ, respectively. The resulting recombinant plasmid and plasmid pCRISPRyl_E1-3 were transformed into strain BMH04. PCR and sequencing verification yielded cantharidin-producing strains BMH06~08 with ERG7 site-directed mutations (BMH06 expresses ERG7). F713T Mutant; BMH07 expresses ERG7 I719K Mutant; BMH08 expresses ERG7 Y721K (Mutants), among which strain BMH08 had the highest canthaxanthin production.
[0044] Example 5 The yield of canthaxanthin synthesized by each strain was determined by shaking flasks: The BMH01-02 strains prepared in Example 1, the BMH03-05 strains prepared in Example 2, and the BMH06-08 strains prepared in Example 4 were inoculated into 2 mL of YPD medium (YPD medium: 2 wt% glucose, 2 wt% peptone and 1 wt% yeast extract) and cultured for 24 hours, then incubated with initial OD... 600 The inoculum was 0.01 g in fresh 50 mL YPD medium. After 4 days of fermentation, cantharidin was extracted using DMSO and acetone. The extract was then analyzed using high-performance liquid chromatography (HPLC). 18 Qualitative and quantitative analysis of cantharidin was performed using a reversed-phase column chromatography. The results are shown in the table below. Figure 2 .
[0045] Figure 2 The results showed that strain BMH08 had a significantly enhanced canthaxanthin production capacity, with a canthaxanthin yield of 350 mg / L on the 4th day of fermentation.
[0046] Example 6 Fermentation production experiment of strain BMH08: Single colonies of strain BMH08 were picked and inoculated into shake flasks containing seed culture medium for seed culture. The seed culture medium formula (g / L) was: yeast extract 10, peptone 20, and glucose 20; glucose was sterilized separately, and the remaining components were sterilized at 121℃ for 20 min, cooled, and then mixed for later use. The shake flask culture conditions were 30℃, 220 rpm, and shaking culture for 18 h.
[0047] After the seed culture was completed, the seed culture was inoculated into a 5 L fermenter containing 2 L of fermentation medium at an inoculation rate of 2% (v / v) for fermentation culture. The fermentation medium formula (g / L) was: magnesium sulfate heptahydrate 0.5, ammonium sulfate 1, potassium dihydrogen phosphate 10, corn steep liquor powder 20, soybean peptone 10, glucose 20, soybean oil 2, and pyruvate 4; among which, glucose was sterilized separately, and all other components of the fermentation medium except glucose were sterilized at 121℃ for 30 min. After the components were sterilized and cooled, they were mixed evenly to obtain the fermentation medium.
[0048] A multi-stage temperature control strategy is employed during fermentation, specifically: when the OD of the fermentation broth... 600 When the value is less than 100 (corresponding to a cell dry weight of less than 20 g / L), the fermentation temperature should be controlled at 29~30℃; when the OD of the fermentation broth is... 600 When the OD value is between 100 and 200 (corresponding to a cell dry weight between 20 and 40 g / L), the fermentation temperature should be controlled at 27-28℃; when the OD value of the fermentation broth is... 600 Once the value exceeds 200, control the fermentation temperature at 25~26℃ and maintain this temperature condition until the fermentation is complete.
[0049] A segmented pH control strategy is employed during fermentation, specifically: when the OD of the fermentation broth... 600 Before the pH value is less than 100, maintain the pH of the fermentation broth at 5.5 by adding ammonia water; when the OD value of the fermentation broth is less than 100, maintain the pH of the fermentation broth at 5.5. 600 Once the value exceeds 100, the pH of the fermentation broth should be controlled within the range of 4.9 to 5.0.
[0050] During fermentation, the glucose and dissolved oxygen concentrations in the fermentation broth are monitored in real time. When the initial glucose is consumed, the pH of the fermentation broth will show a significant upward trend, and the dissolved oxygen concentration will rise rapidly. At this time, a glucose feed solution with a concentration of 650 g / L will be added to the fermenter. During the cell growth stage, the glucose concentration in the fermentation broth will be controlled within the range of 1 to 3 g / L. After the cell growth enters the stationary phase, the glucose concentration in the fermentation broth will be controlled below 1 g / L.
[0051] Throughout the fermentation process, the dissolved oxygen concentration in the fermentation broth was maintained at no less than 25% by adjusting the stirring speed and aeration rate of the fermenter. Simultaneously, a phased corn steep liquor replenishment strategy was adopted: during the cell growth stage, 50 g of corn steep liquor was added to the fermenter every 12 hours; after the cells entered the stationary phase, 10 g of corn steep liquor was added to the fermenter every 12 hours.
[0052] Fermentation was terminated after 160 h. The content of cantharidin in the fermentation broth was detected by high performance liquid chromatography (HPLC). The results showed that the yield of cantharidin in the fermentation broth could reach 5.9 g / L.
[0053] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method for constructing a high-yield cantharidin-producing genetically engineered bacterium, characterized in that, Includes the following steps: The key gene was introduced into a yeast chassis strain and overexpressed to obtain the basic canthaxanthin production strain; The key genes include carB Gene, carRP Gene, crBKT Gene, HMG1 Genes and GGS1 Gene; Through repeated gene introduction optimization, the quality of the cantharidin-producing strain was improved. crBKT The copy number of the gene was used to obtain the strain with optimized copy number. For the strain with optimized copy number ERG7 The gene underwent site-directed mutagenesis to shrink the substrate binding pocket, resulting in the high-yield cantharidin-producing genetically engineered bacterium. The carB The nucleotide sequence of the gene is shown in SEQ ID NO.1; carRP The nucleotide sequence of the gene is shown in SEQ ID NO.2; crBKT The nucleotide sequence of the gene is shown in SEQ ID NO.3; HMG1 The gene's GenBank ID is NP_732900.1; GGS1 The gene's GenBank accession number is XP_045941587.1; the... ERG7 The gene's GenBank accession number is XM_504990.
3.
2. The construction method according to claim 1, characterized in that, The yeast strain in the yeast tray is Yersinia lipolytica.
3. The construction method according to claim 1, characterized in that, After repeated gene introduction optimization, the crBKT The gene has a copy number of 2-4.
4. The construction method according to claim 3, characterized in that, After repeated gene introduction optimization, the crBKT The gene has a copy number of 3.
5. The construction method according to claim 1, characterized in that, The site-directed mutagenesis involves mutating the ERG7 protein to ERG7. F713T mutant, ERG7 I719K mutant or ERG7 Y721K Mutant.
6. The construction method according to claim 5, characterized in that, The site-directed mutagenesis involves mutating the ERG7 protein to ERG7. Y721K Mutant.
7. The construction method according to claim 1, characterized in that, The key gene was overexpressed using a recombinant plasmid.
8. A high-yield cantharidin-producing genetically engineered bacterium constructed according to any one of claims 1-7.
9. The application of a high-canthaxanthin-producing genetically engineered bacterium as described in claim 8 in the fermentation production of canthaxanthin.
10. A method for producing canthaxanthin by fermentation, characterized in that, The method includes the step of fermenting and culturing the high-yield cantharidin genetically engineered bacteria as described in claim 8 to prepare the cantharidin.
Citation Information
Patent Citations
CN112300952A
CN118580979B