Molecular markers for soybean apical inflorescence length trait assisted selection and application thereof
By developing fluorescent tag-independent molecular markers based on AS-PCR and agarose gel electrophoresis, and designing primer sets using the mutation site of the Glyma.19G193100 gene, the problem of long cycle and low efficiency in the selection of terminal inflorescence length trait in soybean breeding was solved, and early, efficient and precise breeding results were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JILIN UNIVERSITY
- Filing Date
- 2026-01-28
- Publication Date
- 2026-07-10
AI Technical Summary
In existing soybean breeding techniques, the selection of the trait of terminal inflorescence length relies on phenotypic observation, which is characterized by long cycle, low efficiency, great susceptibility to environmental influences, and lack of efficient molecular markers for early generation selection.
We developed a fluorescent tag-independent molecular marker based on AS-PCR and agarose gel electrophoresis. We designed a primer set using the 271st base mutation site of the Glyma.19G193100 gene to distinguish the soybean terminal inflorescence length trait through specific amplification and provide high-resolution genotyping.
This technology enables efficient and precise selection of the terminal inflorescence length trait in early soybean breeding, reducing the scale of breeding, workload, and costs, and improving breeding efficiency.
Smart Images

Figure CN122357754A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a molecular marker for auxiliary selection of the trait of soybean terminal inflorescence length and its application. Background Technology
[0002] Soybean [Glycine max (L.) Merr] originated in China and is an important crop used for grain, oil, and feed, serving as a significant source of food, vegetable oil, and animal feed. Currently, soybean yields in my country are relatively low, indicating considerable room for improvement; increasing soybean yields is a key focus for future development.
[0003] In soybeans, hybridization breeding is currently the main breeding method. However, hybridization breeding has a long cycle, and the selection of quantitative traits needs to be carried out in high generations, resulting in a large breeding scale and workload. Compared with hybridization breeding, molecular marker-assisted breeding is efficient, rapid, and precise. With the development of soybean genomics, proteomics, metabolomics, and phenomics, a large number of genes related to important agronomic traits have been cloned. These genetic loci have been developed into molecular markers, and combined with molecular marker-assisted breeding, the desired soybean varieties can be obtained quickly.
[0004] The length of the soybean terminal inflorescence can affect the number of pods per plant and the uniformity of seed distribution. Soybean varieties with longer terminal inflorescences generally have higher light energy utilization, thus exhibiting greater pod-setting potential and contributing to increased yield per plant. Therefore, rapid detection of the soybean terminal inflorescence length trait is of great significance for improving soybean plant architecture, optimizing pod placement, and increasing pod quantity. Among the challenges in soybean breeding, accurately, rapidly, and simply utilizing the soybean terminal inflorescence length gene for molecular marker breeding remains a key hurdle.
[0005] Among soybean varieties with the same determinate pod-bearing habit (dt1 / dt1), the length of the terminal inflorescence still exhibits rich variation. Therefore, within the dt1 / dt1 genetic background, other genes may influence the length of the terminal inflorescence. However, there are currently no reports of cloning genes related to terminal inflorescence length, and the molecular mechanisms influencing terminal inflorescence length in soybean remain unclear. Previous studies have yielded a limited number of results regarding the localization of soybean terminal inflorescence trait loci. For example, Yamaguchi et al. located two soybean terminal inflorescence length trait loci, qTRL18-1 and qTRL11-1, on chromosomes 11 and 18, respectively; our patent application team previously used the BSA method to locate the terminal inflorescence length trait within a 4.5 Mb segment on chromosome 19; and Wang et al. detected 30 QTNs for the soybean inflorescence length trait on 14 chromosomes using GAWS analysis. These mapping results indicate that, within the dt1 / dt1 genetic background, other genes exist that regulate the length of soybean terminal inflorescences, but there are no reports of related marker development and their application in breeding. Summary of the Invention
[0006] The purpose of this invention is to provide a molecular marker for auxiliary selection of the trait of soybean terminal inflorescence length, so as to solve the problems mentioned in the background art.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] A molecular marker for assisted selection of the trait of terminal inflorescence length in soybean is the 271st base of the Glyma.19G193100 gene; the mutation location of the Glyma.19G193100 gene is the 271st base on the CDS sequence, where a G is mutated to A in the reference genome, resulting in a mutation of proline to serine at the 91st amino acid in the protein sequence; the reference genome is Glycine max Wm82.a4.v1; the nucleotide sequence of the Glyma.19G193100 gene is shown in SEQ ID NO:1 of the sequence listing.
[0009] Another object of the present invention is to provide an application of the above-mentioned molecular marker in assisting in the identification or screening of soybean terminal inflorescence length traits.
[0010] Another object of the present invention is to provide a primer set for detecting the above-mentioned molecular markers, comprising:
[0011] The first primer pair is used to specifically amplify DNA sequences containing the G allele;
[0012] The second primer pair is used to specifically amplify DNA sequences containing the A allele.
[0013] Furthermore, the first primer pair includes upstream and downstream primers as shown in SEQ ID NO:2-3 of the sequence listing.
[0014] Furthermore, the second primer pair includes upstream and downstream primers as shown in SEQ ID NO:4-5 of the sequence listing.
[0015] Another object of the present invention is to provide a method for assisting in the identification or screening of soybean terminal inflorescence length traits, comprising the following steps:
[0016] Genomic DNA was extracted from the soybean sample to be tested;
[0017] Using genomic DNA as a template, the above-mentioned primer set was used for amplification to obtain the amplification product;
[0018] Detect the amplification products and determine the genotype of the 271st base of the Glyma.19G193100 gene based on the amplification products.
[0019] Furthermore, if the genotype of the 271st base of the Glyma.19G193100 gene is A, then the soybean terminal inflorescence length trait is determined to be a long inflorescence trait; if the genotype of the 271st base of the Glyma.19G193100 gene is G, then the soybean terminal inflorescence length trait is determined to be a short inflorescence trait.
[0020] The molecular marker provided by this invention for auxiliary selection of soybean terminal inflorescence length trait does not rely on fluorescent tags. This molecular marker has high resolution and is easy to detect. It can be applied to the screening and identification of soybean terminal inflorescence length trait. It can select soybean terminal inflorescence length trait in early generations of soybean breeding, which can reduce the breeding scale, reduce workload, reduce costs, and improve breeding efficiency. Attached Figure Description
[0021] Figure 1 The results show the fine mapping of the length trait of soybean terminal inflorescence.
[0022] Figure 2 The amplification results of the marker primers in the tested segregating population of parents are shown. Detailed Implementation
[0023] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0024] Currently, selection for the soybean terminal inflorescence length trait in soybean breeding mainly relies on phenotypic observation, which suffers from problems such as long cycle, low efficiency, and significant environmental influence. Molecular markers offer advantages such as genetic stability, high throughput, high efficiency, and applicability to early-generation selection in breeding. AS-PCR (allele-specific PCR) designs primers based on the allele sequences of SNP loci and genotypes SNPs by analyzing the binding of allele-specific primers to template DNA. Compared to other genotyping methods, AS-PCR has advantages such as low equipment requirements, low cost, and ease of operation. To address the aforementioned issues, this invention, based on AS-PCR and agarose gel electrophoresis, develops a fluorescent tag-free molecular marker based on the variation sites of the gene controlling soybean terminal inflorescence length. This molecular marker has high resolution and is easy to detect, and has been validated in segregating populations, effectively distinguishing the soybean terminal inflorescence length trait. It can be applied to early selection in soybean breeding and screening for the soybean terminal inflorescence length trait, reducing breeding scale, workload, and costs, and improving breeding efficiency.
[0025] Specifically, in one embodiment of the present invention, a molecular marker for auxiliary selection of the trait of soybean terminal inflorescence length is provided, which is the 271st base of the Glyma.19G193100 gene; the mutation position of the Glyma.19G193100 gene is the 271st base on the CDS sequence, which is changed from G to A in the reference genome, resulting in the 91st amino acid on the protein sequence being changed from proline to serine; the reference genome is Glycine max Wm82.a4.v1; the nucleotide sequence of the Glyma.19G193100 gene is shown in the sequence listing SEQ ID NO:1 (the sequence source is the Phytozome database, the URL is https: / / phytozome-next.jgi.doe.gov / report / gene / Gmax_Wm82_a4_v1 / Glyma.19G193100).
[0026] In another embodiment of the present invention, a primer set for detecting the above-mentioned molecular markers is also provided, comprising:
[0027] The first primer pair is used to specifically amplify DNA sequences containing the G allele;
[0028] The second primer pair is used to specifically amplify DNA sequences containing the A allele.
[0029] Preferably, the first primer pair includes upstream and downstream primers as shown in SEQ ID NO:2-3 of the sequence listing; specifically, the upstream primer is 3100G-F: GTGGAATACCCATTGTAATTCG (as shown in SEQ ID NO:2 of the sequence listing); and the downstream primer is 3100G-R: AGCAAGAGGAGAAGAGCTAA (as shown in SEQ ID NO:3 of the sequence listing).
[0030] Preferably, the second primer pair includes upstream and downstream primers as shown in SEQ ID NO:4-5 of the sequence listing; specifically, the upstream primer is 3100A-F: GTGGAATACCCATTGTAATTCA (as shown in SEQ ID NO:4 of the sequence listing); and the downstream primer is 3100A-R: AGCAAGGGAGGAAGAGCTAA (as shown in SEQ ID NO:5 of the sequence listing).
[0031] In another embodiment of the present invention, a method for assisting in the identification or screening of soybean terminal inflorescence length traits is also provided, comprising the following steps:
[0032] S1. Extract genomic DNA from the soybean sample to be tested;
[0033] S2. Using genomic DNA as a template, amplify the product using the primer set described above.
[0034] S3. Detect the amplification product and determine the genotype of the 271st base of the Glyma.19G193100 gene based on the amplification product. If the genotype of the 271st base of the Glyma.19G193100 gene is A, then the soybean terminal inflorescence length trait is determined to be a long inflorescence trait; if the genotype of the 271st base of the Glyma.19G193100 gene is G, then the soybean terminal inflorescence length trait is determined to be a short inflorescence trait.
[0035] Specifically, the leaf samples to be identified were placed in 2 mL centrifuge tubes, and genomic DNA was extracted using the classic CTAB method. The specific procedure was as follows: the preserved leaf samples were removed and placed into numbered 2 mL centrifuge tubes, then one steel bead was added to each tube. The centrifuge tubes were placed in liquid nitrogen and homogenized using a tissue homogenizer for 30 seconds. 800 μL of CTAB extraction buffer (preheated to 65°C, 2% CTAB, 2% added before use) was added. After thoroughly mixing with β-mercaptoethanol, incubate the mixture in a 65°C water bath for 45 minutes, inverting the tube every 10 minutes. After the water bath, remove the centrifuge tube and add 800 μL of phenol, chloroform, and isoamyl alcohol (volume ratio 25:24:1). Mix thoroughly and centrifuge at 12000 rpm for 10 minutes at 4°C. After centrifugation, transfer the supernatant to a new 2 mL centrifuge tube, add 600 μL of chloroform, invert the tube to mix, and centrifuge at 12000 rpm for 10 minutes at 4°C. After centrifugation, transfer the supernatant to a new centrifuge tube. Add 500 μL of pre-chilled isopropanol to the centrifuge tube, mix well, and place in a -20°C freezer for 2 hours to precipitate DNA. Then centrifuge at 12,000 rpm for 10 minutes at 4°C and discard the supernatant. Rinse the precipitate 2-3 times with 75% ethanol solution. Air dry the DNA precipitate at room temperature and then dissolve it with an appropriate amount of ddH2O. Finally, use 1% agarose to check the DNA quality and use NanodropOne to determine the concentration of extracted DNA. Dilute to the required DNA concentration of 100 ng / μL and store at -20°C for later use.
[0036] In addition, PCR amplification was used as the amplification method. The PCR amplification system is shown in Table 1, and the PCR amplification program is shown in Table 2.
[0037] Table 1
[0038]
[0039] Table 2
[0040]
[0041] The amplification products were detected by agarose gel electrophoresis, as follows: 1% agarose gel electrophoresis was used to detect multiplex PCR products, which helped identify the genotypes of long and short inflorescences. Materials that could correctly bind to the first primer pair 3100G were identified as genotype G, materials that could correctly bind to the second primer pair 3100A were identified as genotype A, and materials that could bind to both primer pairs were identified as heterozygous genotypes. The amplified bands after primer binding were all 257 bp in length. Amplification results for primers that could not bind were asymptomatic.
[0042] The following embodiments are implementation examples of the technical solution of the present invention in practical applications, but are not limited thereto. Unless otherwise specified, all materials and reagents involved are commercially available products; unless otherwise specified, all experimental methods used are conventional methods.
[0043] Example 1: This example provides a method for designing molecular markers for auxiliary selection of the trait of soybean terminal inflorescence length, specifically including the following steps:
[0044] I. Population Construction: Using Chinese flat-stemmed soybean and American flat-stemmed soybean (both donated by the former Jilin Provincial Seed Breeding Center) as parents, a Restricted Indwelling Line (RIL) was constructed through single-seed propagation. From the RIL population, the F27 genetically stable line was selected. This line exhibits determinate pod-bearing behavior with a terminal inflorescence length of 4.5 cm. Using the long-inflorescence soybean variety Jiyu 80 (a certified soybean variety available from the China Germplasm Bank, with a terminal inflorescence length of 13.1 cm), which also exhibits determinate pod-bearing behavior, as the female parent and the F27 line as the male parent, self-pollination was performed after hybridization to construct segregating populations for generations F2, F2:3, and F2:4. Phenotypic analysis of the populations and parents revealed rich and continuous phenotypic variation in terminal inflorescence length within the segregating populations under different conditions, indicating a skewed distribution and suggesting the existence of a major gene controlling the terminal inflorescence length trait.
[0045] II. QTL Mapping: Genotypic analysis of the F2 population was performed using a 5K microarray, constructing a high-density genetic linkage map covering the soybean genome. Twenty linkage groups were identified, corresponding to 20 chromosomes. Two QTL mapping operations were conducted using segregating populations grown under different environments. As shown in Table 3, three QTLs for the trait of terminal inflorescence length were detected on chromosomes 10, 18, and 19, named qTRL10.1, qTRL18.1, and qTRL19.1. qTRL19.1 was mapped in different years and locations, explaining 19.09% and 30.69% of the phenotypic variation, respectively. Therefore, it was determined to be the major-effect QTL controlling soybean terminal inflorescence length. Figure 2As shown, to further narrow down the mapping interval, KASP markers were used to genotype 1528 individual plants in the segregating population. Individuals recombining within the mapping interval were screened, and the qTRL19.1 locus was finely mapped, narrowing the interval to a 21 kb range on chromosome 19, containing three candidate genes: Glyma.19G192900, Glyma.19G193000, and Glyma.19G193100. Through sequence analysis, gene function annotation, and spatiotemporal expression analysis of the candidate genes, it was inferred that Glyma.19G193100 is a key candidate gene regulating the length of soybean terminal inflorescence.
[0046] Table 3
[0047]
[0048] III. Molecular Marker Development
[0049] Based on the nonsynonymous mutation site of Glyma.19G193100, a polymorphic molecular marker was successfully developed. The molecular marker consists of two primer pairs, named 3100G and 3100A respectively (the nucleotide sequences of the two primer pairs are shown in SEQ ID NO: 2-5 of the sequence listing). The target fragment for each pair is 257 bp, used to distinguish between the A and G genotypes of the Glyma.19G193100 gene (genotype A for the long-inflorescence variety Jiyu 80; genotype G for the short-inflorescence line F27). The 3' ends of primers 3100A-F and 3100G-F are nonsynonymous mutation sites. To enhance the specificity of primer amplification, a mismatched base was introduced one base before the nonsynonymous mutation site in this embodiment of the invention (as shown in SEQ ID NO: 2 and 4 of the sequence listing). 3100A-R and 3100G-R are universal downstream primers with identical sequences (as shown in SEQ ID NO: 3 and 5 of the sequence listing). Each soybean material needs to be amplified with two pairs of primers (3100A and 3100G). The material that can correctly bind to primer 3100G, has the correct amplification conditions, and cannot bind to primer 3100A, and amplifies without a band, has the genotype G. The material that can correctly bind to primer 3100A, has the correct amplification conditions, and cannot bind to primer 3100A, and amplifies without a band, has the genotype A. The material that can bind to both pairs of primers is a heterozygous genotype.
[0050] IV. Validation of Molecular Marker Effect: The molecular marker was validated using the F2:4 generation population produced by crossing Jiyu 80 and F27 as parents. Long-inflorescence and short-inflorescence lines from the population were selected and subjected to AS-PCR amplification with primer pairs 3100A and 3100G, respectively. As shown in Table 4, the results showed that the long-inflorescence lines in the progeny population were all genotyped as A, while the short-inflorescence varieties were all genotyped as G, demonstrating that the molecular marker can effectively distinguish between long-inflorescence and short-inflorescence types.
[0051] Table 4
[0052]
[0053] Example 2: Based on the SNP variation sites of the candidate gene Glyma.19G193100 between the two parents, molecular markers were developed, and the polymorphism of the markers between the parents was examined, as well as the linkage relationship between the markers and traits was analyzed. Two pairs of primers (primer pair 1 and primer pair 2) were used to distinguish between the A and G genotypes of the Glyma.19G193100 gene (genotype A for long-inflorescence lines; genotype G for short-inflorescence lines). Materials that correctly bound primer 3100G were classified as G genotype, materials that correctly bound primer 3100A were classified as A genotype, materials that bound both primer pairs were classified as heterozygous genotype, and amplification results for primers that did not bind showed no bands (e.g., Figure 2 (As shown). The polymorphism of this marker was examined in the parents. Agarose gel results showed that the marker could clearly distinguish between the two genotypes, indicating that the marker has a high discriminative ability in the parental materials. The specific technical methods are as follows:
[0054] Step 1: DNA extraction and purification of soybean varieties to be identified
[0055] Leaves of soybean material to be identified were placed in 2 mL centrifuge tubes, and genomic DNA was extracted using the classic CTAB method. The specific procedure was as follows: The preserved leaves were removed and placed into numbered 2 mL centrifuge tubes. One steel ball was added to each tube, and the tubes were placed in liquid nitrogen and sampled for 30 seconds. Then, 800 μL of CTAB extraction buffer (preheated to 65°C, 2% CTAB, with 2% added before use) was added. After thoroughly mixing with β-mercaptoethanol, incubate the mixture in a 65°C water bath for 45 minutes, inverting the tube every 10 minutes. After the water bath, remove the centrifuge tube and add 800 μL of phenol, chloroform, and isoamyl alcohol (volume ratio 25:24:1). Mix thoroughly and centrifuge at 12000 rpm for 10 minutes at 4°C. After centrifugation, transfer the supernatant to a new 2 mL centrifuge tube, add 600 μL of chloroform, invert the tube to mix, and centrifuge at 12000 rpm for 10 minutes at 4°C. After centrifugation, transfer the supernatant to a new centrifuge tube. Add 500 μL of pre-chilled isopropanol to the centrifuge tube, mix well, and place in a -20°C freezer for 2 hours to precipitate DNA. Then centrifuge at 12,000 rpm for 10 minutes at 4°C and discard the supernatant. Rinse the precipitate 2-3 times with 75% ethanol solution. Air dry the DNA precipitate at room temperature and then dissolve it with an appropriate amount of ddH2O. Finally, use 1% agarose to check the DNA quality and use NanodropOne to determine the concentration of extracted DNA. Dilute to the required DNA concentration of 100 ng / μL and store at -20°C for later use.
[0056] Step 2: PCR amplification
[0057] PCR system: 100 ng / μL DNA, 1 μL; MIX, 12.5 μL; primers, 3 μL; water, 8.5 μL, total volume 25 μL.
[0058] PCR amplification program: 94℃, 5 min; 94℃, 30 s; 55℃, 30 s; 72℃, 30 s; 72℃, 10 min; 28 cycles, store at 16℃.
[0059] Step 3: Agarose gel electrophoresis detection
[0060] Multiplex PCR products were detected using 1% agarose gel electrophoresis to identify the genotypes of long and short inflorescences. For example... Figure 2 As shown, the genotype of the material that can correctly bind to primer 3100G, has the correct amplification conditions, and cannot bind to primer 3100A, and amplifies without a band, is G; the genotype of the material that can correctly bind to primer 3100A, has the correct amplification conditions, and cannot bind to primer 3100A, and amplifies without a band, is A; the material that can bind to both pairs of primers is a heterozygous genotype.
[0061] Based on the above-described preferred embodiments of the present invention, and through the foregoing description, those skilled in the art can make various changes and modifications without departing from the inventive concept. The technical scope of this invention is not limited to the contents of the specification.
Claims
1. A molecular marker for auxiliary selection of the trait of soybean terminal inflorescence length, characterized in that, The molecular marker is the 271st base of the Glyma.19G193100 gene; the mutation location of the Glyma.19G193100 gene is the 271st base on the CDS sequence, where a G in the reference genome is mutated to an A, resulting in the 91st amino acid in the protein sequence being mutated from proline to serine; the reference genome is Glycine max Wm82.a4.v1; the nucleotide sequence of the Glyma.19G193100 gene is shown in SEQ ID NO:1 of the sequence listing.
2. The application of the molecular marker as described in claim 1 in assisting in the identification or screening of soybean terminal inflorescence length traits.
3. A primer set for detecting the molecular marker as described in claim 1, characterized in that, The primer set includes: The first primer pair is used to specifically amplify DNA sequences containing the G allele; The second primer pair is used to specifically amplify DNA sequences containing the A allele.
4. The primer set according to claim 3, characterized in that, The first primer pair includes upstream and downstream primers as shown in the sequence listing SEQ ID NO:2-3.
5. The primer set according to claim 3, characterized in that, The second primer pair includes upstream and downstream primers as shown in SEQ ID NO:4-5 of the sequence listing.
6. A method for assisting in the identification or screening of soybean terminal inflorescence length traits, characterized in that, Includes the following steps: Genomic DNA was extracted from the soybean sample to be tested; Using genomic DNA as a template, amplification was performed using the primer set described in any one of claims 3-5 to obtain the amplification product; Detect the amplification products and determine the genotype of the 271st base of the Glyma.19G193100 gene based on the amplification products.
7. The method for assisting in the identification or screening of soybean terminal inflorescence length traits according to claim 6, characterized in that, If the genotype of the 271st base of the Glyma.19G193100 gene is A, then the soybean terminal inflorescence length trait is determined to be a long inflorescence trait; if the genotype of the 271st base of the Glyma.19G193100 gene is G, then the soybean terminal inflorescence length trait is determined to be a short inflorescence trait.