Method for screening active ingredients targeting tnfr1 from tremella fermentation broth

Abstract

This invention discloses a method for screening TNFR1-targeting active ingredients in Tremella fuciformis fermentation broth, belonging to the field of active ingredient screening. The method includes: preparing and immobilizing a recombinant TNFR1 extracellular domain protein with a His tag; optimizing the conditions for preparing Tremella fuciformis fermentation broth and removing polysaccharides; subjecting the fermentation broth to affinity incubation with the immobilized protein to specifically capture the binding components; washing to remove impurities and then competitively eluting with imidazole phosphate buffer; finally, separating the TNFR1-targeting active ingredients by the methanol-chloroform method. This method utilizes the specific affinity of the TNFR1 target to efficiently and accurately enrich immunologically active ingredients from the complex Tremella fuciformis fermentation broth. Experiments have shown that the obtained components can significantly promote the proliferation of macrophages and splenocytes, providing a new source of raw materials and technical support for the development of novel immune-enhancing products.

Description

Technical Field

[0001] This invention relates to the field of active ingredient screening, specifically a method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth. Background Technology

[0002] Tumor necrosis factor-α (TNF-α) is a key inflammatory and immunomodulatory cytokine in the human body, mediating complex biological effects through its two main receptors, TNFR1 and TNFR2. The TNFR1 signaling pathway primarily triggers pro-inflammatory responses and apoptosis, and is closely related to various inflammatory diseases, autoimmune diseases, and tissue damage; while TNFR2 is more involved in tissue repair and immune regulation. TNFR1 consists of 439 amino acid residues with a molecular weight of approximately 55 kDa. It is a membrane receptor ubiquitous on the surface of various cell types and can bind to its natural ligand, TNF-α. TNFR1 comprises three parts: an extracellular region, a transmembrane region, and an intracellular region. The extracellular region of TNFR1 is the 41-201 region of the protein (NCBI accession number 1NCF-A). TNF-α specifically binds to the cysteine-rich domains 2 / 3 (CRD2 / CRD3) of the extracellular region of TNFR1 in a trimeric form, transducing the stimulatory signal. First, TRADD is recruited to act as a scaffold, followed by the recruitment of TRAF2, RIPK1, and cIAP1 / 2 to form the activated TNFR1 core signaling complex. Further recruitment of LUBAC, IKK, TAK1, and TAB2 leads to the formation of a stable TNFR1 signaling complex I, which activates the NF-κB, JNK, and MAPK pathways. This mediates key immunomodulatory functions such as immune cell activation, amplified inflammatory responses, and maintenance of immune homeostasis, in addition to regulating cell survival. When the above pathway fails to form TNFR1 signaling complex I, it leads to the internalization and recruitment of FADD and procaspase 8, ultimately resulting in the formation of the pro-apoptotic signaling complex II and initiating cell death. Therefore, TNFR1 is a key target mediating most of the physiological and pathological effects of TNF-α, and antagonists targeting this receptor have become an important direction in new drug development. Currently, TNFR1-targeting drugs such as monoclonal antibodies GSK-2862277 and Atrosimab have entered the clinical trial stage, but they still have certain side effects and high costs. Therefore, it is of great significance to find TNFR1-targeting active ingredients with wider sources and higher safety.

[0003] Tremella fuciformis, a traditional medicinal and edible fungus, is rich in polysaccharides, proteins, and other bioactive substances, and has been proven to possess antioxidant, antitumor, and immunomodulatory effects. However, the small molecule active ingredients in Tremella fuciformis that exert immunomodulatory effects and their targets remain unclear, and its complex component system leads to low utilization rates of effective components. Traditional separation and screening methods are inefficient and lack specificity, making it difficult to accurately identify active molecules acting on specific targets (such as TNFR1) from Tremella fuciformis extracts.

[0004] To address the above problems, this invention provides a method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth. Summary of the Invention

[0005] The purpose of this invention is to provide a method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth, so as to solve the problems raised in the prior art.

[0006] To achieve the above objectives, the present invention provides the following technical solution: A method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth, characterized by comprising the following steps: S1: S1-1: Plasmid construction and transformation: The gene fragment of the extracellular domain of TNFR1 was cloned into the pET-28a(+) vector to construct the recombinant plasmid pET-28a(+)-TNFR1-ECD, and the recombinant plasmid was transformed into competent Escherichia coli cells. S1-2: Culture and Induction of Expression: E. coli transformed with the recombinant plasmid were cultured and the recombinant plasmid was successfully identified; culture was carried out, diluted and cultured again, expression was induced, centrifuged, precipitated, resuspended in phosphate buffer and sonicated, centrifuged to obtain inclusion bodies; the inclusion bodies were then dissolved in denaturing solution, centrifuged and subjected to gradient dialysis for renaturation, and the renatured protein solution was obtained after dialysis. S1-3: Purification of TNFR1-ECD protein: The refolded protein solution was bound to a nickel column, then washed with washing buffer and eluted with elution buffer to obtain the purified protein for identification. S2: S2-1: Strain activation: Tremella fuciformis spores are inoculated into a culture medium and cultured to obtain activated strains; S2-2: Optimized fermentation: The activated strain is inoculated into the seed culture medium to obtain the fermentation seed liquid; the seed liquid is inoculated; it is cultured in the culture medium and the fermentation liquid is collected by centrifugation; the fermentation liquid is concentrated, polysaccharides are removed and dried, and pure water is added to dissolve the dried solids to obtain the polysaccharide-free tremella fermentation liquid. S3: Screening of bioactive components targeting TNFR1 in Tremella fuciformis fermentation broth based on bioaffinity and technical methods: Ni packing was added to the chromatography column, ethanol was released, and the column was washed with deionized water and equilibration buffer successively. A refolded protein solution was added, and the column was shaken to bind. The column was removed, the outlet was opened, and the flow-through was collected. The column was washed with a low concentration of imidazole buffer to remove impurities. After the flow-through was complete, a polysaccharide-free *Tremella fuciformis* fermentation broth was added and the column was shaken to bind. Unbound *Tremella fuciformis* fermentation broth was released, and the column was washed with equilibration buffer to remove any *Tremella fuciformis* fermentation broth that had not bound to TNFR1-ECD. The column was then competitively eluted with a high concentration of imidazole phosphate buffer, and the eluent was collected. Methanol was added, mixed, and allowed to stand. Chloroform was added, mixed, and allowed to stand for separation. The organic and protein phases were released downwards, and the aqueous phase was released upwards, yielding the active ingredient targeting TNFR1.

[0007] Furthermore, the nucleotide sequence of the pET-28a(+) vector is SEQ ID NO:1; the nucleotide sequence of pET-28a(+)-TNFR1-ECD is SEQ ID NO:2; and the amino acid sequence of the purified protein is SEQ ID NO:3.

[0008] Furthermore, in S1-2, after dilution, the mixture was cultured until the OD600 reached 0.6-0.8, and then isopropyl-β-D-thiogalactoside was added for induction expression. The induction parameters were: temperature 16-37℃, induction time 1-16h, and isopropyl-β-D-thiogalactoside concentration 0.01-2mM.

[0009] Furthermore, in S1-3, the washing buffer is 10-25 mM imidazole phosphate buffer, and the elution buffer is 200 mM imidazole phosphate buffer.

[0010] Furthermore, in step S2-2, the culture medium includes nitrogen source A, carbon source, and nitrogen source B.

[0011] Furthermore, the nitrogen source A is any one of peptone, yeast extract, tryptone, and ammonium sulfate.

[0012] Furthermore, the carbon source is any one of sucrose, brown sugar, raffinose, and sorbitol.

[0013] Furthermore, the nitrogen source B is any one or more of a mixture of tryptone, peptone, yeast extract, and ammonium sulfate.

[0014] Furthermore, in S2-2, the pH range during cultivation is 5.0-8.0, and the cultivation time ranges from 6 to 72 hours.

[0015] Furthermore, in S1-2, primer T7 is used during the identification process. The nucleotide sequence of primer T7-F is: TAATACGACTCACTATAGGG The nucleotide sequence of primer T7-R is: GCTAGTATTGCTCAGCGG.

[0016] Compared with the prior art, the beneficial effects of the present invention are: 1. Achieve efficient and precise screening of specific target active ingredients in complex systems: Using TNFR1-ECD protein as an affinity capture probe, it is possible to specifically enrich the active ingredients bound to it from the complex fermentation broth of Tremella fuciformis. Through experimental optimization of the fermentation conditions (nitrogen source, carbon source, pH, time) of Tremella fuciformis, fermentation products with higher wet bacterial weight and polysaccharide expression levels were obtained, which has the effect of screening the yield of potential active ingredients in raw materials.

[0017] 2. Elucidating the material basis and potential mechanism of the immunomodulatory effect of Tremella fuciformis: By screening for a specific target TNFR1, the immunomodulatory activity of Tremella fuciformis is linked to the effect of its specific active ingredients on specific receptors, providing new scientific evidence for explaining its traditional efficacy.

[0018] 3. The screened active ingredients possess clear immune-enhancing functions: By applying the screened active ingredients to RAW264.7 macrophages, a significant cell proliferation-promoting effect was obtained, especially at a concentration of 0.6 mg / mL, demonstrating the potential to directly enhance the function of key cells in innate immunity. Cell experiments proved that the obtained active ingredients could significantly promote the proliferation of macrophages (RAW264.7) and mouse spleen cells, and increase the proportion of T lymphocytes (CD3⁺, CD4⁺, CD8⁺) in spleen cells, confirming their immune-enhancing activity. Attached Figure Description

[0019] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings: Figure 1 This is a schematic diagram of the pET-28a(+)-TNFR1-ECD plasmid recombinantly constructed in Example 1 of the present invention; Figure 2 This is a diagram showing the optimized expression and induction conditions of TNFR1-ECD protein in Escherichia coli Rosetta (DE3) in Example 1 of this invention; Figure 3 The diagram shows the denaturation, renaturation, purification, and identification of TNFR1-ECD protein in Example 1 of this invention. Figure 4 This is a secondary mass spectrometry study of the TNFR1-ECD peptide in Example 1 of the present invention. Figure 1 ; Figure 5 This is a secondary mass spectrometry study of the TNFR1-ECD peptide in Example 1 of the present invention. Figure 2 ; Figure 6 This is a secondary mass spectrometry study of the TNFR1-ECD peptide in Example 1 of the present invention. Figure 3 ; Figure 7 This is a secondary mass spectrometry study of the TNFR1-ECD peptide in Example 1 of the present invention. Figure 4 ; Figure 8 This is a secondary mass spectrometry study of the TNFR1-ECD peptide in Example 1 of the present invention. Figure 5 ; Illustration: Figure 4-8 The horizontal axis represents the mass-to-charge ratio, which is the ratio of the ion's mass to its charge; the vertical axis represents the intensity. Figure 9 This is a diagram showing the optimized fermentation conditions for Tremella fuciformis in Example 1 of the present invention; Figure 10 The total ion effluent of Tremella fuciformis fermentation broth was detected in negative ion mode. Figure 11 The total ion effluent of Tremella fuciformis fermentation broth was detected in positive ion mode. Figure 12 The image shows the total ion effluent of Tremella fuciformis fermentation broth bound to TNFR1-ECD protein as detected in negative ion mode. Figure 13 The image shows the total ion elution of the Tremella fuciformis fermentation broth bound to TNFR1-ECD protein as detected in positive ion mode. Illustration: Figure 10-13 The horizontal axis represents time, which is the time from when the sample enters the chromatographic column to when it is detected by the detector; the vertical axis represents intensity. Figure 14 The figure shows the effects of aqueous and organic phases on RAW264.7 macrophage proliferation and mouse spleen cell proliferation in Example 1 of this invention. Figure 15 This is a diagram showing the effect of aqueous phase and organic phase on the T cell population of mouse spleen cells in Example 1 of the present invention. Detailed Implementation

[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] The sources and types of substances involved in this invention are not specifically limited. Exemplary examples include the following raw materials: isopropyl-β-D-thiogalactoside: CAS: 367-93-1, available from Adatec (Shanghai) Co., Ltd.; CCK-8 reagent kit: catalog number HY-K0301, available from MedChemExpress (Shanghai); NiSepharose™ 6FastFlow affinity chromatography packing material: available from GE Healthcare; all primers were synthesized by Shanghai Bioengineering Co., Ltd.; the accession number of the best-matching protein for the purified TNFR1-ECD protein in the NCBI database is P19438; name: tumor necrosis ctorreceptorsuperfamilymember1A; LB solid medium: peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agar 7.5g / L; LB broth: peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L; PDA solid medium: potato extract 20g / L, glucose 20g / L, potassium dihydrogen phosphate 8.34g / L, dipotassium hydrogen phosphate 0.87g / L, dipotassium hydrogen phosphate trihydrate 1.14g / L, agar 14g / L; seed culture medium: potato extract 20g / L, glucose 20g / L, potassium dihydrogen phosphate 8.34g / L, dipotassium hydrogen phosphate 0.87g / L, dipotassium hydrogen phosphate trihydrate 1.14g / L.

[0022] Example 1:

[0023] S1: Induction and Optimization of Recombinant TNFR1 Extracellular Domain Protein (TNFR1-ECD) Plasmid construction and transformation: The gene fragment encoding the extracellular domain of human TNFR1 (UniProt accession number: 1NCF-A) was cloned into the pET-28a(+) vector to construct the recombinant plasmid pET-28a(+)-TNFR1-ECD. The recombinant plasmid was transformed into E. coli Rosetta(DE3) competent cells by CaCl2 method, and the E. coli transformed with the recombinant plasmid were cultured. Cultivate and induce expression: Inoculate onto LB solid medium containing kana (25 μg / ml) and incubate overnight at 37°C. Select positive colonies identified by colony PCR and inoculate into LB medium containing kana resistance and incubate overnight at 37°C. Dilute 1:100 and continue culturing until OD. 600The concentration of isopropyl-β-D-thiogalactoside was increased to 0.6 to induce expression. Different samples were prepared for expression identification and solubility analysis. The induction temperature, induction time, and isopropyl-β-D-thiogalactoside concentration were optimized. After the induction, the bacterial cell pellet was resuspended in 20 mM phosphate buffer (pH=8.9) and then sonicated. After sonication, the inclusion bodies were obtained by centrifugation. The inclusion bodies were then dissolved in denaturing solution, and the supernatant was collected by centrifugation and subjected to gradient dialysis for refolding. The refolded protein solution was obtained after dialysis. The process for identifying whether E. coli has been successfully transferred into the recombinant plasmid is as follows: Four single colonies from the plate were picked and placed in 10 μL of sterile water. After mixing, the mixture was used as a template. The primers were T7 universal primers, and the amino acid sequences of the primers are as follows: T7-F: TAATACGACTCACTATAGGG T7-R: GCTAGTATTGCTCAGCGG Prepare the following mixture on ice, mix well, and place it in a PCR instrument. Perform PCR amplification under the following conditions: T7-F: 0.5 μL, T7-R: 0.5 μL, template: 1 μL, distilled water: 8 μL, PremixTaq™: 10 μL. The PCR program was as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s; annealing at 45℃ for 1 min; extension at 72℃ for 2 min 30 s for 35 cycles; final extension at 72℃ for 5 min; after PCR amplification, the amplification of the target gene band was determined by 1% agarose gel electrophoresis. Purification and identification of TNFR1-ECD protein: The refolded protein solution was added to a chromatography column containing 1 mL of NiSepharose™ 6 FastFlow packing material and incubated at 4 °C with shaking for 6 h; impurities were removed by washing with 10-50 mM imidazole washing buffer, and finally, the specifically bound TNFR1-ECD protein was eluted with 200 mM imidazole elution buffer to obtain the purified protein solution; samples of flow-through, washing buffer, and elution buffer were taken for SDA-PAGE analysis. S2: Optimization and treatment of Tremella fuciformis fermentation liquid Strain activation: Tremella fuciformis spores were inoculated onto PDA solid medium and cultured at 25°C for 48 hours to obtain activated strains; Optimize fermentation: Inoculate the activated strain into the seed culture medium and culture for 2 days to obtain the fermentation seed liquid; take 1 mL of the seed liquid and inoculate it into different fermentation culture media; culture, centrifuge and collect the fermentation liquid; concentrate the fermentation liquid, remove polysaccharides and dry it to obtain polysaccharide-free Tremella fuciformis fermentation liquid; S3: Screening of bioactive components targeting TNFR1 in Tremella fuciformis fermentation broth based on bioaffinity and technical methods. Remove the chromatography column containing 1 mL of packing material, fix the column on the iron stand, open the lower outlet of the column to release 20% ethanol. After the ethanol has drained, wash the column 5 times with deionized water (1 mL each time), then wash the column with equilibration buffer. After the equilibration buffer has drained, slowly add the renatured protein solution to the column and incubate at 4°C on a shaker for 2 hours. Remove the column and refix it on the iron stand, open the lower outlet to release the unbound TNFR1-ECD protein solution, and after the liquid has drained, wash the column twice with a low concentration of imidazole buffer to remove impurities and loosely bound TNFR1-ECD. Then, add the polysaccharide-free Tremella fuciformis fermentation broth and incubate at 4°C on a shaker for 2 hours. Remove the column and refix it on the iron stand, open the lower outlet to release the unbound Tremella fuciformis fermentation broth, and after the liquid has drained... The chromatography column was washed 5 times with 1 mL of equilibration buffer (phosphate buffer) each time to remove unbound Tremella fuciformis fermentation broth. Then, the column was washed 10 times with 1 mL of 200 mM imidazole phosphate buffer each time to elute the TNFR1-ECD protein and the bound Tremella fuciformis fermentation broth. The eluent was collected and transferred to a separatory funnel. Two volumes of methanol were added and mixed thoroughly, then allowed to stand. After standing, one volume of chloroform was added, mixed thoroughly, and allowed to separate into three layers: an upper aqueous phase (methanol and water-soluble substances), a middle layer of TNFR1-ECD protein, and a lower organic phase (chloroform and organic substances dissolved in chloroform). The organic and protein phases were released downwards (TNFR1-ECD protein) and upwards (the aqueous phase). The active ingredient targeting TNFR1 was obtained.

[0024] Experiment 1: The expression of TNFR1-ECD protein and the optimal conditions for its induction were determined: The pET-28a(+)-TNFR1-ECD recombinant plasmid was transformed into *E. coli* Rosetta(DE3) expression strain. Single colonies were selected for polymerase chain reaction (PCR). These four single colonies were induced to express protein using isopropyl-β-D-thiogalactoside. Whole-cell lysate was analyzed by SDS-PAGE and Western blot. For SDS-PAGE, *E. coli* protein samples were boiled at 100℃ for 2 min, then subjected to SDS-PAGE on a 12% polyacrylamide gel. After electrophoresis, the gel was stained and destained with Coomassie Brilliant Blue R-250 (ST1123-5g, Beyotime, Shanghai, China) solution. Protein bands were observed, and samples were collected. The isolated proteins were transferred to nitrocellulose membranes using a wet transfer method, blocked with 5% skim milk at room temperature for 1.5 h, and then incubated overnight with primary antibody at 4°C. Histag Rabbit Polyclonal Antibody (R1207-2, 1:5000) was purchased from HUABIO (Hangzhou, China). Subsequently, it was incubated with HRP Conjugated Goat Anti-Rabbit IgG Polyclonal Antibody (HA1001, 1:10000) at room temperature for 1 h. Finally, it was exposed and imaged using an ECL chemiluminescence ultrasensitive colorimetric kit (36208ES60, Yeasen, Shanghai, China) under a chemiluminescence image analysis system. like Figure 1-2 As shown, Figure 1 A schematic diagram of the pET-28a(+)-TNFR1-ECD plasmid constructed for recombination; Figure 2 A: SDS-PAGE and Western blot detection of TNFR1-ECD protein expression in Escherichia coli Rosetta (DE3); M: Protein Marker; Lane 1: Whole bacteria lysed after induction of colonies containing pET-28a empty plasmid; Lanes 2-5: Whole bacteria lysed after induction of colonies containing pET-28a-TNFR1-ECD recombinant plasmid; Figure 2 B represents the expression of TNFR1-ECD protein in *E. coli* before and after induction with Rosetta (DE3) by SDS-PAGE and Western blot; M: Protein Marker; Lane 1: Whole bacteria fragmented after induction containing pET-28a-TNFR1-ECD recombinant plasmid; Lane 2: Whole bacteria fragmented before induction containing pET-28a-TNFR1-ECD recombinant plasmid; Lane 3: Whole bacteria fragmented after induction containing pET-28a empty plasmid; Lane 4: Whole bacteria fragmented before induction containing pET-28a empty plasmid. Figure 2C: SDS-PAGE analysis of TNFR1-ECD protein solubility; M: Protein Marker; Lane 1: Whole cells containing pET-28a-TNFR1-ECD recombinant plasmid induced and then lysed; Lane 2: Supernatant containing pET-28a-TNFR1-ECD recombinant plasmid induced and then lysed; Lane 3: Precipitate containing pET-28a-TNFR1-ECD recombinant plasmid induced and then lysed. Figure 2 D represents the optimal induction temperature for SDS-PAGE detection of TNFR1-ECD protein expression; M: Protein Marker; Lanes 1-4: Colonies containing pET-28a-TNFR1-ECD recombinant plasmid were lysed and precipitated after induction at 16℃, 20℃, 25℃, 30℃, and 37℃. Figure 2 E represents the optimal inducing agent concentration for SDS-PAGE detection of TNFR1-ECD protein; M: Protein Marker; Lanes 1-7: Colonies containing pET-28a-TNFR1-ECD recombinant plasmid were lysed and precipitated after induction with 0, 0.01, 0.05, 0.1, 0.5, 1, and 2 mM isopropyl-β-D-thiogalactoside. Figure 2 F represents the optimal induction time for SDS-PAGE detection of TNFR1-ECD protein; M: Protein Marker; Lanes 1-8: bacterial cell lysis and precipitation after induction of colonies containing pET-28a-TNFR1-ECD recombinant plasmid for 0, 2, 4, 6, 8, 12, 14, and 16 hours.

[0025] Conclusion: In Figure 2 As shown in Figure A, compared with the negative control group strain No. 1 containing the pET-28a-TNFR1-ECD recombinant plasmid, strains No. 2-5 all showed the target band at approximately 18 kDa. Western blot results also showed that strains No. 2-5 all showed specific bands at the corresponding positions. SDS-PAGE and Western blot analyses of the bacterial cultures before and after induction were performed, as follows: Figure 2 As shown in Figure B, strains transformed with the empty pET-28a plasmid did not show the target band before or after induction, while strains transformed with the recombinant pET-28a-TNFR1-ECD plasmid showed the target band after induction. E. coli generally expresses exogenous proteins intracellularly, mainly in two forms: soluble expression and inclusion body expression. SDS-PAGE analysis was performed on the lysed whole cells, supernatant, and precipitate after induction. Figure 2 C, TNFR1-ECD protein was expressed in both the supernatant and the precipitate, but the protein content was higher in the precipitate. Therefore, the precipitate was chosen for subsequent experiments. Furthermore, the induction temperature, induction time, and isopropyl-β-D-thiogalactoside concentration were optimized, and the results are as follows: Figure 2(DF) showed the highest expression level of TNFR1-ECD protein after 2 h of induction at 37℃ and 0.5 mM isopropyl-β-D-thiogalactoside concentration.

[0026] Experiment 2: TNFR1-ECD protein denaturation, renaturation, purification, and identification: The strain containing the pET-28a-TNFR1-ECD recombinant plasmid was induced to express under optimal induction conditions, resulting in a large amount of cell lysis and precipitation. The protein was then dissolved in 8M urea, refolded by dialysis, and analyzed by SDS-PAGE electrophoresis. To verify the correctness of the amino acid sequence of the purified TNFR1-ECD protein, high performance liquid chromatography-mass spectrometry (HPLC-MS) was used to analyze the TNFR1-ECD protein by mass spectrometry. Figure 3 The diagram shows the denaturation, renaturation, purification, and identification of TNFR1-ECD protein in Example 1 of this invention. Figure 3 A: TNFR1-ECD protein denaturation and renaturation detection by SDS-PAGE and Western blot; M: Protein Marker; 1: TNFR1-ECD protein denaturation supernatant; 2: TNFR1-ECD protein renaturation solution; Figure 3 B represents SDS-PAGE detection of Ni. 2+ Affinity chromatography was used to purify TNFR1-ECD protein; M: Protein Marker; Lane 1: TNFR1-ECD protein refolding buffer; Lane 2: Flow-through buffer: TNFR1-ECD protein not bound to the column; Lanes 3-6: 10 mM imidazole wash buffer; Lanes 7-10: 25 mM imidazole wash buffer; Lanes 11-14: 50 mM imidazole wash buffer; Lanes 15-20: 200 mM imidazole elution buffer; Figure 3 C represents the detection of amino acid sequence matching of TNFR1-ECD protein using high performance liquid chromatography-mass spectrometry; Figure 4-8 This is a secondary mass spectrometry study of the TNFR1-ECD peptide in Example 1 of the present invention. Figure 1-5 ,and Figure 3 C corresponds to; Conclusion: Figure 3 A. The content of impurities in the refolded protein solution is relatively low, because the refolded protein solution is treated with Ni... 2+ Affinity chromatography purification was performed, followed by elution of TNFR1-ECD protein with imidazole; like Figure 3B. SDS-PAGE results showed that unbound target protein was present in the flow-through buffer. Small amounts of target protein and other proteins were eluted in the 10mM, 25mM and 50mM imidazole elution buffers. Finally, the 200mM imidazole elution buffer eluted the firmly bound target protein, resulting in a purified protein solution. like Figure 3 C. The best matching protein accession number for this proteome in the NCBI database is P19438, with a matching value as high as 297.53. Meanwhile, the TNFR1 protein has a total of 161 amino acids, and 16 peptides were used to qualitatively identify this proteome. The amino acid sequences marked in red are the matching peptides from mass spectrometry analysis, with a coverage of 60.25% of the entire amino acid sequence, indicating high accuracy of the protein sequence. The amino acid sequence of the purified TNFR1-ECD protein is correct (matching GeneBank accession number: P19438).

[0027] Experiment 3: Optimization of fermentation conditions for Tremella fuciformis and screening of its active ingredients: The fermentation conditions for *Tremella fuciformis* were optimized. A blank control was prepared using a fermentation medium containing 3 g / L peptone, 3 g / L yeast extract, 30 g / L glucose, and 1.5 g / L magnesium sulfate. Nitrogen source A, nitrogen source B, carbon source, pH, and fermentation time were optimized. The results are as follows: Figure 9 (AE) Figure 9 This is a diagram showing the optimized fermentation conditions for Tremella fuciformis in Example 1 of the present invention; wherein... Figure 9 Nitrogen source A optimization: blank control, peptone, yeast extract, tryptone, and ammonium sulfate were all optimized according to a nitrogen source of 6 g / L; Figure 9 Nitrogen source B optimization: blank control, 1 part tryptone + 1 part peptone, 1 part tryptone + 1 part yeast extract, 2 parts tryptone, 1 part tryptone + 1 part ammonium sulfate, all optimized with a nitrogen source of 6 g / L; Figure 9 C represents carbon source optimization: blank control, sucrose, brown sugar, raffinose, and sorbitol were all optimized with a carbon source of 30 g / L; Figure 9 D represents pH optimization: 5.0, 5.5, 6.0, 6.5, 7.5, 8.0; Figure 9 E represents time optimization (h): 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, 72; Figure 10 The total ion effluent of Tremella fuciformis fermentation broth was detected in negative ion mode. Figure 11 The total ion effluent of Tremella fuciformis fermentation broth was detected in positive ion mode. Figure 12 The image shows the total ion effluent of Tremella fuciformis fermentation broth bound to TNFR1-ECD protein as detected in negative ion mode. Figure 13This is a total ion effluent curve of Tremella fuciformis fermentation broth bound to TNFR1-ECD protein, detected in positive ion mode.

[0028] Conclusion: Under the conditions of 2 parts by mass of tryptone as nitrogen source, sucrose as carbon source, pH=5.5 and fermentation time of 60 h, the wet mycelium weight and polysaccharide expression of Tremella fuciformis were high. According to the mass spectrometry detection results, 319 active molecules were detected in positive ion mode and 159 active molecules were detected in negative ion mode.

[0029] Experiment 4: Effects of TNFR1-ECD active ingredients on the proliferation of macrophages and mouse spleen cells: Cells: RAW264.7 mouse mononuclear macrophage leukemia cells, purchased from the Cell Bank of the Chinese Academy of Sciences; aseptically isolated BALB / c mouse spleen cells; Reagents: CCK-8 cell proliferation assay kit (purchased from MedChemExpress); DMEM complete medium: DMEM basal medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin; RPMI-1640 complete medium: RPMI-1640 basal medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin; fetal bovine serum (FBS). Experimental Methods: RAW264.7 cells were seeded at 10,000 cells / well in 96-well plates (100 μL per well). After 24 h of cell culture, the active ingredient targeting TNFR1 was diluted to different concentrations in DMEM complete medium and added to each well (100 μL per well) according to the group. After 48 h of culture, the medium was discarded, and 100 μL of DMEM complete medium containing 10% CCK-8 (HY-K0301, MedChemExpress, Shanghai, China) solution was added to each well. After culturing for another 1-2 hours, the absorbance (A) at 450 nm was measured using a microplate reader, and cell viability was calculated. The cell viability calculation formula was: Cell viability = [(A cells experimental - A blank) / (A cells control - A blank)] × 100%; GraphPad Prism was used for plotting. Line graphs were constructed. Mouse spleen cells were seeded at 500,000 cells / well into 96-well plates. The dried Tremella fuciformis fermentation broth was diluted to 0.6 mg / mL with RPMI-1640 complete medium and added to the 96-well plates according to the groups. After culturing for 48 h, 10 μL of CCK-8 was added to each well. After culturing for another 3-4 hours, the absorbance (A) was measured at 48 h, and the cell proliferation rate was calculated. To accurately investigate the promoting effect of aqueous phase and organic phase on RAW264.7 cell proliferation and the maximum promoting concentration, RAW264.7 cells were treated with aqueous phase and organic phase at concentration gradients of 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mg / mL for 24, 48, and 72 h. Mouse spleen cells were treated with 0.6 mg / mL aqueous phase and organic phase, respectively, and the proliferation effect of aqueous phase and organic phase on mouse spleen cells was investigated using the CCK-8 assay. Flow cytometry was used to further identify T cell populations in mouse spleen cells, and the effects of aqueous and organic phases on T cell populations in mouse spleen cells were studied. Mouse spleen cells were cultured in a 5*10⁸ atmosphere. 6 Cells were seeded per well in 6-well plates, and dried Tremella fuciformis fermentation broth was added to a final concentration of 0.6 mg / mL. The control group was treated with the same volume of RPMI-1640 complete medium. After 48 h of culture, cell identification was performed using APC-anti-mouse CD3 antibody, FITC-anti-mouse CD4 antibody, PE-anti-mouse CD8 antibody, and mouse Fc receptor blocker. Cells were pipetted with RPMI-1640 medium and collected into Eppendorf tubes. After centrifugation, 100 μL of staining buffer was added to resuspend the cells, followed by 5 μL of Fc blocker. The cells were incubated at room temperature for 5-10 min, then the staining antibody was added, and the cells were incubated on ice in the dark for 20 min. After centrifugation and washing twice with staining buffer, the cells were resuspended in 1 mL of staining buffer and analyzed by flow cytometry within 1 hour.

[0030] Figure 14The figure shows the effects of aqueous and organic phases on RAW264.7 macrophage proliferation and mouse spleen cell proliferation in Example 1 of this invention; wherein... Figure 14 A represents RAW264.7 macrophages treated with aqueous and organic phases at different concentration gradients. Cell viability was detected by the Cell Counting Kit-8 (CCK-8) after 48 h. ns: P>0.05, *: P<0.05, **: P<0.01, ****: P<0.0001; Figure 14 B represents RAW264.7 macrophages treated with different concentrations of aqueous and organic phases. Cell viability was detected at 24h, 48h, and 72h using a cell counting kit-8 (CCK-8). *: P<0.05, ***: P<0.001, ****: P<0.0001. Figure 14 C represents mouse spleen cells treated with aqueous and organic phases at a concentration of 0.6 mg / mL for 48 h, with cell viability detected using a cell counting kit-8 (CCK-8); ***: P < 0.001; Figure 15 T cell populations were detected by flow cytometry after mouse spleen cells were treated with aqueous and organic phases at a concentration of 0.6 mg / mL for 48 h; **: P<0.01, ***: P<0.001.

[0031] Conclusion: Figure 14 As shown in Figure A, both the aqueous and organic phases significantly promoted the proliferation of RAW264.7 cells (P<0.001); Figure 14 As shown in Figure B, both the aqueous and organic phases exhibited the highest promoting effect on cell proliferation at a concentration of 0.6 mg / mL, with a statistically significant difference (P < 0.0001). Figure 14 As shown in Figure C, both the aqueous phase and the organic phase had a statistically significant effect on the proliferation of mouse spleen cells (P<0.0001). Figure 15 The results showed that the T cell population of mouse spleen cells reacted with aqueous and organic phases was significantly higher than that of the control group, and the proportion was significantly increased (P<0.001).

[0032] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

[0033] sequence list <110> Jilin University <120> Screening method for TNFR1-targeting active ingredients in Tremella fuciformis fermentation broth <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 5369 <212> DNA <213> Artificial Sequence <400> 1 atccggatat agttcctcctttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt 180 cgacggagct cgaattcgga tccgcgaccc atttgctgtc caccagtcat gctagccata 240 tggctgccgc gcggcaccag gccgctgctg tgatgatgat gatgatggct gctgcccatg 300 gtatatctcc ttcttaaagt taaacaaaat tatttctaga ggggaattgt tatccgctca 360 caattcccct atagtgagtc gtattaattt cgcgggatcg agatctcgat cctctacgcc 420 ggacgcatcg tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc 480 gacatcaccg atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc 540 gtgggtatgg tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca 600 ccattccttg cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg 660 caggagtcgc ataagggaga gcgtcgagat cccggacacc atcgaatggc gcaaaacctt 720 tcgcggtatg gcatgatagc gcccggaaga gagtcaattc agggtggtga atgtgaaacc 780 agtaacgtta tacgatgtcg cagagtatgc cggtgtctct tatcagaccg tttcccgcgt 840 ggtgaaccag gccagccacg tttctgcgaa aacgcgggaa aaagtggaag cggcgatggc 900 ggagctgaat tacattccca accgcgtggc acaacaactg gcgggcaaac agtcgttgct 960 gattggcgtt gccacctcca gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat 1020 taaatctcgc gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg 1080 cgtcgaagcc tgtaaagcgg cggtgcacaa tcttctcgcg caacgcgtca gtgggctgat 1140 cattaactat ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt 1200 tccggcgtta tttcttgatg tctctgacca gacacccatc aacagtatta ttttctccca 1260 tgaagacggt acgcgactgg gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc 1320 gctgttagcg ggcccattaa gttctgtctc ggcgcgtctg cgtctggctg gctggcataa 1380 atatctcact cgcaatcaaa ttcagccgat agcggaacgg gaaggcgact ggagtgccat 1440 gtccggtttt caacaaacca tgcaaatgct gaatgagggc atcgttccca ctgcgatgct 1500 ggttgccaac gatcagatgg cgctgggcgc aatgcgcgcc attaccgagt ccgggctgcg 1560 cgttggtgcg gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat 1620 cccgccgtta accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg 1680 cttgctgcaa ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact 1740 ggtgaaaaga aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 1800 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 1860 acgcaattaa tgtaagttag ctcactcatt aggcaccggg atctcgaccg atgcccttga 1920 gagccttcaa cccagtcagc tccttccggt gggcgcgggg catgactatc gtcgccgcac 1980 ttatgactgt cttctttatc atgcaactcg taggacaggt gccggcagcg ctctgggtca 2040 ttttcggcga ggaccgcttt cgctggagcg cgacgatgat cggcctgtcg cttgcggtat 2100 tcggaatctt gcacgccctc gctcaagcct tcgtcactgg tcccgccacc aaacgtttcg 2160 gcgagaagca ggccattatc gccggcatgg cggccccacg ggtgcgcatg atcgtgctcc 2220 tgtcgttgag gacccggcta ggctggcggg gttgccttac tggttagcag aatgaatcac 2280 cgatacgcga gcgaacgtga agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa 2340 catgaatggt cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct 2400 gcaccattat gttccggatc tgcatcgcag gatgctgctg gctaccctgt ggaacaccta 2460 catctgtatt aacgaagcgc tggcattgac cctgagtgat ttttctctgg tcccgccgca 2520 tccataccgc cagttgttta ccctcacaac gttccagtaa ccgggcatgt tcatcatcag 2580 taacccgtat cgtgagcatc ctctctcgtt tcatcggtat cattaccccc atgaacagaa 2640 atccccctta cacggaggca tcagtgacca aacaggaaaa aaccgccctt aacatggccc 2700 gctttatcag aagccagaca ttaacgcttc tggagaaact caacgagctg gacgcggatg 2760 aacaggcaga catctgtgaa tcgcttcacg accacgctga tgagctttac cgcagctgcc 2820 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 2880 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 2940 ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg 3000 gcttaactat gcggcatcag agcagattgt actgagagtg caccatatat gcggtgtgaa 3060 ataccgcaca gatgcctaag gagaaaaatac cgcatcaggc gctcttccgc ttcctcgctc 3120 actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 3180 gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 3240 cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 3300 ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 3360 ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 3420 ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 3480 agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 3540 cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 3600 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 3660 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 3720 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 3780 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 3840 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 3900 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgaa caataaaact 3960 gtctgcttac ataaacagta atacaagggg tgttatgagc catattcaac gggaaacgtc 4020 ttgctctagg ccgcgattaa attccaacat ggatgctgat ttatatgggt ataaatgggc 4080 tcgcgataat gtcgggcaat caggtgcgac aatctatcga ttgtatggga agcccgatgc 4140 gccagagttg tttctgaaac atggcaaagg tagcgttgcc aatgatgtta cagatgagat 4200 ggtcagacta aactggctga cggaatttat gcctcttccg accatcaagc attttatccg 4260 tactcctgat gatgcatggt tactcaccac tgcgatcccc gggaaaacag cattccaggt 4320 attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag tgttcctgcg 4380 ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg tatttcgtct 4440 cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga 4500 gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataaacttt tgccattctc 4560 accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt ttgacgaggg 4620 gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat accaggatct 4680 tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac ggctttttca 4740 aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga 4800 gtttttctaa gaattaattc atgagcggat acatatttga atgtatttag aaaaataaac 4860 aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgaaattgta aacgttaata 4920 ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 4980 aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 5040 cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 5100 ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 5160 cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 5220 ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 5280 gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 5340 cgccgctaca gggcgcgtcc cattcgcca 5369 <210> 3 <211> 5719 <212> DNA <213> Artificial Sequence <400> 3 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gaggttttcg atctgcggca 180 ggcacagttt ggtgcattcc agagattttt tgcagttaga gcaagaaacg cattcgtttt 240 cacgcagga gaaacccgcg tggcaggtgc aaacggtgtt ctgtttttcc tggcaagaca 360. ggtgaacggt accgttcagg cacagagagc agttgaagca ctggaacagg ttttcagacc agtagcg gtactggttt ttacggcaac cgcaaacggt atcacgatca acggtgcaag 420 aagagatttc aacctgaccc atttctttac ggcatttag gcaagacagg cagtgacgca 480 ggtggttttc agacgcggtg aaagaaccag attcgcattc acggcaatcg gtatcctgac 540 ccggacccgg acaatcgttg tacaggtagg tacctttgtg gcatttggtg cagcagatag agttgttctg cgggtggatg tatttaccct gcgggcaaac agaatccatg gtatatctcc ttcttaaagt taaacaaaat tatttctaga ggggaattgt tatccgctca caattcccct atagtgagtc gtattaattt cgcgggatcg atagtcgat cctctacgcc ggacgcatcg 780 tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc gacatcaccg 840 atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc gtgggtatgg 900 tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca ccattccttg 960 cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg caggagtcgc 1020 ataagggaga gcgtcgagat cccggacacc atcgaatggc gcaaaacctt tcgcggtatg 1080 gcatgatagc gcccggaaga gagtcaattc agggtggtga atgtgaaacc agtaacgtta 1140 tacgatgtcg cagagtatgc cggtgtctct tatcagaccg tttcccgcgt ggtgaaccag 1200 gccagccacg tttctgcgaa aacgcgggaa aaagtggaag cggcgatggc ggagctgaat 1260 tacattccca accgcgtggc acaacaactg gcgggcaaac agtcgttgct gattggcgtt 1320 gccacctcca gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat taaatctcgc 1380 gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg cgtcgaagcc 1440 tgtaaagcgg cggtgcacaa tcttctcgcg caacgcgtca gtgggctgat cattaactat 1500 ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt tccggcgtta 1560 tttcttgatg tctctgacca gacacccatc aacagtatta ttttctccca tgaagacggt 1620 acgcgactgg gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc gctgttagcg 1680 ggcccattaa gttctgtctc ggcgcgtctg cgtctggctg gctggcataa atatctcact 1740 cgcaatcaaa ttcagccgat agcggaacgg gaaggcgact ggagtgccat gtccggtttt 1800 caacaaacca tgcaaatgct gaatgagggc atcgttccca ctgcgatgct ggttgccaac 1860 gatcagatgg cgctgggcgc aatgcgcgcc attaccgagt ccgggctgcg cgttggtgcg 1920 gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat cccgccgtta 1980 accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa 2040 ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact ggtgaaaaga 2100 aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 2160 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 2220 tgtaagttag ctcactcatt aggcaccggg atctcgaccg atgcccttga gagccttcaa 2280 cccagtcagc tccttccggt gggcgcgggg catgactatc gtcgccgcac ttatgactgt 2340 cttctttatc atgcaactcg taggacaggt gccggcagcg ctctgggtca ttttcggcga 2400 ggaccgcttt cgctggagcg cgacgatgat cggcctgtcg cttgcggtat tcggaatctt 2460 gcacgccctc gctcaagcct tcgtcactgg tcccgccacc aaacgtttcg gcgagaagca 2520 ggccattatc gccggcatgg cggccccacg ggtgcgcatg atcgtgctcc tgtcgttgag 2580 gacccggcta ggctggcggg gttgccttac tggttagcag aatgaatcac cgatacgcga 2640 gcgaacgtga agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa catgaatggt 2700 cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct gcaccattat 2760 gttccggatc tgcatcgcag gatgctgctg gctaccctgt ggaacaccta catctgtatt 2820 aacgaagcgc tggcattgac cctgagtgat ttttctctgg tcccgccgca tccataccgc 2880 cagttgttta ccctcacaac gttccagtaa ccgggcatgt tcatcatcag taacccgtat 2940 cgtgagcatc ctctctcgtt tcatcggtat cattaccccc atgaacagaa atccccctta 3000 cacggaggca tcagtgacca aacaggaaaa aaccgccctt aacatggccc gctttatcag 3060 aagccagaca ttaacgcttc tggagaaact caacgagctg gacgcggatg aacaggcaga 3120 catctgtgaa tcgcttcacg accacgctga tgagctttac cgcagctgcc tcgcgcgttt 3180 cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct 3240 gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg 3300 tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg gcttaactat 3360 gcggcatcag agcagattgt actgagagtg caccatatat gcggtgtgaa ataccgcaca 3420 gatgcgtaag gagaaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc 3480 tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 3540 tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 3600 ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg 3660 agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat 3720 accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta 3780 ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct 3840 gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc 3900 ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa 3960 gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg 4020 taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag 4080 tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 4140 gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta 4200 cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc 4260 agtggaacga aaactcacgt taagggattt tggtcatgaa caataaaact gtctgcttac 4320 ataaacagta atacaagggg tgttatgagc catattcaac gggaaacgtc ttgctctagg 4380 ccgcgattaa attccaacat ggatgctgat ttatatgggt ataaatgggc tcgcgataat 4440 gtcgggcaat caggtgcgac aatctatcga ttgtatggga agcccgatgc gccagagttg 4500 tttctgaaac atggcaaagg tagcgttgcc aatgatgtta cagatgagat ggtcagacta 4560 aactggctga cggaatttat gcctcttccg accatcaagc attttatccg tactcctgat 4620 gatgcatggt tactcaccac tgcgatcccc gggaaaacag cattccaggt attagaaagaa 4680 tatcctgatt caggtgaaaa tattgttgat gcgctggcag tgttcctgcg ccggttgcat 4740 tcgattcctg tttgtaattg tccttttaac agcgatcgcg tatttcgtct cgctcaggcg 4800 caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga gcgtaatggc 4860 tggcctgttg aacaagtctg gaaagaaatg cataaacttt tgccattctc accggattca 4920 gtcgtcactc atggtgattt ctcacttgat aaccttattt ttgacgaggg gaaattaata 4980 ggttgtattg atgttggacg agtcggaatc gcagaccgat accaggatct tgccatccta 5040 tggaactgcc tcggtgagtt ttctccttca ttacagaaac ggctttttca aaaatatggt 5100 attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga gttttctaa 5160 gaattaattc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt 5220 tccgcgcaca tttccccgaa aagtgccacc tgaaattgta aacgttaata ttttgttaaa 5280 attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa 5340 aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa 5400 caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca 5460 gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt cgaggtgccg 5520 taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc 5580 ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc 5640 aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca 5700 gggcgcgtcc cattcgcca 5719 <210> 3 <211> 162 <212> PRT <213> Artificial Sequence <400> 3 Met Asp Ser Val Cys Pro Gln Gly Lys Tyr Ile His Pro Gln Asn Asn 1 5 10 15 Ser Ile Cys Cys Thr Lys Cys His Lys Gly Thr Tyr Leu Tyr Asn Asp 20 25 30 Cys Pro Gly Pro Gly Gln Asp Thr Asp Cys Arg Glu Cys Glu Ser Gly 35 40 45 Ser Phe Thr Ala Ser Glu Asn His Leu Arg His Cys Leu Ser Cys Ser 50 55 60 Lys Cys Arg Lys Glu Met Gly Gln Val Glu Ile Ser Ser Cys Thr Val 65 70 75 80 Asp Arg Asp Thr Val Cys Gly Cys Arg Lys Asn Gln Tyr Arg His Tyr 85 90 95 Trp Ser Glu Asn Leu Phe Gln Cys Phe Asn Cys Ser Leu Cys Leu Asn 100 105 110 Gly Thr Val His Leu Ser Cys Gln Glu Lys Gln Asn Thr Val Cys Thr 115 120 125 Cys His Ala Gly Phe Phe Leu Arg Glu Asn Glu Cys Val Ser Cys Ser 130 135 140 Asn Cys Lys Lys Ser Leu Glu Cys Thr Lys Leu Cys Leu Pro Gln Ile 145 150 155 160 Glu Asn

Claims

1. A method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth, characterized in that: Includes the following steps: S1: S1-1: Plasmid construction and transformation: The gene fragment of the extracellular domain of TNFR1 was cloned into the pET-28a(+) vector to construct the recombinant plasmid pET-28a(+)-TNFR1-ECD, and the recombinant plasmid was transformed into competent Escherichia coli cells. S1-2: Culture and Induction of Expression: E. coli transformed with the recombinant plasmid were cultured and the recombinant plasmid was successfully identified; culture was carried out, diluted and cultured again, expression was induced, centrifuged, precipitated, resuspended in phosphate buffer and sonicated, centrifuged to obtain inclusion bodies; the inclusion bodies were then dissolved in denaturing solution, centrifuged and subjected to gradient dialysis for renaturation, and the renatured protein solution was obtained after dialysis. S1-3: Purification of TNFR1-ECD protein: The refolded protein solution was bound to a nickel column, then washed with washing buffer and eluted with elution buffer to obtain the purified protein for identification. S2: S2-1: Strain activation: Tremella fuciformis spores are inoculated into a culture medium and cultured to obtain activated strains; S2-2: Optimized fermentation: The activated strain is inoculated into the seed culture medium to obtain the fermentation seed liquid; Seed liquid was inoculated; cultured in culture medium, and fermentation broth was collected by centrifugation; after concentration of fermentation broth, polysaccharides were removed and dried, and pure water was added to dissolve the dried solid to obtain polysaccharide-free tremella fermentation broth; S3: Screening of bioactive components targeting TNFR1 in Tremella fuciformis fermentation broth based on bioaffinity and technical methods: Ni packing material was added to the chromatography column, ethanol was released, and the column was washed successively with deionized water and equilibration buffer. A refolded protein solution was added, and the column was shaken to bind. The column was removed, the outlet was opened, and the flow-through was collected. The column was washed with a low concentration of imidazole buffer to remove impurities. After the flow-through was complete, polysaccharide-free *Tremella fuciformis* fermentation broth was added and the column was shaken to bind. Unbound *Tremella fuciformis* fermentation broth was released, and the column was washed with equilibration buffer to remove unbound *Tremella fuciformis* fermentation broth. Then, a high concentration of imidazole phosphate buffer was used for competitive elution, the eluent was collected, methanol was added, and the mixture was allowed to stand. Chloroform was added, and the mixture was stirred and allowed to stand for separation. The organic and protein phases were released downwards, and the aqueous phase was released upwards, yielding the active ingredient targeting TNFR1.

2. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 1, characterized in that: The nucleotide sequence of the pET-28a(+) vector is SEQ ID NO:1; the nucleotide sequence of pET-28a(+)-TNFR1-ECD is SEQ ID NO:2; and the amino acid sequence of the purified protein is SEQ ID NO:

3.

3. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 1, characterized in that: In steps S1-2, after dilution, the culture continues until OD. 600 The initial concentration was 0.6-0.8, followed by the addition of isopropyl-β-D-thiogalactoside for induction. The induction parameters were: temperature 16-37℃, induction time 1-16h, and isopropyl-β-D-thiogalactoside concentration 0.01-2mM.

4. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 1, characterized in that: In steps S1-3, the washing buffer is 10-25 mM imidazole phosphate buffer, and the elution buffer is 200 mM imidazole phosphate buffer.

5. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 1, characterized in that: In step S2-2, the culture medium includes nitrogen source A, carbon source, and nitrogen source B.

6. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 5, characterized in that: The nitrogen source A is any one of peptone, yeast extract, tryptone, and ammonium sulfate.

7. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 5, characterized in that: The carbon source is any one of sucrose, brown sugar, raffinose, or sorbitol.

8. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 5, characterized in that: The nitrogen source B is any one or more of a mixture of tryptone, peptone, yeast extract, and ammonium sulfate.

9. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 1, characterized in that: In step S2-2, the pH range during cultivation is 5.0-8.0, and the cultivation time ranges from 6 to 72 hours.

10. The method for screening active ingredients targeting TNFR1 in Tremella fuciformis fermentation broth according to claim 1, characterized in that: In steps S1-2, primer T7 is used during the identification process. The nucleotide sequence of primer T7-F is: TAATACGACTCACTATAGGG The nucleotide sequence of primer T7-R is: GCTAGTATTGCTCAGCGG.

Images