Application of gene LpCbDR3 in improving salt tolerance and forage quality of ryegrass

Abstract

The application discloses genes LpCbDR3 In the application of improving the salt tolerance and forage quality of rye grass, transgenic RNAi- LpCbDR3 The crude protein content and fat of the rye grass are significantly improved, and the ADF, NDF and Ash contents are significantly reduced. LpCbDR3 The transgenic rye grass has a significantly improved chlorophyll content compared with the control group, which indicates that chlorophyll is degraded under the salt stress condition, and the transgenic plant can reduce the chlorophyll decomposition rate. LpCbDR3 The relative conductivity (EL) is significantly reduced, which indicates that the transgenic plant has a low ion permeability of leaf cell membrane and a low damage degree of cell membrane compared with the control group, and the harm of salt stress to the plant is alleviated. LpCbDR3 The forage quality and salt tolerance of perennial rye grass can be improved.

Description

Technical Field

[0001] This invention relates to plant genetic engineering technology, specifically to the application of gene LpCbDR3 in improving salt tolerance and forage quality in ryegrass. Background Technology

[0002] Under the environment of continuously aggravated global soil salinization, excessive accumulation of sodium ions in the soil leads to salt damage. Saline-alkali land is widely distributed in North China, Northwest China, and coastal areas of my country. Not only do arid and semi-arid regions face the combined stress of salt and drought year-round, but most semi-humid and humid regions also frequently experience seasonal and regional salt stress problems due to high irrigation water salinity and secondary salinization of facility soils. High-salt soil environments severely affect plant growth and development, and in severe cases, can lead to significant yield reductions or even crop failures, causing great harm to forage cultivation, grassland ecological restoration, and turf establishment. Under salt stress conditions, even in areas with irrigation facilities, forage often suffers salt damage due to excessively salty irrigation water or untimely leaching. Salt damage ranks first among abiotic threats to forage, exceeding losses caused by biotic stresses such as pests and diseases. The stunted plant growth, premature leaf senescence, decreased quality, and reduced yield caused by salt stress are as severe as the sum of most other natural stresses.

[0003] Perennial ryegrass is the most widely cultivated perennial grass forage and turfgrass in temperate regions. It boasts outstanding advantages such as excellent forage quality, long growing season, high yield, tolerance to grazing, strong regeneration, and good palatability. Furthermore, its rapid establishment, excellent texture, and resistance to trampling make it widely used in golf courses, sports fields, parks, and urban greening lawns, holding a core position in grassland agriculture and green space systems in Europe and America. However, due to its shallow root system and relatively weak cell wall water retention and ion separation capabilities, under salt stress, the plant's water and ion balance is disrupted, leading to a large accumulation of reactive oxygen species, damage to cell membrane integrity, and rapid chlorophyll degradation. This results in inhibited plant growth, accelerated leaf yellowing and senescence, significantly reducing the survival rate, biomass accumulation, and forage and turfgrass value.

[0004] Ethylene response factors (ERFs): The AP2 / ERF family is a plant-specific transcription factor superfamily. Members of the ERF subfamily contain only one conserved AP2 / ERF domain and are primarily involved in ethylene signaling, stress response, and growth and development regulation. ERF transcription factors can activate or inhibit target gene transcription by binding to cis-acting elements such as the GCC-box, DRE / CRT, and CCGAC in the promoter regions of downstream genes, playing diverse regulatory functions in processes such as drought, salt, low temperature, disease, and leaf senescence. Previous studies have shown that some ERF genes participate in plant salt stress responses, altering salt tolerance through the regulation of ion transport, antioxidant systems, and osmotic substance synthesis; other ERF members participate in leaf senescence regulation, altering leaf greening period by affecting chlorophyll metabolism, reactive oxygen species homeostasis, or the expression of senescence-related genes. For example, Arabidopsis thaliana AtERF4 and AtERF8 can accelerate leaf senescence, rice OsERF922 negatively regulates salt tolerance, and wheat TaERF1 participates in salt stress response. However, these genes do not simultaneously regulate salt stress, chlorophyll degradation, leaf senescence, and forage quality, and no genes directly targeting chlorophyll degradation have been found to perform dual regulatory functions.

[0005] Although ERF family genes have been widely reported in model plants and crops, their functions exhibit high species specificity and functional differentiation. Members of the same subfamily can perform completely opposite physiological functions in different plants. Even within the same ERF family, some positively regulate salt tolerance, while others negatively regulate it; some promote senescence, while others delay it. Family classification alone cannot predict their specific targets, regulatory pathways, and physiological phenotypes. Currently, no ERF gene in perennial ryegrass has been confirmed to simultaneously possess a series of linked functions: negatively regulating salt tolerance, positively regulating leaf senescence, directly activating chlorophyll degradation genes, reshaping reactive oxygen species homeostasis, and synergistically improving forage quality. Furthermore, a complete regulatory module of "ethylene signaling—transcription factor—chlorophyll degradation—salt stress resistance—leaf senescence—forage quality" has not been established. Existing research largely focuses on the stress resistance or senescence functions of single ERF genes, lacking core regulatory genes that can simultaneously enhance salt tolerance, delay senescence, and improve quality. Most reported salt tolerance genes do not affect leaf senescence and chlorophyll metabolism, while senescence regulatory genes are largely unrelated to salt stress response, making it difficult to synergistically improve the stress resistance, greenness retention, and quality traits of perennial ryegrass. Therefore, identifying key ERF transcription factors that simultaneously regulate salt stress resistance, leaf senescence process, chlorophyll metabolism, and reactive oxygen species homeostasis, and elucidating their molecular mechanisms, is of significant theoretical and applied value for overcoming the molecular breeding bottleneck of salt-tolerant and anti-senescence traits in perennial ryegrass and for cultivating high-quality, salt-tolerant, and green-retaining varieties. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide the application of gene LpCbDR3 in improving the salt tolerance and forage quality of perennial ryegrass.

[0007] This invention can be achieved through the following technical solutions:

[0008] In a first aspect, the present invention protects the substance that inhibits / reduces / silences the expression level of the LpCbDR3 gene in any one or more of the following applications:

[0009] (1) Application in improving the quality of ryegrass forage;

[0010] (2) Application in the preparation of products that improve the quality of ryegrass forage;

[0011] (3) Application in cultivating high-quality ryegrass;

[0012] (4) Application in improving the salt tolerance of ryegrass;

[0013] (5) Application in the preparation of products that improve the salt tolerance of ryegrass;

[0014] (6) Application in cultivating highly salt-tolerant ryegrass;

[0015] The nucleotide sequence of the gene LpCbDR3 is shown in SEQ ID NO.1.

[0016] In a specific implementation scheme, the substance that inhibits / reduces / silences the expression level of the LpCbDR3 gene is any one of the following:

[0017] (A1) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.2;

[0018] (A2) An expression cassette containing the DNA molecule described in (A1);

[0019] (A3) A recombinant vector containing the DNA molecule described in (A1) or a recombinant vector containing the expression cassette described in (A2);

[0020] (A4) A recombinant microorganism containing the DNA molecule described in (A1), or a recombinant microorganism containing the expression cassette described in (A2), or a recombinant microorganism containing the recombinant vector described in (A3).

[0021] In the specific implementation plan, improving the quality of ryegrass forage means that the crude protein and fat content of ryegrass is significantly increased, while the content of ADF, NDF and Ash is significantly reduced.

[0022] Secondly, the present invention protects a method for improving the quality of ryegrass forage, the method being achieved by inhibiting / reducing / silencing the expression level of the gene LpCbDR3 in the target ryegrass, the nucleotide sequence of the gene LpCbDR3 being shown in SEQ ID NO.1.

[0023] Thirdly, the present invention protects a method for improving the salt tolerance of ryegrass, the method being achieved by inhibiting / reducing / silencing the expression level of the gene LpCbDR3 in the target ryegrass, the nucleotide sequence of the gene LpCbDR3 being shown in SEQ ID NO.1.

[0024] Fourthly, the present invention protects a method for cultivating high-quality ryegrass, the method being achieved by inhibiting / reducing / silencing the expression level of the gene LpCbDR3 in the target ryegrass, the nucleotide sequence of the gene LpCbDR3 being shown in SEQ ID NO.1.

[0025] High pasture quality refers to ryegrass with relatively high crude protein content, relatively high fat content, and relatively low ADF, NDF, and Ash content.

[0026] Fifthly, the present invention protects a method for cultivating highly salt-tolerant ryegrass, the method being achieved by reducing the expression level of the inhibitory / depressed / silenced gene LpCbDR3 in the target ryegrass, the nucleotide sequence of the gene LpCbDR3 being shown in SEQ ID NO.1.

[0027] Sixthly, the present invention provides a substance that protects against / reduces / silences the expression level of the gene LpCbDR3, said substance being any one of the following:

[0028] (A1) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.2;

[0029] (A2) An expression cassette containing the DNA molecule described in (A1);

[0030] (A3) A recombinant vector containing the DNA molecule described in (A1) or a recombinant vector containing the expression cassette described in (A2);

[0031] (A4) A recombinant microorganism containing the DNA molecule described in (A1), or a recombinant microorganism containing the expression cassette described in (A2), or a recombinant microorganism containing the recombinant vector described in (A3).

[0032] Seventhly, this invention protects a ryegrass RNAi interference plant with the LpCbDR3 gene, which is prepared by the following method, specifically including the following steps:

[0033] (1) The RNAi gene fragment of LpCbDR3 was ligated into a vector and then transformed into Agrobacterium tumefaciens;

[0034] (2) Agrobacterium tumefaciens containing the LpCbDR3 RNAi gene fragment was used to infect the callus of ryegrass, and after co-culture, the callus was screened to obtain resistant callus.

[0035] (3) The resistant callus tissue was subjected to plant regeneration culture to obtain ryegrass RNAi interference plants with gene LpCbDR3.

[0036] In a specific implementation, the nucleotide sequence of the LpCbDR3 RNAi gene fragment is shown in SEQ ID NO:2.

[0037] In a specific implementation scheme, the vector includes the pVT1629 vector.

[0038] More specifically, the present invention provides a method for transforming Agrobacterium tumefaciens into a vector after ligating an example LpCbDR3 RNAi gene fragment:

[0039] (1) The RNAi gene fragment of LpCbDR3 was ligated to pGMentryL1-kanni by enzyme digestion and ligation, then linearized into a vector, recovered from gel, and ligated into pVT1629 vector by LR recombination.

[0040] (2) Mix the ligation product with Agrobacterium tumefaciens, place on ice for 2-8 min, in liquid nitrogen for 2-8 min, at 30-45℃ for 2-8 min, on ice for 2-8 min, add liquid culture medium, revive at 20-39℃, spread on the culture medium, and place in the dark at 20-39℃.

[0041] Beneficial Effects: Compared with existing technologies, this invention has the following advantages: Under salt stress conditions, the chlorophyll content of transgenic RNAi-LpCbDR3 ryegrass was significantly increased, while the relative conductivity and MDA content were significantly decreased compared to the control group. This indicates that chlorophyll degrades under salt stress conditions, and the transgenic plants can reduce the rate of chlorophyll decomposition. The transgenic plants exhibited lower cell membrane ion permeability and less cell membrane damage than the control group. This demonstrates that transgenic RNAi-LpCbDR3 ryegrass not only delays senescence but also improves forage quality, exhibiting higher salt tolerance than the control group. Interfering with LpCbDR3 transcription can enhance the forage quality and salt tolerance of ryegrass. Attached Figure Description

[0042] Figure 1 LpCbDR3 positively regulates leaf senescence; inhibiting its expression yields an ethylene-insensitive green-holding phenotype and improves forage quality.

[0043] Figure 1 A, Figure 1 D is a diagram of the natural aging experiment of ryegrass plants. Figure 1 B, Figure 1 C represents the chlorophyll content and relative electrical conductivity of different leaf positions in wild-type ryegrass before and after ethanol-induced LpCbDR3 overexpression. Figure 1 E, Figure 1 F represents the chlorophyll content and relative electrical conductivity at different leaf positions in wild-type ryegrass and RNAi-LpCbDR3 transgenic lines. Figure 1 GK is a forage quality indicator (crude protein content, fat content, ADF content, NDF content, and Ash content) for RNAi-LpCbDR3 transgenic lines.

[0044] Figure 2 This is a diagram of a salt stress experiment on ryegrass plants. Among them, Figure 2 A, Figure 2 E represents ryegrass plants before and after salt stress treatment (control and two overexpressing transgenic lines, control and three RNAi interference lines). Figure 2 BD, Figure 2 The FG diagram shows the chlorophyll content, relative conductivity, and MDA content of wild-type ryegrass and genetically modified ryegrass before and after salt treatment. Detailed Implementation

[0045] The technical solution of the present invention will be further explained and described below with reference to specific embodiments and accompanying drawings. Reagents or instruments used without a specified manufacturer are considered to be conventional products that can be purchased on the market.

[0046] The present invention provides a ryegrass salt tolerance gene LpCbDR3, and the gene sequence of LpCbDR3 (SEQ ID NO.1): ATGACCACGCTCCAACGAGCAGCAGCTTGCCACCAGCTCCCGACCGCTCAACTCCACTCGCCGGGCTCCTCCACCAGCTCGGCCGACTCCGCGCCGTGGCACCGTGCCCCGGCCACACCGCCGCTGCTCCCGTTCGACACCAACGACGCGGACGAGATGCTCCTGCTCGACTTGCTCTCCCACTCCCAGAACGCCCCCGTGCAGGCTCCCAAGACGGAGACGCCAATGAAACAAGATGCAGACGAGGGGCACAACGGCGGCTGTGGGCGTGCGTTCCGCGGGGTGCGGAAGCGGCCGTGGGGCAAGTTCGCTGCGGAGATCCGTGACTCGACGCGGAACGGCGTCCGGGTGTGGCTGGGCACCTTCGACAGCCCGGAGGCGGCGGCGCTGGCGTACGATCAGGCCGCCTTCGCGATGCGGGGTGGCGCCGCCGTGCTCAACTTCCCAGCGGAGCATGTCCGGCGGTCGCTGGACGGCGCCGGTGACGATGTGTGCGGGCGCGCCGACGGGGTGTCGCCCGTTCTGGCGCTCAAGCGACGACATTCTATGCATCGGAGGCGGCCGCTTGCGGCGAACCGGAAGCCAAAGGTCGCCCGGCGGCCGGAGTGCGTGATGGAGCTGGAGGACCTCGGCGCAGATTACCTGGAGGAGCTGCTCGGCGCCTATCAGGATGACACAACCTCCGCCGCCTCCATTTCATGGTGCTGGAGCCACCACTCCGCC

[0047] Example 1 Construction of overexpression vector

[0048] RNA was extracted from wild-type ryegrass lines and reverse transcribed into cDNA. The cDNA was then used as a template for PCR amplification (using the forward primer sequence: CGGAATTCATGACCACGCTCCAACGAGC, and the reverse primer sequence: GGACTAGTGGCGGAGTGGTGGCTCC) to obtain the LpCbDR3 gene fragment. This fragment was ligated to pEnD-linker via enzyme digestion and ligation (6 μL gene fragment, 2 μL digested vector, 1 μL T4 ligase, 1 μL buffer, total volume 10 μL, incubated at 16℃ for 1 h). The vector was then linearized, and after gel recovery, ligated to the pVT1629 vector (Xu B, Escamilla-Trevino LL, Sathitsuksanoh N, et al. Silencing of 4-coumarate:coenzyme A ligase in switchgrass leads to reduced lignin content and improved fermentable sugar yields for biofuel) via LR recombination (0.5 μL enzyme, 1 μL vector, 2.5 μL linearized vector). production[J]. New Phytol,2011,192(3):611-625.). The ligation product was added to 100 μL of Agrobacterium tumefaciens EHA105 (purchased from Qingke), placed on ice for 5 min, in liquid nitrogen for 5 min, at 37℃ for 5 min, on ice for 5 min, then added to 500 μL of liquid LB, and after recovery at 28℃ for 1 h, it was plated on LB (K+Rif) and incubated in the dark at 28℃ for 2 days. Single clones were selected for bacterial PCR identification.

[0049] Example 2: Construction of RNAi Vector

[0050] RNA was extracted from wild-type ryegrass lines and reverse transcribed into cDNA. The cDNA was then used as a template for PCR amplification (using the forward primer sequence: GCTTAGAGTCGACAACGAGCAGCAGCTTGC, and the reverse primer sequence: CCCAAGCTTGAATTCATCTTGTTTCATTGGCGTCTCCG). The RNAi fragment (SEQ ID NO. 2) was designed as follows:

[0051] The RNAi gene fragment of LpCbDR3 was obtained by digesting and ligating it into pGMentryL1-kanni. The fragment was then linearized into a vector, recovered from the gel, and ligated into the pVT1629 vector via LR recombination (0.5 μL enzyme, 1 μL vector, 2.5 μL linearized vector). The ligation product was added to 100 μL of Agrobacterium tumefaciens EHA105 (purchased from Qingke), placed on ice for 5 min, in liquid nitrogen for 5 min, at 37℃ for 5 min, on ice for 5 min, then added to 500 μL of liquid LB, and after recovery at 28℃ for 1 h, it was plated onto LB (K+Rif) and incubated in the dark at 28℃ for 2 days. Single clones were selected for bacterial culture PCR identification.

[0052] Example 3

[0053] After cutting ryegrass seeds, they were placed on induction medium (N6 medium + 1 g / L hydrolyzed casein + 1 g / L Proline + 30 g / L maltose + 8.0 g / L agar + 7.0 mg / L 2,4-D + 0.05 mg / L BA; pH: 5.8 to 5.9). After one month, the callus was transferred to subculture plates (N6 medium + 1 g / L hydrolyzed casein + 1 g / L Proline + 30 g / L maltose + 8.0 g / L agar + 5.0 mg / L 2,4-D + 0.1 mg / L BA; pH: 5.8 to 5.9), and subcultured once a month. After three months, Agrobacterium tumefaciens containing the LpCbDR3 gene and LpCbDR3-RNAi were used to infect the callus tissue of perennial ryegrass, respectively. After three days of co-culturing, the tissue was screened using a selection plate containing antibiotics. The culture medium was changed every 14 days. After two months, the callus that was not killed by Agrobacterium was transferred to the differentiation plate. The sprouting callus was then cultured for plant regeneration to obtain transgenic plants that were overexpressed and interfered with by RNAi.

[0054] Example 4

[0055] After emergence, the leaves were stained with GUS staining solution. If the leaves stained blue, the plant was identified as a transgenic positive seedling. Positive plants were further confirmed by PCR using extracted gDNA from the leaves. RNA was extracted from the leaves and RT-qPCR was performed to determine whether there were significant changes in gene expression levels among different transgenic plant lines. The gene expression levels of overexpressing plants were higher than those of the wild-type control, while the expression levels of RNAi interference plants were lower than those of the wild-type control. The OE-LpCbDR3#1,2 (overexpressing plant lines) and RNAi-LpCbDR3#1,2,4 (RNAi interference plant lines) lines were selected for the following experiments.

[0056] Example 5

[0057] Transgenic seedlings were planted in clusters of three tillers each. Two overexpression lines and the wild-type were planted in one pot, and two RNA interference lines and the wild-type were planted in another pot. Each pot contained six biological replicates. Pruning was done weekly. When growth was uniform, three pots were randomly selected for salt stress treatment (50, 100, 200, 300, 400, and 500 mM sodium chloride were added on days 3, 7, 10, 14, 17, and 21, respectively). Indicators were measured after 35 days.

[0058] (1) Chlorophyll: Chlorophyll content was extracted by dimethyl sulfoxide (DMSO) soaking method. 0.1g of leaf was cut and soaked in 5 ml of DMSO. It was placed in the dark at room temperature for 3 days (to ensure that the green color of the leaf completely faded). The absorbance values ​​at wavelengths of 663 nm and 645 nm were measured by spectrophotometer. Each treatment was repeated 4 times.

[0059] (2) Relative conductivity: 0.1 g of leaves from each strain were weighed, wrapped in absorbent paper, and immersed in a 50 ml centrifuge tube containing 30 ml of deionized water. After shaking at 28°C for 24 h, the value was measured using a conductivity meter and named C0. The centrifuge tubes were then sterilized in an autoclave at 121°C for 20 min. After cooling, they were placed in a shaker at 28°C for 24 h and the value was measured using a conductivity meter and named C1. The conductivity was calculated using the following formula: EL (%) = C0 / C1 * 100%

[0060] The results are as follows:

[0061] like Figure 1 As shown in Figure A, after exogenous ethanol spraying induced LpCbDR3 overexpression, the transgenic seedlings had only two and a half green leaves, while the wild-type had three and a half. The chlorophyll content of the fourth leaf of the overexpressing transgenic seedlings was significantly lower than that of the wild-type, while the relative electrical conductivity was significantly higher. Figure 1 B, Figure 1C). This indicates that overexpression of LpCbDR3 accelerates leaf senescence in ryegrass and exacerbates leaf membrane damage. In contrast, the RNAi transgenic lines have up to five green leaves, with the fifth leaf exhibiting significantly higher chlorophyll content and significantly lower relative electrical conductivity than the wild type. This suggests that RNAi interference with LpCbDR3 expression delays chlorophyll degradation in ryegrass, reduces leaf membrane damage, and maintains the green color of the ryegrass. Figure 1 E, Figure 1 F). Simultaneously, after RNAi interference with LpCbDR3 expression, the crude protein and fat content of ryegrass was significantly higher than that of the wild type, while ADF, NDF, and Ash were significantly lower than those of the wild type (e.g., ...). Figure 1 (GK) indicates that the RNAi transgenic lines have superior forage quality.

[0062] like Figure 2 As shown in Figure A, under salt stress, the wild-type ryegrass grew better than the two transgenic lines OE-1 and OE-2. Under salt stress, the wild-type ryegrass grew worse than the transgenic lines RNAi-1, 2, and RNAi-4. Figure 1 E). Chlorophyll content and relative conductivity of overexpressing plants and RNAi plants, as shown in... Figure 2 BD, Figure 2 As shown in Figure FG, under salt stress, the overexpression lines had lower chlorophyll content than the wild type, but higher relative conductivity and MDA content, indicating that salt stress caused greater damage to the overexpression transgenic lines. The overexpression lines were more sensitive to salt stress, exhibited greater cell membrane damage, and experienced faster chlorophyll degradation. In contrast, the RNAi transgenic lines had higher chlorophyll content than the wild type, but lower relative conductivity and MDA content, indicating that they were less affected by salt stress, experienced less cell membrane damage than the control, and had a relatively slower chlorophyll degradation rate.

[0063] The scope of protection of this invention is not limited to the above embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.

Claims

1. Suppress / reduce / silence genes LpCbDR3 The expression level of the substance is used in any one or more of the following applications: (1) Application in improving the quality of ryegrass forage; (2) Application in the preparation of products that improve the quality of ryegrass forage; (3) Application in cultivating high-quality ryegrass; (4) Application in improving the salt tolerance of ryegrass; (5) Application in the preparation of products that improve the salt tolerance of ryegrass; (6) Application in cultivating highly salt-tolerant ryegrass; The gene LpCbDR3 The nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The suppressed / reduced / silenced genes LpCbDR3 The substance expressed in any of the following ways: (A1) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.2; (A2) An expression cassette containing the DNA molecule described in (A1); (A3) A recombinant vector containing the DNA molecule described in (A1) or a recombinant vector containing the expression cassette described in (A2); (A4) A recombinant microorganism containing the DNA molecule described in (A1), or a recombinant microorganism containing the expression cassette described in (A2), or a recombinant microorganism containing the recombinant vector described in (A3).

3. A method for improving the quality of ryegrass forage, characterized in that, The method works by inhibiting / reducing / silencing genes in ryegrass. LpCbDR3 The expression level of the gene is used to achieve this. LpCbDR3 The nucleotide sequence is shown in SEQ ID NO.

1.

4. A method for improving the salt tolerance of ryegrass, characterized in that, The method works by inhibiting / reducing / silencing genes in ryegrass. LpCbDR3 The expression level of the gene is used to achieve this. LpCbDR3 The nucleotide sequence is shown in SEQ ID NO.

1.

5. A method for cultivating high-quality ryegrass, characterized in that, The method involves inhibiting / reducing / silencing genes in the target ryegrass. LpCbDR3 The expression level of the gene is used to achieve this. LpCbDR3 The nucleotide sequence is shown in SEQ ID NO.

1.

6. A method for cultivating highly salt-tolerant ryegrass, characterized in that, The method involves inhibiting / reducing / silencing genes in the target ryegrass. LpCbDR3 The expression level of the gene is used to achieve this. LpCbDR3 The nucleotide sequence is shown in SEQ ID NO.

1.

7. Suppress / reduce / silence genes LpCbDR3 The substance expressing a certain amount is characterized by, The substance is any one of the following: (A1) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.2; (A2) An expression cassette containing the DNA molecule described in (A1); (A3) A recombinant vector containing the DNA molecule described in (A1) or a recombinant vector containing the expression cassette described in (A2); (A4) A recombinant microorganism containing the DNA molecule described in (A1), or a recombinant microorganism containing the expression cassette described in (A2), or a recombinant microorganism containing the recombinant vector described in (A3).

8. A gene LpCbDR3 Ryegrass RNAi interference plants, characterized by, It is prepared by the following method, specifically including the following steps: (1) LpCbDR3 The RNAi gene fragment was ligated into a vector and then transformed into Agrobacterium tumefaciens; (2) Using the above-mentioned LpCbDR3 Agrobacterium tumefaciens, containing RNAi gene fragments, was used to infect ryegrass callus tissue. After co-culture, the callus tissue was screened to obtain resistant callus tissue. (3) The resistant callus tissue was subjected to plant regeneration culture to obtain the gene. LpCbDR3 RNAi interference in ryegrass plants.

9. The gene according to claim 8 LpCbDR3 Ryegrass RNAi interference plants, characterized by, The LpCbDR3 The nucleotide sequence of the RNAi gene fragment is shown in SEQ ID NO.

2.

10. The gene according to claim 8 or 9 LpCbDR3 Ryegrass RNAi interference plants, characterized by, The carrier includes the pVT1629 carrier.

Images