Use of tRF-GlyGCC expression modulators in the preparation of diagnostic products for muscle atrophy

Abstract

The application discloses an application of a tRF-GlyGCC expression regulator in preparation of a muscle atrophy diagnosis product, and relates to the technical field of biological detection.The application specifically discloses the application of the tRF-GlyGCC expression regulator in preparation of the muscle atrophy diagnosis product, wherein the sequence of the tRF-GlyGCC is shown as SEQ ID NO.1.The tRF-GlyGCC expression regulator is a tRF-GlyGCC expression promoter or a tRF-GlyGCC expression inhibitor; the sequence of the tRF-GlyGCC expression promoter is shown as SEQ ID NO.2, and the sequence of the tRF-GlyGCC expression inhibitor is shown as SEQ ID NO.3.The application applies the tRF-GlyGCC expression regulator to the diagnosis of the muscle atrophy, so as to solve the problem that the existing muscle atrophy diagnosis lacks related diagnosis markers and targets.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, specifically to the application of a tRF-GlyGCC expression regulator in the preparation of diagnostic products for muscle atrophy. Background Technology

[0002] Skeletal muscle is one of the most important locomotion and metabolic tissues in animals, playing a crucial role in maintaining bodily functions, energy metabolism, and overall health. Normal development and homeostasis of skeletal muscle are essential for livestock production performance and animal health. However, under various physiological or pathological conditions such as aging, prolonged exposure to glucocorticoids, chronic diseases, and nutritional imbalances, skeletal muscle is prone to atrophy, manifesting as characteristic changes such as decreased muscle mass, thinning of muscle fibers, and weakened muscle strength. Skeletal muscle atrophy not only severely affects animal production performance and meat quality but also increases disease risk and reduces economic benefits. From a molecular perspective, skeletal muscle atrophy is closely related to an imbalance between protein synthesis and degradation, with the ubiquitin-proteasome system playing a central role in muscle protein degradation. E3 ubiquitin ligases such as MuRF-1 and Atrogin-1 are considered important regulators promoting myofibrillar protein degradation. Furthermore, factors such as impaired myogenic differentiation, mitochondrial dysfunction, and oxidative stress also contribute to the development and progression of skeletal muscle atrophy.

[0003] In recent years, the role of non-coding RNAs in skeletal muscle development and atrophy has gradually attracted attention. Among them, tRNA-derived small RNAs (tsRNAs) are a novel class of non-coding small RNAs produced by the cleavage of mature or precursor tRNAs. Initially considered byproducts of tRNA degradation, increasing research has shown that tsRNAs play important regulatory roles in cellular stress responses, metabolic regulation, cell differentiation, and disease development. tsRNAs can regulate target gene expression in a miRNA-like manner or exert their functions through various mechanisms, such as influencing translation initiation and protein binding. Although existing studies have revealed the important roles of tsRNAs in various physiological and pathological processes, their function and molecular mechanisms in skeletal muscle atrophy have not been clearly reported, especially regarding whether specific tsRNAs participate in the regulation of key pathways in muscle atrophy (such as the TGF-β / SMAD signaling pathway). Therefore, it is necessary to screen and identify key tsRNA molecules associated with skeletal muscle atrophy, thereby providing new molecular markers and potential targets for the diagnosis and intervention of skeletal muscle atrophy. Summary of the Invention

[0004] The purpose of this invention is to provide an application of tRF-GlyGCC expression regulator in the preparation of diagnostic products for muscle atrophy, thereby solving the problem of the lack of relevant diagnostic biomarkers and targets in existing muscular atrophy diagnostic methods.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: The first aspect concerns the application of tRF-GlyGCC expression regulators in the preparation of diagnostic products for muscle atrophy. The sequence of tRF-GlyGCC is shown in SEQ ID NO.1.

[0006] Furthermore, the tRF-GlyGCC expression regulator is either a tRF-GlyGCC expression promoter or a tRF-GlyGCC expression inhibitor; the sequence of the tRF-GlyGCC expression promoter is shown in SEQ ID NO.2, and the sequence of the tRF-GlyGCC expression inhibitor is shown in SEQ ID NO.3.

[0007] Furthermore, the diagnostic products for muscle atrophy are diagnostic reagents or diagnostic kits.

[0008] Secondly, a diagnostic product for muscle atrophy is provided, comprising the aforementioned tRF-GlyGCC expression regulator.

[0009] Furthermore, the tRF-GlyGCC expression regulator is either a tRF-GlyGCC expression promoter or a tRF-GlyGCC expression inhibitor; the sequence of the tRF-GlyGCC expression promoter is shown in SEQ ID NO.1, and the sequence of the tRF-GlyGCC expression inhibitor is shown in SEQ ID NO.2.

[0010] The present invention has the following beneficial effects: 1. This invention uses tRF-GlyGCC expression regulators to prepare diagnostic products for muscular atrophy. By using tRF-GlyGCC expression promoters or tRF-GlyGCC expression inhibitors to target skeletal muscle atrophy, this invention provides new targets for the early diagnosis and intervention of skeletal muscle atrophy in the future. Attached Figure Description

[0011] Figure 1The results show the effect of tRF-GlyGCC mimics on the proliferation of C2C12 myoblasts; Figure A shows the relative expression level of tRF-GlyGCC after transfection with tRF-GlyGCC mimics in C2C12 cells; Figure B shows the mRNA expression level of cell proliferation and apoptosis-related genes detected by real-time quantitative PCR; Figure C shows the changes in cell proliferation activity at different time points detected by CCK-8 assay; Figure D shows the results of EdU incorporation assay to detect cell DNA synthesis level and quantitative analysis. Figure 2 The results show the effects of tRF-GlyGCC mimics on C2C12 myoblast differentiation and myotube formation. Figure A shows the relative expression level of tRF-GlyGCC after transfection with tRF-GlyGCC mimics. Figure B shows the expression levels of myoblast atrophy-related genes (MURF1 and Atrogin-1), myoblast-related genes (MYOD and MYOG), and mitophagy-related genes (Parkin and PINK1) after overexpression of tRF-GlyGCC. Figure C shows the protein expression levels of myoblast atrophy-related proteins MuRF-1, Atrogin-1, and myoblast-related protein MYHC in C2C12 cells after overexpression of tRF-GlyGCC. Figure 3 To quantitatively analyze the immunofluorescence staining results and myotube diameter of C2C12 cells differentiated by tRF-GlyGCC mimicry; Figure 4 The changes in MYHC protein expression levels and the quantitative analysis results of MYHC / GAPDH at different time points after the addition of the protein synthesis inhibitor cyclohexylimide (CHX) to the tRF-GlyGCC mimicry; Figure 5 The changes and quantitative analysis results of MYHC protein expression level of tRF-GlyGCC mimic under the proteasome inhibitor MG132 treatment; Figure 6 The results show the effect of the tRF-GlyGCC inhibitor on the proliferation of C2C12 myoblasts; Figure A shows the relative expression level of tRF-GlyGCC after transfection of C2C12 cells with the tRF-GlyGCC inhibitor; Figure B shows the mRNA expression level of cell proliferation and apoptosis-related genes detected by real-time quantitative PCR; Figure C shows the changes in cell proliferation activity at different time points detected by CCK-8 assay; Figure D shows the results of EdU incorporation assay to detect cell DNA synthesis level and quantitative analysis. Figure 7The results show the effects of the tRF-GlyGCC inhibitor on the differentiation and myotube formation of C2C12 myoblasts. Figure A shows the relative expression level of tRF-GlyGCC after transfection with the tRF-GlyGCC inhibitor in C2C12 myoblasts. Figure B shows the expression levels of myoblast atrophy-related genes (MURF1 and Atrogin-1), myoblast-related genes (MYOD and MYOG), and mitophagy-related genes (Parkin and PINK1) after tRF-GlyGCC expression inhibition. Figure C shows the protein expression levels of myoblast atrophy-related proteins MuRF-1, Atrogin-1, and myoblast-related protein MYHC in C2C12 cells after tRF-GlyGCC inhibition. Figure 8 The results of quantitative analysis of the differentiation of C2C12 cells into myotubes and the diameter of myotubes were obtained by tRF-GlyGCC inhibitor. Figure 9 The changes in MYHC protein expression levels and the quantitative analysis results of MYHC / GAPDH at different time points under the condition of adding the protein synthesis inhibitor cyclohexylimide (CHX) to the tRF-GlyGCC inhibitor; Figure 10 The changes and quantitative analysis results of MYHC protein expression level under the treatment of proteasome inhibitor MG132 with tRF-GlyGCC inhibitor; Figure 11 The results show the effects of tRF-GlyGCC mimic (Agomir-GlyGCC) on skeletal muscle growth and development in C57BL / 6 mice. Figure A is a schematic diagram of the experimental procedure for Agomir-GlyGCC treatment or control. Figure B shows the changes in body weight of mice in the Agomir-NC group and the Agomir-GlyGCC group over time during the treatment period. Figure C shows representative appearance images of the tibialis anterior (TA), soleus (Sol), and gastrocnemius (GAS) muscles of mice. Figure D shows the motor performance of mice in different treatment groups as assessed by motor ability tests and grip strength tests. Figure E shows the WGA staining results of cross-sectional morphology of skeletal muscle in mice in different treatment groups. Figure 12 The changes in respiratory exchange rate (RER) in mice under different treatment groups; Figure 13 Serum glucose and creatinine levels in mice from different treatment groups; Figure 14 A model diagram illustrating how tRF-GlyGCC promotes skeletal muscle atrophy. Detailed Implementation

[0012] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0013] Example 1:

[0014] The effects of tRF-GlyGCC and related reagents on the regulation of myoblast proliferation, myoblast differentiation, and myotube formation were investigated. The specific experimental methods are as follows: 1. Test Methods 1.1 Construction of C2C12 myoblast culture and differentiation model Mouse myoblast cell line C2C12 was purchased from the Cell Resource Bank of the Chinese Academy of Sciences (Cat. No. GNM26) and cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, incubated at 37 ℃ in a 5% CO2 incubator. When the cell confluence reached approximately 80%-90%, the medium was replaced with differentiation medium (DMEM + 2% horse serum) to induce cell differentiation into myotubes. The differentiation medium was changed every 2 days, and mature myotubes formed in approximately 5-6 days. In some experiments, an in vitro myotube atrophy model could be established by treating the cells with 50 μM dexamethasone (DEX) for 48 h.

[0015] 1.2 Cell transfection and treatment tRF-GlyGCC mimics (mimics-GlyGCC, tRF-GlyGCC expression promoter), inhibitors (inhibitor-GlyGCC, tRF-GlyGCC expression inhibitor), and their corresponding negative controls were transfected into C2C12 cells at a final concentration of 50 nM. Transfection was performed using liposome transfection reagent (Invitrogen, Carlsbad, CA) according to the reagent instructions. Cells were used for subsequent experiments 24-48 h after transfection. Based on the tRF-GlyGCC sequence (UGGGUGGUUCAGUGGUAGAAUUCUCGC, as shown in SEQ ID NO.1), this invention designed corresponding RNA oligonucleotides; in creating the sequence listing SEQ ID NO.1, U was replaced with T, resulting in the sequence TGGGTGGTTCAGTGGTAGAATTCTCGC; this was only for creating a compliant sequence listing, and the actual sequence is as described above. The constructed RNA oligonucleotide and overexpression plasmid sequences are shown in Table 1.

[0016] Table 1. tRF-GlyGCC related construct sequence 1.3 RNA extraction, cDNA synthesis, and quantitative real-time quantitative PCR (qPCR) After cell transfection, cells were lysed using TRIzol reagent (Takara Bio, China) to extract total RNA. The RNA was then separated, precipitated, and purified according to the reagent instructions. Subsequently, a certain amount of RNA was used to synthesize mRNA and tsRNA using a PrimeScript RT kit and a one-step miRNA synthesis kit, followed by reverse transcription to synthesize cDNA (Takara Bio, China). Next, real-time quantitative PCR (qPCR) was performed using the SYBR Green assay (Novozymes, China). β-actin was used as the internal reference gene for mRNA, and U6 was used as the internal reference gene for miRNA. 2... -ΔΔCt The relative expression level was calculated using a method. The primer sequences used are shown in Table 2.

[0017] Table 2 Primer sequences for qRT-PCR detection 1.4 Western blot Forty-eight hours after transfection or treatment, total protein was extracted from C2C12 myoblasts or mouse skeletal muscle tissue using a tissue or cell total protein extraction kit (Beyotime, Shanghai, China). The total protein concentration was determined using a quinolinic acid (BCA) protein quantification kit (Beyotime, Shanghai, China). β-Tubulin was used as an internal control protein in this experiment. Equal volumes of protein samples were separated by 4-20% SDS-polyacrylamide gradient gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). The PVDF membrane was blocked at room temperature for 2 hours in blocking buffer containing 5% skim milk powder, followed by incubation at 4 °C for 12 hours with primary antibody diluted according to the recommended antibody ratio (as shown in Table 3). The membrane was then washed three times with TBST buffer for 5 minutes each time, and then incubated with the corresponding HRP-labeled secondary antibody at room temperature or 4 °C for 1 hour. After washing, ECL chemiluminescence reagent (Sheng'er Company, Shanghai, China) was added for development. Protein band images were acquired using a gel imaging system (Eblot, Shanghai, China), and the gray values ​​of the bands were analyzed using ImageJ software (National Institutes of Health, USA).

[0018] Table 3 Antibody-related information table 1.5 Immunofluorescence staining C2C12 cells were seeded in culture plates containing glass slides and fixed with 4% paraformaldehyde (Beyotime, Shanghai, China) for 10 min. After permeabilization with 0.25% Triton X-100 (Solarbio, Beijing, China), cells were blocked with 10% goat serum for 1 h. Primary antibody (anti-MYH7) was added and incubated overnight at 4 °C, followed by incubation with fluorescently labeled secondary antibody (Immunoway, Suzhou, China) at room temperature for 1 h. Cell nuclei were stained with DAPI (Beyotime, Shanghai, China), and observed and photographed using a confocal microscope. Fluorescence intensity and myotube diameter were analyzed using ImageJ.

[0019] 1.6. Functional verification in animals Eight-week-old male C57BL / 6 mice were selected and housed under SPF conditions. After one week of acclimatization, they were used in the experiment. Mice were randomly divided into the Agomir-NC group and the Agomir-GlyGCC group (tRF-GlyGCC mimicry for in vivo injection). Chemically modified tRF-GlyGCC Agomir and its negative control (Germal Biotech, Jiangsu, China) were used for treatment at the prescribed dosage. Agomir-GlyGCC or the control oligonucleotide was administered via intraperitoneal injection and local intramuscular injection in the leg, once daily for 14 consecutive days. Changes in mouse body weight were recorded during treatment. After treatment, mice were sacrificed, and the tibialis anterior (TA), gastrocnemius (GAS), and soleus (Sol) muscles were isolated. Muscle appearance was observed and weighed. WGA staining was used to observe changes in muscle fiber cross-sectional area. Exercise endurance was assessed using a treadmill test. Forelimb and limb grip strength were measured using a grip strength meter. Respiratory exchange rate (RER) was measured using a metabolic cage. Serum glucose and creatinine levels were also measured. The effects of tRF-GlyGCC overexpression on skeletal muscle growth, development, and function in mice were comprehensively evaluated using the above indicators.

[0020] 1.7 Statistical Analysis All results are expressed as mean ± standard deviation (SD). Data analysis was performed using GraphPad Prism 8.0.2 software (California, USA). Each experiment was performed in triplicate (n=3) unless explicitly labeled in the text. A p-value < 0.05 was considered significant (*P < 0.0, **P < 0.01, ***P < 0.001, ****P < 0.0001).

[0021] 2. Results Analysis 2.1 Overexpression of tRF-GlyGCC promotes myotube atrophy The role of tRF-GlyGCC in myoblasts: An overexpression model of tRF-GlyGCC mimics (mimics-GlyGCC) was constructed, and its transfection efficiency was verified by qPCR. Figure 1 A, Figure 2 A). First, changes related to cell proliferation were detected. qPCR results showed that overexpression of tRF-GlyGCC altered the expression of cell cycle and proliferation-related genes (such as PCNA, CCNE1, KI67, and CCND1), while the expression levels of apoptosis-related genes such as BAX, FAS, and Caspase-9 also changed. Figure 1 B). CCK-8 assay results showed that, compared with the control group, tRF-GlyGCC overexpression significantly affected the proliferation activity of C2C12 cells at different time points (B). Figure 1 C). EdU incorporation assay results showed that the proportion of EdU-positive cells changed in the tRF-GlyGCC overexpression group (C). Figure 1 D). The above results indicate that tRF-GlyGCC overexpression can affect the proliferative capacity of myoblasts.

[0022] Further analysis was conducted on the processes of myoblast differentiation and myotube formation. qPCR results showed that overexpression of tRF-GlyGCC upregulated the expression levels of atrophy-related genes MuRF1 and Atrogin-1, while decreasing the expression levels of myoblast differentiation-related genes MYOD and MYOG. Figure 2 B). Western blot analysis showed that tRF-GlyGCC overexpression significantly increased MuRF1 and Atrogin-1 protein expression, while decreasing MYHC protein expression levels. Figure 2 C). Immunofluorescence staining results showed that, compared with the control group, the myotube structure was thinner and the myotube diameter was significantly reduced in the tRF-GlyGCC overexpression treatment group. Figure 3 Furthermore, the degradation rate of MYHC protein was accelerated under the condition of adding the protein synthesis inhibitor CHX; and the expression level of MYHC protein changed under the condition of treatment with the proteasome inhibitor MG132. Figure 4 and Figure 5 The results suggest that tRF-GlyGCC may be involved in the regulation of muscle protein degradation. These results indicate that tRF-GlyGCC overexpression can promote myoblast myotube atrophy.

[0023] 2.2 tRF-GlyGCC knockdown promotes myotube formation Its expression was interfered with by the tRF-GlyGCC inhibitor (inhibitor-GlyGCC), and the interference efficiency was verified by qPCR. Figure 6 A, Figure 7A). First, changes related to cell proliferation were detected. qPCR results showed that inhibiting tRF-GlyGCC expression altered the expression of cell cycle and proliferation-related genes (such as PCNA, CCNE1, KI67, and CCND1), while the expression levels of apoptosis-related genes such as BAX, FAS, and Caspase-9 also changed. Figure 6 B). CCK-8 assay results showed that, compared with the control group, tRF-GlyGCC inhibition treatment affected the proliferation activity of C2C12 cells at different time points ( Figure 6 C). EdU incorporation assay results showed that the proportion of EdU-positive cells changed after inhibiting tRF-GlyGCC (C). Figure 6 (D) suggests that it plays a regulatory role in the cell proliferation process.

[0024] Further analysis was conducted on myogenic differentiation and myotube formation. qPCR results showed that inhibiting tRF-GlyGCC expression decreased the expression levels of atrophy-related genes MuRF1 and Atrogin-1, while increasing the expression levels of myogenic differentiation-related genes MYOD and MYOG. Figure 7 B). Western blot analysis showed that tRF-GlyGCC inhibition treatment reduced MuRF1 and Atrogin-1 protein expression and increased MYHC protein expression. Figure 7 C). Immunofluorescence staining results showed that, compared with the control group, the myotube structure was more intact and the myotube diameter was significantly increased in the tRF-GlyGCC inhibition treatment group. Figure 8 Furthermore, the degradation rate of MYHC protein slowed down under the addition of the protein synthesis inhibitor CHX; and the expression level of MYHC protein changed under the treatment of the proteasome inhibitor MG132. Figure 9 and Figure 10 This further supports the role of tRF-GlyGCC in the regulation of muscle protein stability. In summary, these results indicate that inhibiting tRF-GlyGCC expression can suppress myoblast myotube atrophy.

[0025] Example 2:

[0026] The effects of tRF-GlyGCC mimicry (Agomir-GlyGCC) on skeletal muscle growth and development in C57BL / 6 mice were investigated. The specific experimental methods are as follows: 1. Laboratory animals Eight-week-old male C57BL / 6 mice were used in this study and purchased from Chengdu Dashuo Experimental Animal Co., Ltd. (Dashuo, Chengdu, China). All mice were housed under specific pathogen (SPF) conditions with constant temperature and humidity, using a 12-hour light / 12-hour dark cycle, and with free access to food and water. Mice underwent a one-week acclimatization period before the experiment. After the acclimatization period, the mice were randomly divided into a control group (NC group) and a dexamethasone treatment group (DEX group). To establish a dexamethasone-induced skeletal muscle atrophy model, DEX group mice were intraperitoneally injected with dexamethasone at a dose of 25 mg / kg / day for 14 consecutive days; control group mice were intraperitoneally injected with an equal volume of physiological saline. All animal experiments in this study were approved by the Animal Protection and Ethics Committee of Sichuan Agricultural University (Approval No.: 20250368) and conducted in accordance with relevant regulations for the management of experimental animals.

[0027] 2. Construct a mouse model overexpressing tRF-GlyGCC Eight-week-old male C57BL / 6 mice were randomly divided into a control group (Agomir-NC) and a tRF-GlyGCC overexpression group (Agomir-GlyGCC) after one week of acclimatization. In vivo overexpression was performed using a chemically modified tRF-GlyGCC mimic (Agomir-GlyGCC). Specifically, Agomir-GlyGCC or the corresponding negative control was administered to mice via intraperitoneal injection combined with local injection into the gastrocnemius muscle (GAS), once daily for 14 consecutive days. Figure 11 A). Mouse body weight changes were recorded periodically during the treatment period. Results showed that, compared to the control group, body weight gain was inhibited in the Agomir-GlyGCC treatment group ( Figure 11 B), suggesting that tRF-GlyGCC overexpression may affect the body's growth.

[0028] 3. Phenotypic analysis to evaluate the effect of tRF-GlyGCC overexpression on muscle atrophy in mice. After establishing the tRF-GlyGCC overexpression model, mice were sacrificed and the tibialis anterior (TA), soleus (Sol), and gastrocnemius (GAS) muscles were isolated for histological morphology observation. Results showed that compared to the control group, the muscle volumes of the TA, Sol, and GAS muscles in the Agomir-GlyGCC treatment group were significantly reduced. Figure 11 C), indicating skeletal muscle atrophy. Further assessment of muscle function changes in mice was conducted using motor ability tests. Treadmill test results showed that the running distance of mice in the Agomir-GlyGCC treatment group was significantly reduced; grip strength tests showed that both forelimb and overall grip strength were significantly decreased (C). Figure 11D), indicating impaired muscle function. Immunofluorescence staining was used to observe changes in muscle fiber structure, and the results showed that the cross-sectional area of ​​muscle fibers in the Agomir-GlyGCC treatment group was reduced, and the arrangement structure was altered. Figure 11 E), further indicating a significant muscle atrophy phenotype. Metabolic cage assays showed that the respiratory exchange rate (RER) was decreased in the Agomir-GlyGCC treatment group (E). Figure 12 This suggests an alteration in energy metabolism. Furthermore, biochemical indicators showed that, compared to the control group, mice in the Agomir-GlyGCC treatment group had significantly lower blood glucose levels, while serum creatinine levels changed (…). Figure 13 This further reflects changes in the body's metabolic state and muscle-related indicators. The above results indicate that in vivo overexpression of tRF-GlyGCC can significantly promote skeletal muscle atrophy and reduce muscle function (e.g., ...). Figure 14 ).

[0029] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of tRF-GlyGCC expression regulator in the preparation of diagnostic products for muscle atrophy, characterized in that, The sequence of the tRF-GlyGCC is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The tRF-GlyGCC expression regulator is either a tRF-GlyGCC expression promoter or a tRF-GlyGCC expression inhibitor; the sequence of the tRF-GlyGCC expression promoter is shown in SEQ ID NO.2, and the sequence of the tRF-GlyGCC expression inhibitor is shown in SEQ ID NO.

3.

3. The application according to claim 1, characterized in that, The diagnostic product for muscle atrophy is a diagnostic reagent or diagnostic kit.

4. A diagnostic product for muscular atrophy, characterized in that, Including the tRF-GlyGCC expression regulator of claim 1.

5. The muscular atrophy diagnostic product according to claim 4, characterized in that, The tRF-GlyGCC expression regulator is either a tRF-GlyGCC expression promoter or a tRF-GlyGCC expression inhibitor; the sequence of the tRF-GlyGCC expression promoter is shown in SEQ ID NO.1, and the sequence of the tRF-GlyGCC expression inhibitor is shown in SEQ ID NO.2.

Images