Method for editing osdrw1 gene promoter to improve rice yield

By performing multi-site editing on the promoter of the rice OsDRW1 gene, the problems of long breeding cycles and low efficiency in rice breeding technology were solved. This resulted in increased OsDRW1 gene expression and tiller number, significantly improving yield per plant and providing a simple and easy-to-implement method for high-yield rice breeding.

CN122256349APending Publication Date: 2026-06-23GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610348015.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-12-30
Filing Date
2026-03-20
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing rice breeding technologies are time-consuming and inefficient, making it difficult to accurately combine multiple desirable traits. Traditional gene editing can easily lead to loss or abnormality of protein function, and there is a lack of cases of precise editing of the OsDRW1 gene promoter, making it difficult to steadily increase yield.

Method used

By constructing a Cas gene editing expression vector that expresses gRNA that edits the rice OsDRW1 gene, multi-site editing was performed in a specific region of the OsDRW1 gene promoter using cytosine base editing technology. Twelve targeted gRNAs were designed, and cytosine base editing vectors were constructed. Rice was then transformed and high-yield gene-edited mutants were screened.

Benefits of technology

The method achieved increased OsDRW1 gene expression, increased tiller number, and a significant increase in yield per plant of approximately 63.6%. The method is simple and easy to operate, and has good application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256349A_ABST
    Figure CN122256349A_ABST
Patent Text Reader

Abstract

The present application belongs to the field of plant biotechnology, and particularly relates to a method for editing an OsDRW1 gene promoter to improve rice yield. The present application aims to provide a new option for creating high-yield rice. The technical scheme of the present application is a method for editing an OsDRW1 gene promoter to improve rice yield, comprising the following steps: a. constructing a Cas gene editing expression vector for expressing gRNA for editing an OsDRW1 gene promoter of rice; b. transforming rice with the expression vector obtained in step a. to obtain transformed plants; c. collecting seeds of the transformed plants, screening for gene editing mutant seeds, and obtaining high-yield gene editing rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology, specifically relating to a method for editing the OsDRW1 gene promoter to increase rice yield. Background Technology

[0002] Rice is the staple food for over 3 billion people worldwide and is my country's largest grain crop. Its stable yield increase is directly related to national food security and the global food supply balance. Currently, rice production faces numerous challenges: on the one hand, the continuous reduction of arable land and the intensification of climate change (such as high temperatures and drought) have led to a deterioration of the production environment; on the other hand, traditional breeding techniques (such as hybridization breeding and mutation breeding) have inherent defects such as long cycles (usually 8-10 years), low screening efficiency, and difficulty in accurately aggregating multiple superior traits, making them unable to meet the urgent need for increased grain production.

[0003] With breakthroughs in CRISPR-Cas genome editing technologies, crop genetic improvement has entered an era of precision. Currently, research on rice yield-increasing breeding based on genome editing has made some progress, but its core focus remains on editing gene coding regions (such as editing the coding sequences of yield-related genes like Gn1a, DEP1, and GS3), achieving trait improvement by altering protein structure. However, coding region editing easily leads to protein loss or abnormality, potentially triggering extreme phenotypes, and it is difficult to achieve precise regulation of gene expression. In contrast, promoters, as the "switch" of gene transcription, have core elements in their sequences that directly determine gene expression intensity and spatiotemporal patterns. By editing promoters to obtain specific mutants, gene expression can be precisely regulated without altering the gene coding sequence. This avoids the side effects of coding region editing and can directionally improve agronomic traits, making it an ideal strategy for precision crop breeding.

[0004] The OsDRW1 gene is a key gene for rice growth and development, but traditional overexpression vectors easily lead to gene overexpression and pose issues such as transgenic safety. Despite the significant advantages of promoter editing strategies, there are still obvious technical bottlenecks in this field: First, existing research mostly focuses on validating promoter function in model plants, with very few cases of precise editing of promoters for yield-increasing genes in rice, and a lack of systematic research on the OsDRW1 gene promoter; second, most promoter editing uses a flat target site design, making it difficult to cover multiple core regulatory elements of the promoter, resulting in insufficient efficiency in screening effective mutants. Therefore, developing precise editing technology for the OsDRW1 gene promoter and identifying specific mutants that can stably increase rice yield is of great practical significance for overcoming existing breeding technology bottlenecks and ensuring food security. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a new option for creating high-yield rice.

[0006] The technical solution of this invention is a method for increasing rice yield by editing the OsDRW1 gene promoter, comprising the following steps:

[0007] a. Construct a Cas gene editing expression vector that expresses gRNA that edits the promoter of the rice OsDRW1 gene;

[0008] b. Transform rice with the expression vector obtained in step a to obtain transformed plants;

[0009] c. Collect seeds from the transformed plants, screen out the gene-edited mutant seeds, and obtain high-yield gene-edited rice.

[0010] Specifically, the gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

[0011] The Cas gene editing expression vector is a cytosine base editing expression vector.

[0012] Furthermore, the cytosine base editing expression vector includes a CBE fusion protein expression unit initiated by the maize ubiquitin promoter ZmUbi1 and a gRNA-scaffold expression unit initiated by the rice ubiquitin promoter OsUbi1.

[0013] Preferably, the CBE fusion protein is a fusion protein of nCas9, a cytosine deaminase domain, and a uracil DNA glycosylation inhibitor (UGI);

[0014] Furthermore, the cytosine deaminase domain is one of rApobec1, PmCDA1, TadA-CDa, or TadA-CDd.

[0015] Preferably, the gRNA-scaffold expression unit tandemly expresses at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

[0016] The cytosine base editing expression vector also includes a hygromycin resistance gene Hyg expression unit initiated by the CaMV35S promoter.

[0017] The present invention also provides a gRNA or a complementary nucleic acid molecule thereof, wherein the gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

[0018] The present invention also provides the application of the gRNA or a complementary nucleic acid molecule in increasing rice yield.

[0019] This invention also provides a vector for expressing gRNA that edits the promoter of the rice OsDRW1 gene.

[0020] Specifically, the gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

[0021] Furthermore, the vector is a cytosine base editing expression vector.

[0022] Specifically, the cytosine base editing expression vector includes a gRNA-scaffold expression unit initiated by the rice ubiquitin promoter OsUbi1.

[0023] The cytosine base editing expression vector also includes a CBE fusion protein expression unit initiated by the maize ubiquitin promoter ZmUbi1.

[0024] Furthermore, the cytosine base editing expression vector also includes a hygromycin resistance gene Hyg expression unit initiated by the CaMV35S promoter.

[0025] This invention also provides the application of the vector expressing the gRNA that edits the promoter of the rice OsDRW1 gene in improving rice yield.

[0026] The beneficial effects of this invention: This invention provides a method for increasing rice yield. This method increases the expression level of the OsDRW1 gene by editing the OsDRW1 gene promoter, thereby increasing rice yield. This invention designs and screens 12 specific gRNAs targeting the rice OsDRW1 gene promoter, and constructs a cytosine base editing vector for targeted editing of the rice OsDRW1 gene promoter elements based on these gRNAs. This method enables mutations in specific regions of the rice OsDRW1 gene promoter elements, resulting in a mutant plant with increased OsDRW1 gene expression, increased tiller number, and significantly increased rice yield (mean WT 33.22±4.01 g / plant, mean OsDRW1-PE mutant 54.35±4.52 g / plant, mutant yield per plant increased by approximately 63.6% compared to the wild type). The method of this invention is simple and easy to operate, and has great promise for research and application in improving rice yield. Attached Figure Description

[0027] Figure 1 Schematic diagram of the promoter region structure of the rice OsDRW1 gene; the labeled regions are multiple key regulatory sites, and the target sites of each guide RNA have been labeled.

[0028] Figure 2 Schematic diagram of the T-DNA region structure of the multisite genome editing vector pGEL2056.

[0029] Figure 3 qRT-PCR results of OsDRW1 gene expression level in T0 generation rice plants after OsDRW1 gene promoter editing.

[0030] Figure 4 Agronomic traits of rice mutant OsDRW1-PE T3 generation plants: A: Comparison of yield per plant between wild type and mutant; B: Comparison of tiller number per plant between wild type and mutant. Detailed Implementation

[0031] The OsDRW1 gene is a key gene for rice growth and development. Transcriptome-phenotypic association analysis shows that the expression level of this gene during the young panicle differentiation stage and grain filling stage is significantly positively correlated with the yield per plant. Overexpression of the OsDRW1 gene can increase the number of effective panicles in rice. However, traditional overexpression vectors are prone to gene overexpression and also pose issues such as transgenic safety. Therefore, this application considers the promoter of this gene as the research object, aiming to change the expression level of the OsDRW1 gene by adjusting the efficiency of the promoter through gene editing, thereby achieving a change in rice yield.

[0032] The applicant first obtained the wild-type promoter sequence (Seq ID No. 1) 2000 bp upstream of the OsDRW1 gene of Nipponbare rice through the rice genome database (https: / / rapdb.dna.affrc.go.jp / ). Combined with bioinformatics analysis (CAPE system prediction and PlantCARE software analysis of promoter core elements), three core regulatory regions were identified: Region A (Seq ID No. 1, 2-651 bp), Region B (Seq ID No. 1, 822-1001 bp), and Region C (Seq ID No. 1, 1562-1631 bp).

[0033] Based on the CAPE system prediction and PlantCARE promoter motif prediction results published in 2023, 12 targeting gRNAs (Seq ID No. 3 to Seq ID No. 14) were designed targeting the core regulatory regions and motifs, which can specifically bind to the corresponding core sites. For gene editing vector construction, pCAMBIA or pBI121 containing the CBE fusion protein (nCas9-PmCDA1-UGI) can be used as the backbone vector. The 12 gRNA expression cassettes are sequentially inserted into the vector, carrying the corresponding editing tool enzyme encoding genes (such as CBE fusion protein, ABE fusion protein, Cas9 nuclease).

[0034] The editing vector was transformed into rice Nipponbare callus tissue using Agrobacterium-mediated transformation, and T0 generation transformed plants were obtained after resistance selection. Positive mutant plants with OsDRW1 gene expression levels increased more than 1.2 times to the wild type were obtained by PCR detection of vector positivity, sequencing verification of editing site variations, and qRT-PCR detection of OsDRW1 gene expression levels. Single-seed passages to the T3 generation yielded homozygous mutants without selection markers (e.g., OsDRW1-PE). The edited promoter sequence (Seq ID No. 2) was obtained by sequencing the mutants. The specific edited variations are as follows: deletion occurs at positions 160-172 in region A; 5'-GGATG-3' at positions 373-377 in region A is replaced with 5'-AAATA-3'; 5'-CTAGGCACAAAAGGGGTTGCCTACCTTGGTTTTAAAGATAGGGG-3' at positions 819-862 in region B is replaced with 5'-AATA-3'; C is replaced with T at position 943 in region B; and 5'-CCAC-3' at positions 1571-1574 in region C is replaced with 5'-TTAT-3'. The homozygous mutant OsDRW1 has a gene expression level approximately 1.24 times that of the wild type, and its yield per plant is increased by approximately 63.6% compared to the wild type, exhibiting a stable yield-increasing trait.

[0035] Based on the above experimental results, the following technical solutions of the present invention were obtained.

[0036] The technical solution of this invention is a method for increasing rice yield by editing the OsDRW1 gene promoter, comprising the following steps:

[0037] a. Construct a Cas gene editing expression vector that expresses gRNA that edits the promoter of the rice OsDRW1 gene;

[0038] b. Transform rice with the expression vector obtained in step a to obtain transformed plants;

[0039] c. Collect seeds from the transformed plants, screen out the gene-edited mutant seeds, and obtain high-yield gene-edited rice.

[0040] Specifically, the gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

[0041] The Cas gene editing expression vector is a cytosine base editing expression vector.

[0042] Furthermore, the cytosine base editing expression vector includes a CBE fusion protein expression unit initiated by the maize ubiquitin promoter ZmUbi1 and a gRNA-scaffold expression unit initiated by the rice ubiquitin promoter OsUbi1.

[0043] Preferably, the CBE fusion protein is a fusion protein of nCas9, a cytosine deaminase domain, and a uracil DNA glycosylation inhibitor (UGI).

[0044] Furthermore, the cytosine deaminase domain is one of rApobec1, PmCDA1, TadA-CDa, or TadA-CDd.

[0045] Preferably, the gRNA-scaffold expression unit tandemly expresses at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

[0046] The cytosine base editing expression vector also includes a hygromycin resistance gene Hyg expression unit initiated by the CaMV35S promoter.

[0047] The present invention also provides a gRNA or a complementary nucleic acid molecule thereof, wherein the gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

[0048] The present invention also provides the application of the gRNA or a complementary nucleic acid molecule in increasing rice yield.

[0049] This invention also provides a vector for expressing gRNA that edits the promoter of the rice OsDRW1 gene.

[0050] Specifically, the gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

[0051] Furthermore, the vector is a cytosine base editing expression vector.

[0052] Specifically, the cytosine base editing expression vector includes a gRNA-scaffold expression unit initiated by the rice ubiquitin promoter OsUbi1.

[0053] Preferably, the gRNA-scaffold expression unit expresses the nucleotide fragment shown in Seq ID No. 15.

[0054] The cytosine base editing expression vector further includes a CBE fusion protein expression unit initiated by the maize ubiquitin promoter ZmUbi1; CBE is a fusion protein of nCas9, the cytosine deaminase domain PmCDA1, and the uracil DNA glycosylation inhibitor (UGI).

[0055] Furthermore, the cytosine base editing expression vector also includes a hygromycin resistance gene Hyg expression unit initiated by the CaMV35S promoter.

[0056] This invention also provides the application of the vector expressing the gRNA that edits the promoter of the rice OsDRW1 gene in improving rice yield.

[0057] The present invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the experimental methods used are conventional molecular biology experimental methods.

[0058] Example 1: Construction of a multi-site editing vector for the OsDRW1 gene promoter

[0059] (1) Editing site selection and gRNA design:

[0060] The wild-type promoter sequence (Seq ID No. 1) upstream of the Nipponbare OsDRW1 gene in rice was obtained from the rice genome database (https: / / rapdb.dna.affrc.go.jp / ). Bioinformatics analysis (CAPE system prediction and PlantCARE software analysis of promoter core elements) identified three core regulatory regions: Region A (Seq ID No. 1, 2–651 bp), Region B (Seq ID No. 1, 822–1001 bp), and Region C (Seq ID No. 1, 1562–1631 bp). To improve the editing success rate, 12 targeting gRNAs were designed for the promoter, with sequences Seq ID Nos. 3–14. The core target gRNAs are Seq ID No. 7 (Region C), Seq ID No. 10 and Seq ID No. 11 (Region B), and Seq ID No. 13 and Seq ID No. 14 (Region A), which can guide the editing enzyme to specifically bind to the corresponding core sites in these regions.

[0061] Seq ID No. 1: Complete sequence of wild-type OsDRW1 gene promoter (2000bp);

[0062]

[0063] Seq ID No. 3: gRNA01 sequence (20 bp) GTGCTCTCTGCACGCCTTCT.

[0064] Seq ID No. 4: gRNA02 sequence (20 bp) CAACGGCAATGCGACCAAGC.

[0065] Seq ID No.5: gRNA03 sequence (20 bp) ATGACGGTAGCACCATGAGG.

[0066] Seq ID No. 6: gRNA04 sequence (20 bp) TGATCCCTTCTTTCCGCAC.

[0067] Seq ID No.7: gRNA05 sequence (20 bp) TCCACGTGGGTGGGTTGGAG.

[0068] Seq ID No.8: gRNA06 sequence (20 bp) TCAACTGGGGTATAAGCCTT.

[0069] Seq ID No.9: gRNA07 sequence (20 bp) GTGACGTGTCTGGTCGGGCA.

[0070] Seq ID No. 10: gRNA08 sequence (20 bp) CGCCCCTATCTTTAAAACCA.

[0071] Seq ID No. 11: gRNA09 sequence (20 bp) AGGCAACCCCTTTTGTGCCT.

[0072] Seq ID No.12: gRNA10 sequence (20 bp) TCGCGGAAACCTAGGTGTA.

[0073] Seq ID No.13: gRNA11 sequence (20 bp) TCATCCAATTTGACAAAGGA.

[0074] Seq ID No.14: gRNA12 sequence (20 bp) TCCGAAATGGTGCTACCTAA.

[0075] (2) Vector digestion and purification:

[0076] pTX2061 was selected as the backbone vector, which contains the gene encoding the nCas9-PmCDA1-UGI ​​fusion protein and the Ubiquitin promoter, and was modified from pGEL035 published by Tang X, Ren Q, Yang L, Bao Y, Zhong Z, He Y, Liu S, Qi C, Liu B, Wang Y, Sretenovic S, Zhang Y, Zheng X, Zhang T, Qi Y, Zhang Y. 2019.Single transcript unit CRISPR 2.0 systems for robust Cas9 and Cas12a mediated plant genome editing. Plant Biotechnology Journal, 17(7): 1431-1445. Single digestion was performed using BsaI restriction endonuclease (NEB, R0535L); the digestion system (50 μL) consisted of 5 μL of 10×Fast digest buffer, 10 μL (3 μg) of backbone vector DNA, 1 μL of BsaI endonuclease, and RNase-free ddH2O to a final volume of 50 μL; after reacting at 37℃ for 2 h, the reaction was terminated with EDTA, and the product was detected by 1% agarose gel electrophoresis and recovered by gel excision (Axygen, AP-GX-250). The concentration of the recovered product was ≥100 ng / μL as determined by Nanodrop 2000.

[0077] (3) Construction of gRNA expression cassette and ligation into vector:

[0078] Primers for constructing expression cassettes of 12 gRNAs were synthesized (Sangon Biotech, PAGE purified, primer sequences are shown in Table 1). Following the construction method reported by Tang X, Qi Y, Zhang Y. Single Transcript Unit CRISPR 2.0 Systems for Genome Editing in Rice. Methods Mol Biol. 2021;2238:193-204, the DNA fragments containing each gRNA were inserted into the digested pTX2061 vector via Golden Gate reaction. The reaction system (20 μL) consisted of: 2 μL of 10×T4 ligase buffer, 1 μL of T4 ligase (NEB, M0202L), 1 μL of BsaI-HFv2 (NEB, R3733), 1 μL of BbsI-HF (NEB, R3539), 1 μL of pTX2061 digestion product, 5 μL of the DNA fragment containing the gRNA, and ddH2O to a final volume of 20 μL. The reaction program was as follows: (37℃, 5 min → 16℃, 10 min) × 80 cycles → 37℃, 15 min → 65℃, 15 min → 4℃, 5 min. The reaction product was transformed into E. coli DH5α competent cells, plated on LB medium containing 50 mg / L Kan, and incubated at 37℃ for 18 h.

[0079] Table 1 Primers used for vector construction

[0080] .

[0081] (4) Vector identification:

[0082] Single colonies were selected for colony PCR verification. Plasmids were extracted from positive colonies and subjected to double enzyme digestion and sequencing. The correctly sequenced vector was named pGEL2056 (T-DNA structure diagram shown below). Figure 2 CBE is a fusion protein of nCas9, cytosine deaminase domain, and uracil DNA glycosylation inhibitor (UGI), abbreviated as CBE, where the cytosine deaminase domain is PmCDA1.); Store the correct vector at -80°C (containing 50% glycerol) for subsequent transformation. Figure 2 The expression cassette sequence of the 12 gRNAs concatenated is shown in Seq ID No. 15.

[0083] Seq ID No. 15: Expression cascade containing 12 concatenated gRNAs;

[0084]

[0085] Example 2 Agrobacterium-mediated genetic transformation of rice

[0086] The specific process of Agrobacterium-mediated transformation of rice genetic transformation is described in the experimental method disclosed in the reference (Tang X, Lowder LG, Zhang T, Malzahn A, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y. 2017. A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nature Plants, 3: 17018).

[0087] The specific steps of genetic transformation in rice are as follows: Mature rice (Nipponbare) seeds are dehulled and sterilized; the sterilized seeds are inoculated onto N-6-D solid medium containing 0.4% gellan gum and cultured at 32°C under continuous light for 1–5 days; the cultured seeds are transformed into rice using Agrobacterium-mediated transformation to transfer plasmid pGEL2056; the transformed rice seeds are then cultured in induction and selection medium under continuous light at 32°C for 2 weeks; the resulting callus tissue is transferred to RE-III medium; the young plantlets from the callus tissue are transferred to HF medium to induce root development. When the obtained resistant regenerated seedlings reach approximately 15 cm in length, the root culture medium is washed off with water, and the seedlings are transplanted into nutrient soil for greenhouse cultivation.

[0088] Example 3 Screening and Molecular Identification of Rice OsDRW1 Gene Promoter Mutants

[0089] (1) Extraction of genomic DNA from rice seedlings:

[0090] DNA extraction from rice seedlings was performed using the CTAB method. The specific steps were as follows: The CTAB extraction buffer was preheated in a 65°C water bath. One leaf from a single plant was placed in a 2mL centrifuge tube with a steel ball, flash-frozen in liquid nitrogen, and then shaken to form a powder. 500μL of preheated CTAB extraction buffer was added, and the mixture was incubated at 65°C for 30–50 min, mixing thoroughly during incubation. 500μL of chloroform:isoamyl alcohol (24:1) was added, and the mixture was thoroughly mixed by inverting. The mixture was centrifuged at 10,000 rpm for 10 min at 4°C. The supernatant was collected, and an equal volume of isopropanol was added to precipitate the precipitate. The precipitate was incubated at -20°C for 30 min–2 h. The precipitate was then centrifuged at 12,000 rpm for 10 min at room temperature. The supernatant was discarded, the precipitate was washed with 75% ethanol, and centrifuged at 12,000 rpm for 2 min. The supernatant was discarded, and the DNA was air-dried. 30–50μL of ddH2O was added to dissolve the DNA, and the mixture was stored at -20°C for later use.

[0091] (2) Positive detection of transgenic rice seedlings:

[0092] Primers designed for pGEL2056 were TX067-F (5'-CATATGCAGCAGCTATATGTGGA-3', Seq ID No. 15) and TX552 (5'-CGCAATGAGATTCCCGAACA-3', Seq ID No. 16); PCR system (25 μL): 12.5 μL of 2×TaqMaster Mix, 1 μL each of forward and reverse primers, 2 μL of DNA template, and ddH2O to 25 μL; amplification program: 95℃ pre-denaturation for 5 min → 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min (35 cycles) → 72℃ final extension for 5 min; 1% agarose gel electrophoresis was used to detect positive plants, with the appearance of a specific band of 900 bp.

[0093] (3) Sequencing verification of edited sites:

[0094] The promoter sequence of the OsDRW1 gene in transgenic plants was amplified using specific primers OsDRW1-pro-seq-F (5'- CCCGATCCCTAGCATTTTCG -3', Seq ID No. 17) and OsDRW1-pro-seq-R (5'- CTGCAGCAAGATTGGGAGCG -3', Seq ID No. 18), respectively (Seq ID No. 1). The PCR products were excised from the gel, recovered, and ligated into the pMD19-T vector. DH5α competent cells were transformed, and single colonies were selected for sequencing. The sequencing results were compared with the wild-type sequence (Seq ID No. 1) using Chromas software to screen for plants with editing in at least one of the three core regulatory regions. The sequencing results of the OsDRW1-PE line are shown in Seq ID No. 2. The specific edits are as follows: bits 160-172 in region A are deleted; bits 373-377 in region A are replaced with 5'-AAATA-3'; bits 819-862 in region B are replaced with 5'-AATA-3'; bit 943 in region B is replaced with C; and bits 1571-1574 in region C are replaced with 5'-TTAT-3'.

[0095] Seq ID No. 2: Complete sequence of the OsDRW1-PE promoter mutant of the OsDRW1 gene;

[0096]

[0097] (4) qRT-PCR expression analysis

[0098] Total RNA was extracted from the young spikelet leaves of the positive mutant (OsDRW1-PE) and wild-type (WT) using an RNA extraction kit (Novizan, RC411-01); reverse transcription was performed using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit (Novizan, R323-01); OsDRW1-specific primers (OsDRW1-F 5'-CTTTCCCAGAGGGGGTGTTC-3', Seq ID No. 19; OsDRW1-R 5'- TGGGATCGAAAGACAACCCG-3', Seq ID No. 20) were designed using Actin1 as an internal control, and the RNA was analyzed using ChamQ Universal SYBR qPCR Master. Mix (Novizan, Q711-02) amplification, relative expression levels were calculated using the 2^(-ΔΔCt) method; the results showed that the relative expression level of wild-type (WT) OsDRW1 gene was 1±0.091, and the relative expression level of mutant OsDRW1-PE was 1.243±0.109, indicating that the mutant gene expression level was significantly higher than that of wild-type. Figure 3 This confirms that promoter editing successfully improved gene transcription efficiency.

[0099] Example 4: Identification of agronomic traits of the rice OsDRW1 gene promoter mutant OsDRW1-PE

[0100] (1) Obtaining homozygous mutants

[0101] T0 generation positive mutants were self-pollinated to harvest T1 generation seeds; T1 generation plants were planted, and plants with all sequencing results showing the target mutation and no marker gene were screened and identified as homozygous mutant OsDRW1-PE; single seeds were passaged to T3 generation.

[0102] (2) Survey of agronomic traits

[0103] OsDRW1-PE and wild-type Nipponbare (WT) were sown and transplanted at the same time, with conventional field management. At maturity, plants were randomly selected to adjust the yield per plant and the number of tillers per plant.

[0104] (3) Results and Analysis

[0105] like Figure 4As shown, OsDRW1-PE exhibits a significant yield-increasing advantage over WT, with particularly prominent improvements in the number of tillers per plant and yield per plant: the average number of tillers per plant in WT is 13.4±1.8, while the average number of tillers per plant in the OsDRW1-PE mutant is 19.1±5.7, showing a significant increase in tiller number compared to the wild type; the yield per plant is as follows: the average yield in WT is 33.22±4.01 g / plant, while the average yield in the OsDRW1-PE mutant is 54.35±4.52 g / plant, showing a significant increase in yield per plant compared to the wild type. This demonstrates that promoter mutants can directionally improve rice yield traits by increasing tiller number and yield per plant, among other key agronomic traits. Although CBE editing presents challenges in obtaining reproducible results, the homozygous mutant OsDRW1-PE obtained in this invention is genetically stable, providing high-quality germplasm resources for high-yield breeding.

Claims

1. A method for increasing rice yield by editing the OsDRW1 gene promoter, characterized in that: Includes the following steps: a. Construct a Cas gene editing expression vector that expresses gRNA that edits the promoter of the rice OsDRW1 gene; b. Transform rice with the expression vector obtained in step a to obtain transformed plants; c. Collect seeds from the transformed plants, screen out the gene-edited mutant seeds, and obtain high-yield gene-edited rice.

2. The method according to claim 1, characterized in that: The gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

3. The method according to claim 1, characterized in that: The Cas gene editing expression vector is a cytosine base editing expression vector; Preferably, the cytosine base editing expression vector includes a CBE fusion protein expression unit initiated by the maize ubiquitin promoter ZmUbi1 and a gRNA-scaffold expression unit initiated by the rice ubiquitin promoter OsUbi1. Preferably, the CBE fusion protein is a fusion protein of nCas9, a cytosine deaminase domain, and a uracil DNA glycosylation inhibitor (UGI); Furthermore, the cytosine deaminase domain is one of rApobec1, PmCDA1, TadA-CDa, or TadA-CDd; Preferably, the gRNA-scaffold expression unit tandemly expresses at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

4. The method according to claim 3, characterized in that: The cytosine base editing expression vector also includes a hygromycin resistance gene Hyg expression unit initiated by the CaMV35S promoter.

5. gRNA or a complementary nucleic acid molecule, characterized by: The gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

6. The application of the gRNA of claim 5 or a complementary nucleic acid molecule thereto in increasing rice yield.

7. A vector for expressing gRNA that edits the promoter of the rice OsDRW1 gene, characterized in that: The gRNA is at least one of gRNA01 (Seq ID No. 3), gRNA02 (Seq ID No. 4), gRNA03 (Seq ID No. 5), gRNA04 (Seq ID No. 6), gRNA05 (Seq ID No. 7), gRNA06 (Seq ID No. 8), gRNA07 (Seq ID No. 9), gRNA08 (Seq ID No. 10), gRNA09 (Seq ID No. 11), gRNA10 (Seq ID No. 12), gRNA11 (Seq ID No. 13), or gRNA12 (Seq ID No. 14).

8. The carrier according to claim 7, characterized in that: The vector is a cytosine base editing expression vector.

9. The carrier according to claim 8, characterized in that: The cytosine base editing expression vector includes a gRNA-scaffold expression unit initiated by the rice ubiquitin promoter OsUbi1; Preferably, the gRNA-scaffold expression unit expresses the nucleotide fragment shown in Seq ID No. 15; Preferably, the cytosine base editing expression vector further includes a CBE fusion protein expression unit initiated by the maize ubiquitin promoter ZmUbi1; Preferably, the cytosine base editing expression vector further includes a hygromycin resistance gene Hyg expression unit initiated by the CaMV35S promoter.

10. The application of the vector expressing gRNA that edits the promoter of the rice OsDRW1 gene as described in any one of claims 7 to 9 in improving rice yield.