KASP primer of haplotype synergistically regulating wheat thousand kernel weight and sdssd value and application

By developing haplotype KASP primers for wheat thousand-grain weight and SDS-sedimentation value, and using SNP site detection of the TraesCS1B02G443800 gene, the problem of synergistic improvement of yield and quality in wheat breeding was solved, and efficient early screening of high-quality and high-yield materials was achieved.

CN122382239APending Publication Date: 2026-07-14YANGZHOU UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2026-05-22
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient to synergistically improve thousand-grain weight and SDS-sedimentation value in wheat breeding. Traditional phenotypic identification is lagging and easily affected by environmental interference. Yield and quality are negatively correlated, and there is a lack of functional molecular markers adapted to the KASP high-throughput platform.

Method used

A haplotype KASP primer was developed to synergistically regulate wheat thousand-grain weight and SDS-sedimentation value. By detecting specific SNP sites (C/T variations) in the TraesCS1B02G443800 gene, high-throughput detection was performed using KASP molecular markers to simultaneously predict the potential for high thousand-grain weight and high SDS-sedimentation value.

Benefits of technology

This breakthrough breaks the negative correlation between yield and quality at the molecular level, enabling simultaneous prediction of yield and quality potential through a single DNA test, eliminating environmental interference, screening high-quality and high-yield materials at an early stage, and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122382239A_ABST
    Figure CN122382239A_ABST
Patent Text Reader

Abstract

This invention discloses a KASP primer for synergistically regulating wheat thousand-grain weight and SDS-sedimentation value, and its application. Based on the polymorphism analysis of candidate genes, this invention precisely locates a functional single nucleotide polymorphism (SNP) site that simultaneously positively regulates the two core traits mentioned above, and develops a high-throughput molecular diagnostic tool. Validation in natural populations shows that this site exhibits strong pleiotropic effects: materials carrying the HAP I haplotype not only show excellent thousand-grain weight but also a significant simultaneous increase in SDS-sedimentation value. This detection system possesses advantages such as high throughput, low cost, and digital genotyping, overcoming the technical bottleneck of traditional quality identification being limited by large quantities of grains and the difficulty in simultaneously considering yield and quality. It achieves early and accurate diagnosis of "dual-superior" genotypes in wheat, which is of great significance for molecular-directed polymerization breeding of high-yielding, strong-gluten wheat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to wheat breeding, and more specifically, to a haplotype KASP primer that synergistically regulates the thousand-grain weight and SDS-sedimentation value of wheat and its application. Background Technology

[0002] Wheat yield is primarily determined by three factors: thousand-grain weight (TGW), number of spikes per unit area, and number of grains per spike. Numerous studies have shown that once the number of spikes and grains per spike reaches a certain level, thousand-grain weight becomes the key factor limiting further yield increases. Generally, a higher thousand-grain weight usually means larger, fuller grains with a relatively higher endosperm content and a relatively lower bran content, which has a significant positive correlation with flour yield. Furthermore, in fully filled grains with a high thousand-grain weight, the accumulation and composition of protein and starch are more optimized, indirectly affecting the rheological properties of the dough and the quality of the final food product.

[0003] SDS-sedimentation value (Sodium Dodecyl Sulfate Sedimentation Value) is a reliable comprehensive physiological and chemical indicator for measuring wheat gluten protein quality, dough rheological properties, and baking quality. Numerous cereal chemistry studies have confirmed that the SDS-sedimentation value directly reflects the content and swelling capacity of glutenin macromers, and shows a highly significant positive correlation with dough formation time and stabilization time measured by a farinograph, maximum tensile resistance measured by an extensometer, and the final baked bread volume. Therefore, cultivating and screening superior germplasm resources with high SDS-sedimentation values ​​has always been a core objective in breeding high-quality, strong-gluten wheat.

[0004] In practical breeding work, synergistically improving thousand-grain weight and SDS-sedimentation value faces significant technical bottlenecks. One is the lag and limitations of traditional phenotypic identification. Traditional thousand-grain weight measurement requires manual sampling and weighing after the plant is fully mature and harvested, and is easily affected by environmental factors such as temperature and pests, which can impair heritability (H²) assessment. SDS-sedimentation value measurement requires not only complex pretreatments such as threshing, moisture regulation, and experimental milling, but also several to tens of grams of whole wheat flour. This means that in early generations (such as F2 and F3 individual plants), due to the extremely low grain yield per plant, sedimentation value phenotypic identification is impossible. Furthermore, environmental factors such as temperature, humidity, and nitrogen fertilizer application in the later stages of growth (G×E interaction) significantly alter protein accumulation patterns, leading to the risk of blindly eliminating superior quality genes in early segregating generations. Another bottleneck is the negative correlation between yield and quality. During physiological development, the pursuit of high thousand-grain weight usually leads to a large accumulation of starch in the endosperm, which relatively dilutes the protein components that determine gluten strength (protein dilution effect), resulting in a decrease in SDS-sedimentation value. This genetic linkage often leads to unintended consequences in conventional selection.

[0005] Currently, there is a lack of functional "one-cause-multiple-effect" molecular markers that can break the negative correlation between yield and quality, while simultaneously positively and synergistically regulating the core genes for thousand-grain weight and SDS-sedimentation value, and are fully adaptable to the KASP high-throughput platform. Therefore, in-depth exploration of superior allelic variations regulating wheat thousand-grain weight and SDS-sedimentation value, and the development of a highly specific and accurately genotyping KASP molecular marker and supporting application system, has extremely high academic value and significant industrial application prospects for achieving efficient synergistic aggregation of quality and yield traits in early generations and accelerating the targeted breeding of high-quality, strong-gluten, and high-yielding wheat. Summary of the Invention

[0006] To address the lack of functional "one-factor-multiple-effect" molecular markers that can break the negative correlation between yield and quality, while simultaneously positively and synergistically regulating core genes for thousand-grain weight and SDS-sedimentation value, and are fully adaptable to the KASP high-throughput platform, this invention provides a haplotype, KASP primer, and application for synergistically regulating wheat thousand-grain weight and SDS-sedimentation value. By detecting core SNP sites once, the potential for high thousand-grain weight and high SDS-sedimentation value in wheat can be predicted simultaneously, improving the efficiency of molecular-assisted selection in high-yield and high-quality synergistic breeding of wheat.

[0007] To achieve the above objectives, this invention provides, on the one hand, the application of haplotype HAP I, which synergistically regulates wheat thousand-grain weight and SDS-sedimentation value, in wheat breeding, in the wheat reference genome. TraesCS1B02G443800 The gene nucleotide sequence is shown in SEQ ID NO.8, and the base of the haplotype HAP I at position 664808074 on wheat chromosome 1B is C.

[0008] SEQ ID NO.8:

[0009] This haplotype can be used to identify and evaluate materials with high thousand-grain weight and high SDS-sedimentation value, as well as to breed high-quality, strong-gluten, and high-yielding wheat varieties through backcrossing and other methods.

[0010] A second aspect of the present invention provides a set of KASP molecular marker primers for the co-identification or auxiliary identification of the above-mentioned haplotype HAP I, comprising: a forward competitive primer KASP-F1 with a nucleotide sequence as shown in SEQ ID NO. 6 (GAAGGTGACCAAGTTCATGCTGAGGCGTTTGAGGGCTGc), a forward competitive primer KASP-F2 with a nucleotide sequence as shown in SEQ ID NO. 7 (GAAGGTCGGAGTCAACGGATTGAGGCGTTTGAGGGCTGt), and a reverse universal primer KASP-R with a nucleotide sequence as shown in SEQ ID NO. 3 (AGGGCCTGGATGAGGGTTGT).

[0011] The third aspect of this invention provides the application of the above-mentioned KASP molecular marker primer set in the simultaneous or auxiliary identification of wheat thousand-grain weight and SDS-sedimentation value.

[0012] Specifically, the identification method includes the following steps: 1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set described above to obtain the amplification product; 2) Scan the amplification products for fluorescence signals and observe the genotyping cluster diagram: If the fluorescence signal is blue, the genotype of the wheat being tested at this locus is determined to be CC, belonging to the HAP I haplotype; if the fluorescence signal is red, the genotype of the wheat being tested at this locus is determined to be TT, belonging to the HAP II haplotype. 3) If the wheat to be tested is determined to be of the HAP I haplotype, it is considered that the wheat has both high thousand-grain weight potential and high SDS-sedimentation value potential.

[0013] Specifically, in step 1), the PCR amplification method is as follows: The PCR amplification reaction system is 10 μL, including: 2 μL of genomic DNA at a concentration of 120 ng / μL, 5 μL of 2×KASP Master Mix, 0.15 μL of KASP Assay Mix, and 2.85 μL of ddH2O; wherein, the KASP Assay Mix is ​​prepared as follows: every 100 μL of KASP Assay Mix contains 12 μL each of two forward competitive primers at a concentration of 100 μM, 30 μL of reverse universal primers at a concentration of 100 μM, and 46 μL of ddH2O to make up the difference; The PCR amplification reaction program is as follows: 1) Activate at 94℃ for 15 min; 2) Denature at 94℃ for 20 s, anneal and extend at 68℃~62℃ for 60 s, 10 touch-down cycles, each cycle decreasing by 0.6℃; 3) Denature at 94℃ for 20 s, anneal and extend at 62℃ for 60 s, 28 conventional cycles.

[0014] Through the above technical solution, the present invention achieves the following beneficial effects: 1. This invention is the first to demonstrate the target gene ( TraesCS1B02G443800 The specific site (Chr1B:664808074) SNP (C / T) variation exhibits strong pleiotropic effects. Wheat carrying the HAP I haplotype defined in this invention achieves larger grains (higher thousand-grain weight) while simultaneously showing a significant increase in SDS-sedimentation value, breaking the negative correlation between yield and quality. This provides a usable haplotype for the synergistic improvement of yield and quality at the molecular level.

[0015] 2. By using the KASP marker of this invention for a single DNA test, both yield potential and processing quality potential can be predicted simultaneously. This eliminates the interference of environmental factors and completely eliminates the limitation of traditional breeding that requires a large number of grains to be used for testing after harvest, thus significantly advancing the screening point for high-quality and high-yield materials to the seedling stage. Attached Figure Description

[0016] Figure 1 This is a schematic diagram showing the location of the SNP corresponding to the KASP molecular marker developed in Example 1 of the present invention, wherein: 3'UTR and Exon represent the 3' untranslated region and exon region of the gene where the SNP is located, respectively; the FSNP marked by the arrow is the functional SNP corresponding to the KASP marker; Figure 2 This is a schematic diagram illustrating the verification of the accuracy and high resolution of SNP site detection by the KASP molecular marker in Example 2 of the present invention. In this diagram: A represents the detection effect of the KASP molecular marker developed in this invention on this site. The coordinate axis values ​​represent the allele fluorescence signal intensity. The black dots represent the negative control (NTC, i.e., ddH2O). The blue and red dots represent different genotypes, respectively. B represents the SNP variant types detected by sequencing methods. Figure 3 This is a graph showing the amplification and genotyping results of the test population material using the developed KASP molecular marker in Example 3 of the present invention. In the graph, the coordinate axis values ​​represent the allele fluorescence signal intensity, the black dots represent the negative control (NTC, i.e., ddH2O), and the blue and red dots represent different genotypes, respectively. Figure 4This is a comparison of the thousand-grain weight (A) and SDS-sedimentation value (B) of two different haplotypes of wheat in Example 3 of the present invention, detected by KASP molecular markers. In this figure, HAPⅠ represents haplotype I material and HAPⅡ represents haplotype II material. Detailed Implementation

[0017] To enable the public to more clearly understand the purpose, technical solution, and advantages of this invention, detailed descriptions will be provided below through embodiments. Unless otherwise expressly defined, the terminology used herein should be understood as having a general meaning in the technical field. Operating methods and processes not described in detail in the embodiments are all common knowledge in the art. Unless otherwise specified, the materials and reagents used can be purchased through conventional commercial channels. The wheat materials involved are all sourced from the College of Agriculture, Yangzhou University - Jiangsu Provincial Germplasm Resource Bank (Crops), and can be legally obtained and used by those skilled in the art.

[0018] Example 1. Development of KASP molecular markers and primers for identifying wheat thousand-grain weight and SDS-sedimentation value (1) Reference sequence determination and structural analysis Selected from chromosome 1B of wheat Chinese Spring (IWGSC RefSeq v1.1) TraesCS1B02G443800 The gene sequence (as shown in SEQ ID NO. 8) is used as a reference sequence. Analysis using the Ensembl Plants database shows that the full-length sequence is 1854 bp, containing one 1554 bp exon (see [link to Ensembl Plants database]). Figure 1 ).

[0019] (2) Natural variation site analysis and functional SNP localization Using resequencing data published in the Wheat Genome Variation Database, 10 SNP variant sites were identified. Their physical locations on chromosome 1B are as follows: 664807497, 664807596, 664807624, 664807663, 664807719, 664808074, 664808183, 664808273, 664808571, and 664808904. Locating these variant sites onto the reference sequence (SEQ ID NO. 8), analysis revealed that, except for site 664808904, which is located in the 3' untranslated region (UTR), the other nine sites are all located in exons. Given that mutations in exon regions can directly alter coding sequences and affect gene function, this invention screened for SNP number 6 (Chr1B:664808074) as a key functional SNP (named FSNP, see [link]). Figure 1 Using the Chinese spring sequence as a reference, this locus exhibits C / T allelic variation (Table 1).

[0020] Table 1 Location of functional SNPs

[0021] Note: The Chinese Spring (IWGSC RefSeq v1.1) sequence is used as the reference sequence.

[0022] (3) Development of KASP marker primers Using SEQ ID NO.8 as a reference sequence, the FSNP site (position 664808074) and its upstream and downstream regions (100 bp each) were extracted. KASP core primers were designed using the built-in workflow of LGC Genomics. The quality of the designed primers was evaluated using DNAMAN software, and their sequence specificity was verified using the Ensembl Plants database. The obtained KASP core primer set consists of two allele-specific forward primers (FSNP-F1, as shown in SEQ ID NO.1; FSNP-F2, as shown in SEQ ID NO.2) and one universal reverse primer (KASP-R, as shown in SEQ ID NO.3). Furthermore, FAM (linker sequence SEQ ID NO.4) and HEX (linker sequence SEQ ID NO.5) fluorescent linkers were attached to the 5' ends of the two forward competing primers, respectively, ultimately forming a KASP molecular marker primer set for high-throughput detection. The combination specifically includes: the forward competitive primer KASP-F1 (SEQ ID NO.6), the forward competitive primer KASP-F2 (SEQ ID NO.7), and the reverse universal primer KASP-R (SEQ ID NO.3).

[0023] SEQ ID NO.1 (FSNP-F1): GAGGCGTTTGAGGGCTGc SEQ ID NO.2 (FSNP-F2): GAGGCGTTTGAGGGCTGt SEQ ID NO.3 (KASP-R): AGGGCCTGGATGAGGGTTGT SEQ ID NO.4 (FAM): GAAGGTGACCAAGTTCATGCT SEQ ID NO.5 (HEX): GAAGGTCGGAGTCAACGGATT SEQ ID NO.6 (KASP-F1): GAAGGTGACCAAGTTCATGCTGAGGCGTTTGAGGGCTGc SEQ ID NO.7 (KASP-F2): GAAGGTCGGAGTCAACGGATTGAGGGCTTTTGAGGGCTGt Example 2: Validation of the accuracy and high resolution of KASP molecular marker detection (1) DNA extraction from the tested wheat Natural populations containing both local and bred varieties (see Table 2 for a list of materials) were selected as test materials. Young leaves were collected during the wheat seedling stage. Freshly collected leaves, along with grinding beads, were placed in 2 mL centrifuge tubes, flash-frozen in liquid nitrogen, and thoroughly homogenized into a slurry. Then, 500 μL of 1.5×CTAB lysis buffer was added to the tube, gently inverted to mix, and incubated at 65°C for half an hour, with several shakes during incubation. An equal volume of chloroform was added to the system, and the mixture was shaken on a shaker at room temperature for 20 minutes. After centrifugation at 10,000 rpm for 10 minutes, clear stratification occurred. Approximately 400-500 μL of the upper aqueous phase was carefully transferred to a fresh centrifuge tube. Pre-chilled isopropanol was then added at a 1:1 volume ratio to precipitate DNA. After thorough mixing, the mixture was transferred to -20°C and incubated for 30 minutes. The nucleic acid precipitate was then collected by high-speed centrifugation at 12,000 rpm for 15 minutes. After discarding the waste liquid, wash the precipitate with 1 mL of 75% ethanol (centrifuged at 8000 rpm for 5 minutes). After the supernatant has been completely removed and the ethanol has completely evaporated at room temperature, add 50 to 100 μL of sterile double-distilled water to fully dissolve the purified DNA, and dilute the DNA concentration of each sample to approximately 120 ng / μL for later use.

[0024] (2) Sequencing technology to detect target SNPs Ten representative samples from a random natural population were selected, and the target fragment was amplified and sequenced by PCR. The forward primer was 5'-CAGCCAGTCGTCAAAGTGTC-3', and the reverse primer was 5'-GACACTTTGACGACTGGCTG-3'. Sequencing data alignment analysis showed that, using the Chinese spring reference sequence as a reference, the expected C / T allelic mutation was successfully detected at locus 664808074 on chromosome 1B. Figure 2 (B)

[0025] (3) KASP typing verification The KASP molecular marker primer set obtained in Example 1 was used to perform genotyping verification on the above 10 sequenced materials.

[0026] ①KASP reaction system (10 μL): contains 2 μL sample DNA (120 ng / μL), 5 μL KASP MasterMix, 0.15 μL KASP Assay Mix, and brings the volume to 10 μL with ddH2O. Each 100 μL of KASP Assay Mix contains 12 μL of primer KASP-F1, 12 μL of primer KASP-F2, and 30 μL of primer KASP-R at a concentration of 100 μM, and is brought to a final volume with 46 μL of ddH2O.

[0027] ② Reaction procedure: Activate at 94℃ for 15 min; then perform 10 cycles of landing PCR (denaturation at 94℃ for 20 s, annealing and extension at 68℃ for 60 s, with the annealing temperature decreasing by 0.6℃ per cycle); finally, perform 28 routine cycles (denaturation at 94℃ for 20 s, annealing and extension at 62℃ for 60 s).

[0028] ③ Genotype determination: Fluorescence signals were scanned and genotyped using the Applied Biosystems ABI Viia7 real-time PCR system. Figure 2 (A) In the genotyping diagram, the cluster distribution clearly reflects the genotype: samples clustered near the Y-axis and showing a blue signal have the genotype corresponding to the FAM fluorescent adapter, and are identified as "C / C" genotype; samples clustered near the X-axis and showing a red signal have the genotype corresponding to the HEX fluorescent adapter, and are identified as "T / T" genotype; samples with black signals are blank controls, clustered near the origin.

[0029] The test results showed that the KASP molecular marker developed in this invention had good typing effect and clear cluster separation. Moreover, the KASP typing results of 10 samples were completely consistent with the sequencing data (Table 2), proving that the marker was successfully developed and has extremely high accuracy.

[0030] Table 2. Comparison of sequencing and KASP marker genotyping results of 10 representative wheat samples.

[0031] Example 3: Detection of thousand-grain weight and SDS-sedimentation value of wheat population using KASP molecular markers. This embodiment illustrates the method for simultaneously identifying and predicting the dual traits of thousand-grain weight (yield indicator) and SDS-sedimentation value (quality indicator) in natural wheat populations using the high-throughput KASP marker primers developed in this invention, and its practical application effects.

[0032] (1) KASP population typing and haplotype definition Using the KASP primer combination obtained in Example 1, genotyping was performed on the remaining 266 unsequencing accessions from the natural population in Example 2, as shown in Table 3. The KASP reaction system, amplification procedure, and genotyping method were consistent with those in Example 2. The detection results are as follows: Figure 3 As shown, the tested material has a C / T mutation at position 664808074 on chromosome 1B, resulting in two different haplotypes: ① Haplotype I (HAP I) has a FSNP locus (position 664808074 on chromosome Chr1B) of "C / C".

[0033] ② Haplotype II (HAP II) has a FSNP locus (position 664808074 on chromosome Chr1B) of “T / T”.

[0034] Table 3. Names, genotypes, and haplotypes of wheat tested.

[0035] Note: "KASP" represents genotyping using the KASP molecular marker developed in this invention.

[0036] (2) Correlation analysis of SDS-sedimentation value and thousand-grain weight among different haplotype varieties The tested population was planted and harvested under uniform conditions at the Yangzhou University experimental base. The laboratory had previously measured the thousand-grain weight and SDS-sedimentation value of wheat from the middle and lower reaches of the Yangtze River in 2024.

[0037] The haplotype data (HAP I and HAP II) detected by KASP markers were jointly statistically analyzed with wheat thousand-grain weight and SDS-sedimentation value phenotypic data. The results are shown in Table 4. Figure 4 As shown, the target site of this invention exhibits a highly significant "one cause, multiple effects" characteristic, specifically manifested as follows: As shown in Table 4 (Student's t-test), the wheat population carrying the superior haplotype HAP I had a significantly higher thousand-grain weight (48.70 g) than the population carrying HAP II (45.81 g). P <0.01); meanwhile, the SDS-sedimentation value of HAP group I (20.91 mL) was also significantly higher than that of HAP group II (19.22 mL,P <0.05). This fully confirms that HAP Ⅰ, defined by this KASP molecular marker, is an excellent haplotype that synergistically enhances wheat yield and quality.

[0038] Table 4. Statistical analysis of the synergistic effect of wheat thousand-grain weight and SDS-sedimentation value on different haplotypes in the tested population.

[0039] Note: * indicates a difference at a significance level of 0.05, and ** indicates a difference at a significance level of 0.01.

[0040] In the normal physiological development of wheat, the increase in thousand-grain weight usually leads to an increase in starch and dilutes gluten protein (i.e., yield and quality are negatively correlated); however, the superior allelic variant of HAP Ⅰ screened in this invention successfully breaks this "protein dilution effect" and achieves a dual-effect simultaneous improvement of large grains (high yield potential) and strong gluten (high SDS-sedimentation value).

[0041] The above embodiments demonstrate that the KASP molecular markers developed in this invention possess accuracy and pleiotropic diagnostic characteristics in the synergistic identification of wheat thousand-grain weight and SDS-sedimentation value. This detection method features high throughput, low cost, accurate genotyping, and standardization, making it suitable for molecular screening of large-scale germplasm resources and early-generation segregating populations in modern wheat breeding. This technology provides an early genotyping diagnostic scheme that is independent of harvest-time phenotypes and unaffected by environmental interactions (G×E), facilitating the simultaneous pre-selection of individuals with high thousand-grain weight and high SDS-sedimentation value potential during the seedling stage. This molecular tool can be used to directionally aggregate superior haplotypes with other economic traits, providing a technical means for the breeding process of synergistic improvement of wheat yield and quality.

[0042] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0043] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0044] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. The application of a haplotype HAP I that synergistically regulates the thousand-grain weight and SDS-sedimentation value of wheat in wheat breeding, characterized in that, The haplotype HAP I has a C base at position 664808074 on wheat chromosome 1B.

2. A KASP molecular marker primer set for the synergistic or auxiliary identification of haplotype HAP I as described in claim 1, characterized in that, include: The nucleotide sequences of the forward competitive primer KASP-F1 (SEQ ID NO. 6), the nucleotide sequences of the forward competitive primer KASP-F2 (SEQ ID NO. 7), and the nucleotide sequences of the reverse universal primer KASP-R (SEQ ID NO. 3) are shown.

3. The application of the KASP molecular marker primer set as described in claim 2 in the simultaneous or auxiliary identification of wheat thousand-grain weight and SDS-sedimentation value.

4. The application according to claim 3, characterized in that, The identification method includes the following steps: 1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the primer set described in claim 2 to obtain the amplification product; 2) Scan the amplification products for fluorescence signals and observe the genotyping cluster diagram: If the fluorescence signal is blue, the genotype of the wheat being tested at this locus is determined to be CC, belonging to the HAP I haplotype; if the fluorescence signal is red, the genotype of the wheat being tested at this locus is determined to be TT, belonging to the HAP II haplotype. 3) If the wheat to be tested is determined to be of the HAP I haplotype, it is considered that the wheat has both high thousand-grain weight potential and high SDS-sedimentation value potential.

5. The application according to claim 4, characterized in that, In step 1), the PCR amplification method is as follows: The PCR amplification reaction system is 10 μL, including: 2 μL of genomic DNA at a concentration of 120 ng / μL, 5 μL of 2×KASP Master Mix, 0.15 μL of KASP Assay Mix, and 2.85 μL of ddH2O; wherein, the KASP Assay Mix is ​​prepared as follows: every 100 μL of KASP Assay Mix contains 12 μL each of two forward competitive primers at a concentration of 100 μM, 30 μL of reverse universal primers at a concentration of 100 μM, and 46 μL of ddH2O to make up the difference; The PCR amplification reaction program is as follows: 1) Activation at 94℃ for 15 min; 2) Denaturation at 94℃ for 20 s, annealing and extension at 68℃~62℃ for 60 s, 10 touch-down cycles, each cycle decreasing by 0.6℃; 3) Denaturation at 94℃ for 20 s, annealing and extension at 62℃ for 60 s, 28 conventional cycles.