A method for inhibiting the growth of eucalyptus with a virus of the genus filovirus and applications

By inoculating Mikania plants with a virus of the genus Cervus, a virus infection model and screening platform were established, solving the problem of high control costs for Mikania and achieving effective inhibition of Mikania growth and screening of virus resources.

CN122397520APending Publication Date: 2026-07-17AGRI GENOMICS INST CHINESE ACADEMY OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610846605.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-12
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

Current technologies lack methods to use viruses of the genus *Mikania* to infect and inhibit the growth of *Mikania micrantha*, resulting in high costs for *Mikania micrantha* control and limited application in ecologically sensitive areas.

Method used

By inoculating Mikania micrantha plants with viruses of the genus Cervus, such as rice stripe virus (RSV), and using methods such as insect feeding and mechanical inoculation to infect them, and by detecting viral nucleic acid or protein to determine the growth status, a Mikania micrantha virus infection model and a platform for screening candidate factors for virus control were established.

Benefits of technology

Effective inhibition of Mikania micrantha growth was achieved, and a virus infection system was established for screening virus resources with growth inhibition and reproduction blocking effects, supporting research on the prevention and control of Mikania micrantha.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122397520A_ABST
    Figure CN122397520A_ABST
Patent Text Reader

Abstract

This invention relates to the field of biocontrol technology, specifically to a method and application for inhibiting the growth of *Mikania micrantha* using a *Cervone* virus. The method includes: using *Mikania micrantha* plants as recipient material, inoculating the plants with a *Cervone* virus; culturing the inoculated plants, collecting leaves during the cultivation process; and examining the collected leaves to determine the growth status of the *Mikania micrantha* plants. This invention, by using a *Cervone* virus to infect *Mikania micrantha*, can inhibit its growth, which is beneficial for establishing a *Mikania micrantha* virus infection model and a platform for screening candidate factors for virus control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biocontrol technology, specifically to a method and application of using a virus of the genus *Mikania* to inhibit the growth of *Mikania micrantha*. Background Technology

[0002] Mikania micrantha is a highly damaging invasive alien plant characterized by its rapid growth, strong climbing ability, extensive ground cover, and high reproductive capacity, which can severely impact farmland, woodlands, and ecosystems. Current control methods mainly include manual removal, mechanical cutting, and chemical herbicide treatment. However, manual labor is costly and prone to regeneration, and the application of chemical herbicides is limited in ecologically sensitive areas, farmland edges, and around water sources.

[0003] Plant viruses can systemically infect host plants and may affect their growth, development, and reproduction. Rice stripe virus (RSV) belongs to the genus *Fraginovirus* and is primarily transmitted by planthoppers under natural conditions. There are currently no reports on using *Fraginovirus* viruses to infect *Mikania micrantha* and inhibit its growth; therefore, a technical system for evaluating virus infection in *Mikania micrantha* and screening candidate factors for virus control is lacking. Summary of the Invention

[0004] In view of this, the present invention provides a method and application for inhibiting the growth of Mikania micrantha using viruses of the genus Cirrhosa. By infecting Mikania micrantha with viruses of the genus Cirrhosa, the growth of Mikania micrantha can be inhibited, which is beneficial for establishing a virus infection model of Mikania micrantha and a screening platform for candidate factors for virus prevention and control.

[0005] In a first aspect, the present invention provides a method for inhibiting the growth of Mikania micrantha using a virus of the genus Cervus, comprising: inoculating the Mikania micrantha plant with a virus of the genus Cervus using the Mikania micrantha plant as the recipient material; The inoculated Mikania plants were then cultured, and leaves were collected during the culture process. The collected leaves were examined to determine the growth status of the Mikania micrantha plant.

[0006] As described above, in the process of inoculating the fibrillocyte virus into Mikania plants, the inoculation method includes at least one of insect-borne inoculation, mechanical inoculation, and spraying.

[0007] As described above, the fibrillviruses include rice stripe virus (RSV) or fibrillviruses with the same or similar infectivity characteristics as RSV.

[0008] As described above, during the process of collecting leaves during the cultivation of the Mikania micrantha plant, the leaves include old leaves or new leaves of the Mikania micrantha plant.

[0009] As described above, during the detection process, viral nucleic acid detection or viral protein detection is performed.

[0010] As described above, during the detection process, at least one of the following is detected: capsid protein gene of a fibrillaviridae virus, viral RNA, fibrillaviridae virus replication-related gene, and fibrillaviridae virus-specific protein.

[0011] As described above, in the process of judging the growth status of the Mikania micrantha plant, the growth indicators, leaf phenotype, vine elongation rate, flowering and fruiting ability, and seed formation ability of the Mikania micrantha plant are used to judge the growth status of the Mikania micrantha plant.

[0012] As described above, the method further includes determining that the growth of the Mikania micrantha plant is inhibited by a fibrillvirus when the plant's growth is hampered, its reproductive capacity is reduced, and its risk of spread is reduced.

[0013] Secondly, the present invention provides an infection system comprising a processing module for performing the method described above for inhibiting the growth of Mikania micrantha using a virus of the genus Cervus.

[0014] Thirdly, the present invention provides an application of the method described above, or the infection system described above, in the study of the infection mechanism of Mikania micrantha virus, the screening of candidate factors for Mikania micrantha biocontrol, the study of the antiviral response mechanism of Mikania micrantha, or the verification of gene function of Mikania micrantha.

[0015] The present invention, employing the above-described solution, has at least the following beneficial effects: In this application, by using viruses of the genus *Mikania micrantha* to infect *Mikania micrantha*, this infection method can not only inhibit the growth of *Mikania micrantha* plants, but also establish a *Mikania micrantha* virus infection system. The establishment of this system can be used to screen viral resources that have potential growth inhibition, reproduction blocking, or spread control effects on *Mikania micrantha*, and can also be used to establish a platform for studying *Mikania micrantha* virus-induced gene silencing, antiviral response analysis, and invasion mechanism research, thereby providing new support for the prevention and control of *Mikania micrantha*. Attached Figure Description

[0016] This application can be further illustrated by the non-limiting embodiments given in the accompanying drawings.

[0017] Figure 1 The phenotype of Mikania micrantha 10 days after inoculation of the planthopper with RSV in this application; Figure 2 The results of RSV CP protein accumulation detection in Mikania micrantha 10 days after inoculation of planthoppers with RSV in this application; Figure 3 The phenotype of Mikania micrantha 14 days after inoculation of the planthopper with RSV in this application; Figure 4 The results of RSV CP protein accumulation detection in Mikania micrantha 14 days after inoculation of planthoppers with RSV in this application; Figure 5 The phenotype of *Tobacco Bunge* plants artificially inoculated with RSV for 10 days in this application; Figure 6 The phenotype of Mikania micrantha plant after artificial inoculation with RSV for 10 days in this application; Figure 7 This application describes the RT-qPCR detection of RSV CP transcript expression in Mikania micrantha 10 days after RSV inoculation. Figure 8 This application uses Western blot to detect RSV CP protein accumulation 10 days after RSV inoculation; Figure 9 The phenotype of *Nicotiana benthamiana* plants artificially inoculated with RSV for 14 days in this application; Figure 10 The phenotype of Mikania micrantha plant artificially inoculated with RSV 14 days prior to this application; Figure 11 This application describes the RT-qPCR detection of RSV CP transcript expression in Mikania micrantha 14 days after RSV inoculation. Figure 12 This application uses Western blot to detect RSV CP protein accumulation 14 days after RSV inoculation; Figure 13 The phenotype of Mikania micrantha plant artificially inoculated with RSV 21 days prior to this application; Figure 14 This application uses Western blot to detect RSV CP protein accumulation 21 days after RSV inoculation. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with specific embodiments. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0019] To improve the control of the invasive plant Mikania micrantha, the inventors researched control methods and approaches. They found that existing control methods for Mikania micrantha mainly include manual removal, mechanical cutting, and chemical herbicide treatment. However, manual labor is costly and prone to regeneration, and the application of chemical herbicides is limited in ecologically sensitive areas, farmland edges, and around water sources.

[0020] The inventors discovered that by infecting Mikania micrantha with viruses of the genus Filivir in plant viruses, they were able to inhibit the growth of Mikania micrantha. This infection method can establish a virus infection model for Mikania micrantha and a platform for screening candidate factors for virus control.

[0021] In view of this, in a first aspect, embodiments of this application propose a method for inhibiting the growth of Mikania micrantha using a virus of the genus Cervone, comprising: using Mikania micrantha plants as recipient materials, inoculating the Mikania micrantha plants with a virus of the genus Cervone; The inoculated Mikania plants were then cultured, and leaves were collected during the culture process. The collected leaves were tested to determine the growth status of the Mikania plants.

[0022] By inoculating Mikania micrantha plants with a virus of the genus Fragariae, the virus accumulated within the plants and spread as the plants grew. Leaf samples were collected and analyzed to determine the amount of virus accumulation and to monitor the plant's growth. The results showed that the virus could inhibit the growth of Mikania micrantha.

[0023] In one embodiment of the present invention, during the process of inoculating a Fibrovirus into a Mikania plant, the inoculation method includes at least one of insect-borne inoculation, mechanical inoculation, and spraying.

[0024] In one specific implementation, insect-borne inoculation involves feeding Mikania micrantha with insects carrying viruses of the genus Cervus, allowing the Cervus virus to enter the Mikania micrantha plant through insect feeding.

[0025] Understandably, the insects that transmit the virus include at least one of the following: the gray planthopper, the brown planthopper, and the Philippine corn planthopper; the gray planthopper is preferred. Inoculating Mikania micrantha with the food of the gray planthopper allows for the transmission of Fibrovirus viruses into Mikania micrantha.

[0026] In one specific embodiment, mechanical inoculation includes at least one of friction inoculation, needle inoculation, grafting inoculation, and phloem injection. In this embodiment, a fibrillvirus is inoculated onto Mikania micrantha using friction inoculation.

[0027] In this embodiment, during friction inoculation, a crude extract of a virus containing a virus of the genus *Mikania* is applied to the surface of *Mikania micrantha* leaves, and the virus is introduced into the *Mikania micrantha* leaf tissue through mechanical friction.

[0028] In one embodiment of the present invention, the fibrillviruses include rice stripe virus (RSV) or fibrillviruses that have the same or similar infectivity characteristics as rice stripe virus (RSV).

[0029] Understandably, viruses of the genus Cilivirus that have the same or similar infectivity characteristics as rice stripe virus (RSV) include maize stripe virus (MSpV) and rice straw dwarf virus (RGSV).

[0030] In this embodiment, the preferred virus is rice stripe virus (RSV). By using planthoppers to transmit RSV, the virus can be effectively inoculated onto Mikania micrantha.

[0031] In one embodiment of the present invention, during the collection of leaves during the cultivation of Mikania micrantha plants, the leaves include both old and new leaves of the Mikania micrantha plant. It is understood that after a period of cultivation, the old or new leaves of Mikania micrantha may carry viruses of the genus *Cyclovir*, which can be effectively detected in subsequent testing. In practice, petioles, stems, etc., of Mikania micrantha can also be collected for subsequent testing.

[0032] In one embodiment of the present invention, viral nucleic acid detection or viral protein detection is performed during the detection process. By performing viral nucleic acid detection or viral protein detection on parvoviruses, parvoviruses can be effectively detected, and the accumulation or distribution of parvoviruses in Mikania micrantha can be determined.

[0033] In one specific implementation, nucleic acid testing can be performed using one or more of RT-PCR, RT-qPCR, digital PCR, or nucleic acid hybridization detection.

[0034] In one specific implementation, when detecting viral proteins, one or more of the following methods can be used: Western blot, ELISA, immunoblotting, immunofluorescence, or colloidal gold detection.

[0035] Understandably, the testing process involves detecting at least one of the following: capsid protein gene, viral RNA, replication-related genes, and specific proteins of the genus *Mikania*. By detecting these genes, the cumulative amount, activity, and distribution of *Mikania* can be determined, thus confirming the presence of *Mikania* within *Mikania micrantha*.

[0036] In one embodiment of the present invention, the growth status of Mikania micrantha plants is assessed using growth indicators, leaf phenotype, vine elongation rate, flowering and fruiting capacity, and seed formation capacity. By determining whether these indicators have decreased, it is possible to determine whether a cytomegalovirus has inhibited the growth of Mikania micrantha.

[0037] Understandably, when the growth of Mikania plants is hampered, their reproductive capacity is reduced, and the risk of spread is lowered, the growth of Mikania plants is inhibited by fibrillviruses.

[0038] Secondly, the present invention provides an infection system comprising a processing module. The processing module is used to perform the method described above for inhibiting the growth of *Mikania micrantha* using a *Fragariae* virus.

[0039] Understandably, the processing module can include inoculation machinery, incubators (culture chambers), and testing equipment. Among these, the inoculation machinery, incubators (culture chambers), and testing equipment are all existing technologies. Alternatively, appropriate equipment can be selected based on the specific circumstances to implement the method of inhibiting the growth of Mikania micrantha using viruses of the genus *Cervus*.

[0040] Thirdly, the present invention provides a method for inhibiting the growth of Mikania micrantha using a virus of the genus Fibrillovirus as described above, or the application of the above-described infection system in the study of the virus infection mechanism of Mikania micrantha, the screening of candidate factors for biocontrol of Mikania micrantha, the study of the antiviral response mechanism of Mikania micrantha, or the verification of gene function of Mikania micrantha.

[0041] The following specific examples illustrate how viruses of the genus *Cervus* inhibit the growth of *Mikania micrantha*: Example 1 Insect-borne inoculation establishes Mikania micrantha RSV infection Uniformly grown (3-4 weeks old) Mikania micrantha seedlings were selected as recipient materials. Non-toxic planthoppers were used as negative controls, and planthoppers carrying RSV were used as treatment groups. Each Mikania micrantha plant was inoculated with planthoppers and then bagged for isolation, allowing them to feed on the plants continuously for 24-48 hours. After feeding, the planthoppers were removed. Plants treated with non-toxic planthoppers served as mock controls, and plants treated with planthoppers carrying RSV served as the RSV treatment group.

[0042] After inoculation, *Mikania micrantha* was further cultured in an artificial climate chamber or isolation culture room under the following conditions: 26±1℃, relative humidity 60±5%, and light / dark cycle of 11 h / 13 h. Inoculated leaves and newly emerging leaves above them were collected at 10 and 14 days post-inoculation for phenotypic observation and virus detection.

[0043] Culture results as follows Figure 1 and Figure 3 As shown; from Figure 1 It was found that 10 days after inoculation, compared with the Mock control, the RSV-treated group of Mikania micrantha showed stunted growth, with both old and new leaves exhibiting varying degrees of leaf color lightening or chlorophyll loss; from Figure 3 It can be seen that 14 days after inoculation, the yellowing or chlorosis of the new leaves in the treatment group was further aggravated, indicating that RSV can affect the normal vegetative growth of Mikania micrantha after inoculation by planthoppers.

[0044] Leaves of Mikania micrantha were collected 10 and 14 days after inoculation. Total protein was extracted from the leaves using a plant total protein extraction buffer (components: 3 mL 5 M NaCl, 250 μL 1 M MgCl2, 1 mL 1 M Tris-HCl (pH 7.5), 250 μL 1 M DTT, 1.5 mL 10% Tween, 500 μL 100× protease inhibitor, and ddH2O to a final volume of 50 mL). Approximately 0.1 g of the leaves to be tested were ground into powder in liquid nitrogen, and then lysed thoroughly in pre-cooled plant total protein extraction buffer (4 ℃). After being placed on ice for 30 min, the mixture was centrifuged at 4 ℃ and 12000 rpm for 15 min, and the supernatant was used as the total protein sample.

[0045] An equal volume of supernatant was added to 5×SDS-PAGE loading buffer and denatured at 100 °C for 5 min. The sample was then loaded onto an SDS-PAGE gel for electrophoresis. After electrophoresis, the protein was transferred to a PVDF membrane. The PVDF membrane was blocked with 5% skim milk powder at room temperature for 1 h, then incubated overnight at 4 °C with RSV CP-specific primary antibody. After washing the membrane three times with TBST, HRP-labeled secondary antibody was added and incubated at room temperature for 1 h. After washing again, ECL chemiluminescence solution was added for color development. The RSV CP-specific bands were observed using a chemiluminescence imaging system to determine the expression of RSV CP protein in the sample. The Rubisco large subunit staining band was used as a reference for loading volume and protein transfer quality.

[0046] Test results as follows Figure 2 and Figure 4 As shown. From Figure 2 It was found that RSV CP-specific bands were detected in the RSV treatment group 10 days after inoculation, while no corresponding bands were detected in the Mock control, indicating that RSV can enter and infect Mikania micrantha through feeding on planthoppers; from Figure 4 It was found that RSV CP bands were still detectable in the RSV-treated group 14 days after inoculation, and the signal was stronger than that at 10 days, indicating that RSV could continue to accumulate in Mikania micrantha. Rubisco bands were detectable in both the Mock group and the RSV-treated group and were generally similar, indicating that the sample loading in each lane was basically the same. Therefore, the difference in RSV CP signal mainly reflects the difference in virus accumulation.

[0047] Example 2 Establishment of Mikania micrantha RSV infection through artificial friction inoculation Crude extracts of the genus *S. parvum* were prepared from infected plant material. Infected leaves were ground and filtered in 0.01 mol / L phosphate-buffered saline (PBS, pH 7.0) at a ratio of 1:5 to 1:10 (g / mL) to obtain the crude virus extract. The crude virus extract was applied to the surface of *Mikania micrantha* leaves and mechanically abraded with a small amount of carborundum to induce virus entry into the leaf tissue. Treatment with the same volume of phosphate-buffered saline served as a mock negative control, and *Nicotiana benthamiana* served as a positive control for mechanical RSV inoculation.

[0048] After inoculation, the plants were cultured at 26±1℃, relative humidity of 60±5%, and light / dark cycle of 11 h / 13 h. Inoculated leaves and newly grown leaves above them were collected at 10, 14 and 21 days after inoculation.

[0049] Culture results as follows Figure 5 , Figure 6 , Figure 9 , Figure 10 and Figure 13 As shown; from Figure 5It can be seen that the positive control of *Nyctalus benthamiana* showed RSV infection-related phenotypes 10 days after inoculation, indicating that the crude virus extract possesses infective activity; from Figure 6 It can be seen that the overall growth of Mikania micrantha differed from that of the Mock strain 10 days after inoculation; from Figure 9 and Figure 10 It can be seen that phenotypic differences between the treatment groups and the Mock control group were observed in both *Nicotiana benthamiana* and *Mikania micrantha* 14 days after inoculation; from Figure 13 It can be seen that 21 days after inoculation, the Mikania micrantha treatment group still showed suppressed growth or yellowing of leaves, indicating that artificial friction inoculation can be used to establish an evaluation system for Mikania micrantha RSV infection.

[0050] The leaves were subjected to RT-qPCR and Western blot analysis. For RT-qPCR, total RNA was extracted using a plant total RNA extraction kit (RNAprep Pure Plant Total RNA Extraction Kit, manufacturer: TIANGEN, catalog number: DP432). After removing genomic DNA, cDNA was obtained by reverse transcription (HiScript III All-in-one RT SuperMix Perfect for qPCR Kit, manufacturer: Novizan, catalog number: R333). The RSV CP gene was used as the target gene for quantitative real-time PCR detection (SupRealQ Purple Universal SYBR qPCR MasterMix (U+) Kit, manufacturer: Novizan, catalog number: Q412), with the Mikania micrantha EF1a internal reference gene used as a calibration reference.

[0051] The nucleotide sequence of RSV-CP-qR is: AGTGCTGATCGTATTGACAGA (SEQ ID No. 1); the nucleotide sequence of RSV-CP-qF is: GATGAAGTACACAACTGGTC (SEQ ID No. 2); the nucleotide sequence of EF1a-F is: TGAGCCCAAGAGACCATCAGA (SEQ ID No. 3); and the nucleotide sequence of EF1a-R is: GGTGCATCTCAACAGACTTGAC (SEQ ID No. 4). During Western blot analysis, the accumulation of RSV CP protein was detected following the steps outlined in Example 1: total protein extraction, SDS-PAGE, electroporation, RSV CP antibody incubation, and color development.

[0052] Test results as follows Figure 7 , Figure 8 , Figure 11 , Figure 12 and Figure 14 As shown; from Figure 7 It was found that RSV CP transcripts could be detected in Mikania micrantha 10 days after inoculation, indicating that RSV could be detected at the RNA level; from Figure 8 It was found that RSV CP protein bands were detected in the RSV-treated group 10 days after inoculation, while no corresponding bands were detected in the mock control, indicating that RSV can accumulate at the protein level in Mikania micrantha; from Figure 11 and Figure 12 It was found that RSV CP transcripts and proteins were detectable in the Mikania micrantha treatment group 14 days after inoculation, indicating that RSV can persist in Mikania micrantha; from Figure 14 It was found that RSV CP protein accumulation could still be detected 21 days after inoculation, further indicating that artificial friction inoculation can maintain RSV accumulation in Mikania micrantha for a longer period of time.

[0053] Example 3 Screening and evaluation methods and applications of Mikania micrantha as a candidate for virus control or candidate viral vectors Cellular virus materials obtained from different sources, with different virulence levels, or with different inoculation treatments were inoculated into Mikania micrantha to screen for candidate control viruses or candidate viral vectors that could stably infect Mikania micrantha and affect its growth or reproduction.

[0054] Among them, viral materials from different sources include viral materials carried by virus-transmitting insects, crude virus extracts prepared from leaves of susceptible plants, and viral materials obtained through molecular cloning; viral materials with different virulence levels include highly pathogenic strains, weakly pathogenic strains, or viral materials with different pathogenicities after continuous passage; and different inoculation treatment methods include insect-borne inoculation, mechanical friction inoculation, needle pricking inoculation, or spraying inoculation.

[0055] Inoculation sites can be selected from unfolded leaves, young stem segments, or the junction of stem and leaf. After inoculation, virus accumulation and phenotypic changes in *Mikania micrantha* can be detected at 10, 14, 21 days, or longer culture periods. Virus accumulation can be detected by RT-qPCR, Western blot, or ELISA; phenotypic indicators include leaf yellowing, curling, chlorosis, necrosis, vine elongation rate, internode length, number of branches, number of flowers, number of seeds, and seed germination rate.

[0056] Based on the positive accumulation of viral CP transcripts / proteins, the stable infectivity of the virus in Mikania micrantha, and the significant reduction in growth vigor, vegetative growth, or reproductive capacity of Mikania micrantha after inoculation compared to the Mock control, candidate viruses or viral vectors for control were screened. These candidate viruses or viral vectors can be used for subsequent research on growth inhibition, pathogenicity evaluation, viral vector modification, exogenous fragment delivery, or targeted interference with key growth genes of Mikania micrantha, providing a material basis for the development of biocontrol technologies for Mikania micrantha.

[0057] The candidate viruses or viral vectors obtained through screening can be used for the development of biocontrol materials for Mikania micrantha, viral vector modification, targeted gene interference, pathogenicity evaluation, and safety evaluation. Specifically, candidate viruses can serve as biocontrol candidates for inhibiting the growth or reproduction of Mikania micrantha, and their inhibitory effects on processes such as vine elongation, internode elongation, branching, flowering, fruiting, and seed germination can be evaluated. Candidate viral vectors can serve as exogenous fragment delivery or targeted fragment expression vectors to silence or interfere with key genes related to growth, hormone synthesis, sugar metabolism, or reproduction in Mikania micrantha, thereby screening for control targets. Simultaneously, candidate viruses or viral vectors can also be used to analyze their stable infectivity, systemic diffusion capacity, pathogenic phenotype, and potential effects on non-target plants within Mikania micrantha, providing a material basis for developing virus-mediated biocontrol technologies and integrated control strategies for Mikania micrantha.

[0058] In this application, the Fibrovirus infection system is mainly used for the evaluation of Mikania virus infection, screening of candidate control factors, and gene function research under facility conditions, isolation conditions, or approved controlled environments; any release, propagation, or application in the natural environment shall comply with relevant management requirements for biosafety, quarantine, and prevention and control of invasive alien species.

[0059] The above provides a detailed description of a method and application for inhibiting the growth of Mikania micrantha using a virus of the genus Cirrhosa. The specific embodiments described are merely for the purpose of helping to understand the method and core ideas of this invention. It should be noted that those skilled in the art can make various improvements and modifications to this invention without departing from its principles, and these improvements and modifications also fall within the scope of protection of the claims of this invention.

[0060] It should be noted that: for experimental steps or conditions not specified in the examples, the procedures and conditions described in conventional experimental procedures in the literature of this art can be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.

[0061] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for inhibiting the growth of Mikania micrantha using a virus of the genus Cervus, characterized in that, include: Using Mikania plants as recipient materials, Fibrinoviruses were inoculated into Mikania plants; The inoculated Mikania plants were then cultured, and leaves were collected during the culture process. The collected leaves were examined to determine the growth status of the Mikania micrantha plant.

2. The method according to claim 1, characterized in that, In the process of inoculating the fibrillosa virus into Mikania plants, the inoculation method includes at least one of insect-borne inoculation, mechanical inoculation, and spraying.

3. The method according to claim 1 or 2, characterized in that, The fibrillviruses include rice stripe virus (RSV), or fibrillviruses with the same or similar infectivity characteristics as RSV.

4. The method according to claim 1 or 2, characterized in that, During the process of collecting leaves during the cultivation of the Mikania micrantha plant, the leaves include old leaves or new leaves of the Mikania micrantha plant.

5. The method according to claim 1 or 2, characterized in that, During the aforementioned testing process, viral nucleic acid testing or viral protein testing is performed.

6. The method according to claim 5, characterized in that, During the detection process, at least one of the following is detected: capsid protein gene of fibrillaviridae viruses, viral RNA, fibrillaviridae virus replication-related genes, and fibrillaviridae virus-specific proteins.

7. The method according to claim 1 or 2, characterized in that, In assessing the growth status of the Mikania plants, the growth indicators, leaf phenotype, vine elongation rate, flowering and fruiting ability, and seed formation ability of the Mikania plants are used to determine their growth status.

8. The method according to claim 7, characterized in that, The method further includes determining that the growth of the Mikania micrantha plant is inhibited by a fibrillvirus when the plant's growth is hampered, its reproductive capacity is reduced, and its risk of spread is reduced.

9. An infection system, characterized in that, The infection system includes a processing module for performing the method for inhibiting the growth of Mikania micrantha using a virus of the genus Cirrhosa as described in any one of claims 1-8.

10. The method described in any one of claims 1-8, or the infection system described in claim 9, is used in the study of the infection mechanism of Mikania micrantha virus, the screening of candidate factors for biocontrol of Mikania micrantha, the study of the antiviral response mechanism of Mikania micrantha, or the verification of gene function of Mikania micrantha.