CircRNA vaccine for anti-infectious hematopoietic organ necrosis virus and construction method and application thereof

Abstract

The present application relates to a circRNA vaccine for anti-infectious hematopoietic necrosis virus, the circRNA vaccine is a covalently closed circular structure, comprising an internal ribosome entry site, a G protein sequence of the infectious hematopoietic necrosis virus, and a Kozak sequence located between the internal ribosome entry site and the G protein sequence of the infectious hematopoietic necrosis virus;The circRNA vaccine comprises a cyclization connection sequence formed by a fish tRNA Leu I type intron self-splicing;The internal ribosome entry site is one or more of the following: coxsackievirus 3 IRES, infectious pancreatic necrosis virus IRES, encephalomyocarditis virus IRES, Ythdc2 IRES, and hepatitis C virus IRES;The amino acid sequence of the G protein of the infectious hematopoietic necrosis virus has at least 90% sequence identity with the amino acid sequence encoded by SEQ ID NO. 1.

Description

Technical Field

[0001] This invention relates to the field of animal vaccines and veterinary biological products, and in particular to circRNA vaccines for combating infectious hematopoietic necrosis virus, their construction methods, and applications. Background Technology

[0002] Infectious hematopoietic necrosis (IHN) is a serious fish disease caused by the infectious hematopoietic necrosis virus (IHNV). This virus belongs to the Rhabdoviridae family and primarily infects cold-water fish such as rainbow trout (Oncorhynchus mykiss). Symptoms mainly include darkening of body color, bulging eyes, abdominal swelling, gill congestion, abnormal swimming, and internal bleeding. IHN has an extremely high mortality rate, especially in juvenile and fingerling stages, where mortality can reach 80% to 100%, with mass mortality typically occurring within 2 to 3 weeks after infection.

[0003] IHNV virus particles are bullet-shaped, approximately 45–100 nanometers in diameter and 100–430 nanometers in length. The virus consists of an envelope and a nucleocapsid, with its surface densely covered with spikes. Its genome is a non-segmented, negative-sense, single-stranded RNA, approximately 11,000 nucleotides in length, encoding six proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), nonviral protein (NV), and polymerase (L). Among these, glycoprotein (G) is the primary antigenic protein, capable of inducing a specific immune response in the host and playing a crucial role in viral infection, including recognizing and binding to host cell receptors. Therefore, glycoprotein (G) is the most important antigenic protein expressed in RNA vaccines.

[0004] In recent years, breakthroughs in RNA vaccine technology have brought revolutionary changes to infectious disease prevention and control. circRNA, as a next-generation RNA vaccine technology, exhibits high stability and sustained antigen expression capacity due to its covalently closed circular structure, which resists exonuclease degradation. It also possesses low inherent immunogenicity, thus being considered a highly promising vaccine technology platform. Compared to linear mRNA, circRNA can achieve more sustained antigen expression in vivo without nucleotide modification and avoids the frameshift risk associated with nucleotide modification, resulting in higher safety.

[0005] circRNA molecules are covalently closed circular molecules and lack the 5' mRNA cap-dependent translation required by eukaryotic mRNA. 7The G-cap structure relies entirely on the pre-positioned Internal Ribosome EntrySite (IRES) to directly recruit the 40S ribosomal subunit of the host cell. The three-dimensional RNA folding structure of the IRES and its recruitment activity for host cell translation initiation factors exhibit species-specific, temperature-sensitive, and cell-type-specific characteristics. Previous studies have proposed an immunoprotective strategy for sea bass using an infectious spleen and kidney necrosis virus (ISKNV) circRNA vaccine prepared based on T4 RNA ligase. This circRNA is translated via the IRES of encephalomyocarditis virus (EMCV). However, sea bass live in relatively high-temperature environments, while the host species targeted in this strategy, rainbow trout, is a typical cold-water salmonid, with its immunoprogression temperature typically set at 12–15°C. In such a low-temperature cellular physiological environment, there is no reliable theoretical model to predict whether IRES sequences from mammalian or ambient-temperature viral sources can effectively fold and maintain their ribosome recruitment activity. Therefore, animal experiments are needed to screen for effective IRES sequences. Furthermore, in this technical approach, the morbidity rate in the immunized group was only reduced by 20%–30% compared to the control group. When faced with large molecular antigen transcripts with complex secondary structures and sequence lengths exceeding 1.5 kb, the yield of circRNA prepared by T4 RNA ligase is low, and there is an urgent need to develop new circulation methods to improve circulation efficiency and increase yield. Summary of the Invention

[0006] To address the aforementioned problems in the prior art, this invention provides a circRNA vaccine for combating infectious hematopoietic necrosis virus, its construction method, and its application. This vaccine achieves more persistent antigen expression in vivo without nucleotide modification and exhibits good safety and efficacy for the prevention and treatment of infectious hematopoietic necrosis virus in rainbow trout.

[0007] To achieve the above objectives, a first aspect of the present invention provides a circRNA vaccine for combating infectious hematopoietic necrosis virus, characterized in that the circRNA vaccine has a covalently closed circular structure, including an internal ribosome entry site, a G protein sequence of infectious hematopoietic necrosis virus, and a Kozak sequence located between the internal ribosome entry site and the G protein sequence of infectious hematopoietic necrosis virus. The circRNA vaccine comprises a circularized linker sequence formed by self-splicing of the Leu I intron of the anemone tRNA; The internal ribosome entry site is one or more of the following: Coxsackievirus 3 IRES (sequence shown in SEQ ID NO. 7), infectious pancreatic necrosis virus IRES (sequence shown in SEQ ID NO. 8), encephalomyocarditis virus IRES (sequence shown in SEQ ID NO. 9), Ythdc2 IRES (sequence shown in SEQ ID NO. 10), and hepatitis C virus IRES (sequence shown in SEQ ID NO. 11); The amino acid sequence of the G protein of the infectious hematopoietic necrosis virus has at least 90% sequence identity with the amino acid sequence encoded by SEQ ID NO.1.

[0008] Preferably, the nucleotide sequence of the internal ribosome entry site is as shown in SEQ ID NO.7; the Kozak sequence is GCCACC.

[0009] Preferably, the circular linker of the circRNA vaccine is formed by a covalent bond between the 3' end of the G protein coding sequence and the 5' end of the internal ribosome entry site.

[0010] circRNA vaccines contain circRNA molecules and lipid nanoparticles to prevent or treat infectious hematopoietic necrosis virus (IHNV). These circRNA vaccines express an optimized immunogen of IHNV, specifically the IHNV G protein; they also initiate cap-independent translation of IRES within rainbow trout cells.

[0011] A second aspect of the present invention provides a method for constructing a circRNA vaccine against infectious hematopoietic organ necrosis virus, characterized in that the method comprises: (1) Provide a circRNA precursor, wherein the circRNA precursor comprises, from 5' to 3': a 5' EGS homologous fragment and an Anabaena tRNA. Leu Type I intron, 5' stem homolog, internal ribosome entry site, Kozak sequence, G protein sequence of infectious hematopoietic necrosis virus, 3' stem homolog and 3' EGS homolog; The internal ribosome entry site is one or more of the following: Coxsackievirus 3 (CVB3) IRES, Infectious Pancreatic Necrosis Virus (IPNV) IRES, Encephalomyocarditis Virus (EMCV) IRES, Ythdc2 IRES, and Hepatitis C Virus (HCV) IRES; The amino acid sequence of the G protein of the infectious hematopoietic necrosis virus has at least 90% sequence identity with the amino acid sequence encoded by SEQ ID NO.1; (2) Based on the aforementioned circRNA precursor, in vitro transcription is performed to obtain in vitro transcribed RNA; and (3) The RNA transcribed in vitro is self-splicing and circularized to form the circRNA vaccine.

[0012] Preferably, the 5' end EGS homologous fragment sequence is shown in SEQ ID NO.3, the 5' end stem homologous fragment sequence is shown in SEQ ID NO.4, the 3' end stem homologous fragment sequence is shown in SEQ ID NO.5, and the 3' end EGS homologous fragment sequence is shown in SEQ ID NO.6.

[0013] Preferably, the nucleotide sequence of the internal ribosome entry site is as shown in SEQ ID NO.7; the Kozak sequence is: GCCACC; The aforementioned anabaena tRNA Leu The nucleotide sequence of type I introns is shown in SEQ ID NO.2.

[0014] Preferably, the circRNA precursor includes an in vitro transcription promoter, preferably the T7 promoter.

[0015] Preferably, in vitro transcription is performed using T7 RNA polymerase.

[0016] Preferably, step (2) specifically includes: The circRNA precursor sequence was cloned into a vector to obtain the recombinant plasmid p-TRIC-IRES; p-TRIC-IRES was spliced ​​with the G protein sequence by homologous recombination to obtain the recombinant plasmid p-TRIC-IRES-G; p-TRIC-IRES-G fragments were recovered after p-TRIC-IRES-G enzyme digestion or p-TRIC-IRES-G fragments were obtained by PCR amplification using p-TRIC-IRES-G template. Using the p-TRIC-IRES-G fragment as a template, RNA was transcribed in vitro using T7 RNA polymerase, digested with DNase I to remove DNA, and the transcribed RNA was obtained.

[0017] Preferably, the in vitro transcribed RNA is generated via anthocyanin tRNA. Leu After type I intron self-splicing circularization, the linear RNA molecules are removed by treatment with RNase R to obtain the circRNA vaccine.

[0018] A third aspect of the invention provides the use of the described circRNA vaccine or the circRNA vaccine constructed by the described construction method in the preparation of a medicament for the prevention of infectious hematopoietic necrosis virus infection.

[0019] The circRNA vaccine for combating infectious hematopoietic necrosis virus provided by this invention, along with its construction method and application, has no safety risks due to integration into the genome, high biosafety, and can directly translate antigen proteins to induce an immune response without the need for transcription. It is structurally stable and resistant to degradation caused by RNase R enzymes and exonucleases. While possessing the advantages of mRNA vaccines, it can also compensate for the disadvantages of mRNA vaccines. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the structure of the circRNA precursor of the present invention.

[0021] Figure 2 This is a graph showing the circulation efficiency of G-circRNA in this invention; where lane M is the RNA molecular weight standard, lane 1 is the uncirculated circRNA precursor, lane 2 is the product after linear RNA RNase R digestion, lane 3 is the circulation reaction product, and lane 4 is the product after circRNA RNase R digestion.

[0022] Figure 3 The image shows the expression results of the G-circRNA vaccine of this invention in HEK293T and CHSE-214 cells.

[0023] Figure 4 Survival curves of rainbow trout challenged with infectious hematopoietic necrosis virus (IHHV) circRNA vaccine. Detailed Implementation

[0024] To more clearly describe the technical content of the present invention, the following description is provided in conjunction with specific embodiments.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0026] This study used Anabaena tRNA LeuTrans-splicing of type I introns was performed, and the G protein (amino acid sequence of the G protein is shown in SEQ ID NO. 4) on the surface of the IHNV isolate GS21 virus (deposited at the China Center for Type Culture Collection on July 10, 2024, strain accession number CCTCC NO: V202467) was selected as the target antigen. Based on the codon bias in rainbow trout protein translation, the antigen sequence was codon-optimized, and the optimized G protein antigen sequence was used as the CDS region of the circRNA vaccine. Encapsulating LNPs with the circRNA vaccine and immunizing rainbow trout with it further enhanced the immunoprotective effect.

[0027] The experimental materials involved in the following embodiments are: IHNV isolate GS21 (deposited at the China Center for Type Culture Collection (CCTCC) on July 10, 2024, strain accession number CCTCC NO: V202467) was isolated from diseased rainbow trout in Gansu Province. HEK293T and CHSE-214 cells and antigens were preserved in our laboratory. Untranslated regions and other sequences were synthesized by Beijing Qingke Company. mRNA in vitro transcription reagents were purchased from Novizan, and Lipofectamine 3000 (L3000001) transfection reagent was purchased from Thermo Fisher Scientific. Major reagents for Western blotting experiments were purchased from Beyotime International. His-tag Rabbit Polyclonal Antibody (R1207-2) was purchased from Huaan Biotechnology.

[0028] Example 1 Design of the circRNA vaccine of this invention The precursor circRNA is synthesized as follows, from 5' to 3': in vitro transcription promoter, 5' EGS homologous fragment, and Anabaena tRNA. Leu The structure of the circRNA precursor of this invention includes a type I intron, a 5' stem homologous fragment, an internal ribosome entry site (IRES), a Kozak sequence, a G protein sequence of infectious hematopoietic necrosis virus, a 3' stem homologous fragment, and a 3' EGS homologous fragment. A schematic diagram of the structure of the circRNA precursor of this invention is shown below. Figure 1 As shown.

[0029] The G protein of IHNV virus is its most important antigenic protein. Therefore, the CDS sequence containing the G protein was selected as the circRNA. The antigen expression unit sequence is shown in SEQ ID NO.1 and is derived from the IHNV virus G protein sequence.

[0030] To improve RNA circularization efficiency, *Anabaena tRNA* was selected. LeuThe type I introns undergo trans-splicing, and their nucleic acid sequence is shown in SEQ ID NO.2.

[0031] The EGS homologous fragment and stem homologous fragment are artificially designed base-complementary pairing elements. EGS contains 20 nucleotides, and stem contains 25 nucleotides. This architecture guides the spontaneous intramolecular base-complementary pairing of the circRNA precursor through the EGS and stem homologous fragments at both ends, greatly reducing the spatial distance of the splice site and significantly improving the structural stability of the RNA precursor and the final circumduction efficiency. The 5' EGS homologous fragment is GGUCAAUCAGUUGGCUUCCG (SEQ ID NO.3), and the 3' EGS homologous fragment is (SEQ ID NO.4); the 5' stem homologous fragment is TCCGTAGCGT CTCGCCGGTAACGCA (SEQ ID NO.5), and the 3' stem homologous fragment is TGCGTTACCGGCGAG ACGCTACGGA (SEQ ID NO.6); at the same time, a Kozak sequence is added after the IRES sequence, and the Kozak sequence is GCCACC.

[0032] The internal ribosome entry sites (IRES) selected from the following sequences: Coxsackievirus 3 (CVB3) IRES as shown in SEQ ID NO. 7, Infectious Pancreatic Necrosis Virus (IPNV) IRES as shown in SEQ ID NO. 8, Encephalomyocarditis Virus (EMCV) IRES as shown in SEQ ID NO. 9, Ythdc2 IRES as shown in SEQ ID NO. 10, and Hepatitis C Virus (HCV) IRES as shown in SEQ ID NO. 11. CVB3 and EMCV IRES sequences are commonly used IRES sequences in mammals; IPNV mainly infects juvenile salmon and trout, and the IPNV IRES is selected from the 5'UTR region of rainbow trout-derived IPNV; the Ythdc2 IRES is predicted from endogenous Ythdc2 circRNA in rainbow trout; and the HCV IRES is selected from the 5'UTR and part of the CDS region of HCV. This invention constructs circRNAs containing different IRES and compares their immunoprotective effects in rainbow trout, thereby screening for circRNAs with the best translation initiation effect in rainbow trout.

[0033] Construction of p-TRIC-IRES-G plasmid Based on the above design, the pVAX1 plasmid was selected as the vector, and Beijing Qingke Company synthesized the circRNA, with the 5' end consisting of an in vitro transcription promoter, a 5' EGS homologous fragment, and Anabaena tRNA. LeuThe plasmid consists of a type I intron, a 5' stem homologous fragment, an internal ribosome entry site (IRES), a Kozak sequence, and two 3' stem and EGS homologous fragments. The IRES are categorized into six types: no IRES, CVB3 IRES, HCV IRES, IPNV IRES, EMCV IRES, and Ythdc2 IRES. These six plasmids are identical except for the IRES sequence, and are collectively referred to as p-TRIC-IRES. The IHNV viral genome was amplified using primer pair F1 / R1 to obtain the G protein sequence with terminal homologous arms. Simultaneously, the p-TRIC-IRES plasmid was linearized using primers F2 / R2, R3, R4, R5, R6, and R7. The two resulting fragments were ligated using terminal homologous complementation to obtain the p-TRIC-IRES-G plasmid.

[0034] Example 2 Preparation and protein expression identification of G-circRNA Preparation of G-mRNA The template for G-mRNA is derived from the linear mRNA vaccine plasmid pVAX1-G preserved in the laboratory. It is linearized using XbaI and transcribed in vitro using T7 RNA polymerase to generate mRNA, denoted as G-mRNA, which is used as a positive control for G-circRNA.

[0035] Preparation of G-circRNA The six p-TRIC-IRES-G plasmids were linearized according to the above method to prepare G-circRNA precursors. Then, the DNA template was digested with DNase I, GTP was added to perform a circularization reaction, and then purified RNA was obtained by ethanol precipitation.

[0036] The purified in vitro transcribed RNA was digested with RNase R to remove linear RNA from the circRNA, and the circRNAs were named IRES-G-circRNA, CVB3-G-circRNA, HCV-G-circRNA, IPNV-G-circRNA, EMCV-G-circRNA, and Ythdc2-G-circRNA, respectively.

[0037] Agarose gel electrophoresis was used to calculate the grayscale values ​​of G-circRNA before and after digestion using ImageJ, and the circularization efficiency of G-circRNA was calculated. The circularization efficiency of G-circRNA was found to be 81.8%. Figure 2 As shown.

[0038] Finally, purified G-circRNA was obtained by LiCl precipitation.

[0039] Western blotting analysis: 24 hours before transfection, HEK293T and CHSE-214 cells were seeded in 24-well plates. When the cells reached 60-70% confluence, the medium in the plates was replaced with serum-free medium. The transfection system was prepared according to the transfection reagent instructions. Each well in the experimental group was transfected with 1 μg of G-circRNA, and each well in the control group was transfected with 1 μg of G-mRNA. Six hours after transfection, the medium was replaced with medium containing 10% serum, and the cells were incubated statically. Cell samples were collected 24 hours after transfection and analyzed by Western blotting and 6-cell immunofluorescence assay. His-tag rabbit antibody detection of G antigen expression.

[0040] The expression of the G-circRNA of the present invention in HEK293T and CHSE-214 cells is as follows: Figure 3 As shown, the circRNA vaccine designed in this invention can successfully express G protein in both HEK293T cells and CHSE-214 cells, and the protein expression level is higher than that of G-mRNA.

[0041] Example 3 LNP-circRNA and LNP-mRNA nanoparticles The following LNP protocol was used for the packaging preparation of circRNA and mRNA.

[0042] Preparation of lipid solutions: All ionizable lipids and auxiliary lipids were prepared with anhydrous ethanol. Among them, the stock solution concentration of the four components, namely ionizable lipid SM-102, cholesterol, phospholipids, and distearate phosphatidylethanolamine-polyethylene glycol 2000 (DSPE–PEG2000), was 10 mg / mL. They can be diluted as needed before use.

[0043] Preparation of lipid nanoparticles: The molar ratio of each component of the lipid nanoparticles was the same as that of the classic ionizable lipid SM-102 (helper phospholipid: cholesterol: DSPE-PEG = 50:10:38.5:1.5). Two enzyme-free EP tubes were used and labeled I and II, respectively. The four lipid components were dissolved in ethanol solution according to the corresponding ratio and added to EP tube I and mixed well. The total volume was recorded as V1. Sodium citrate buffer (50 mM, pH 4.0) and G-circRNA were added to II and mixed well. The total volume was recorded as V2, where V2 = 3V1. Using a microfluidic device, the flow rate ratio of sodium citrate buffer phase: ethanol phase was controlled at 3:1. The total flow rate was controlled, and stable LNPs were assembled by electrostatic adsorption. After preparation, the nanoparticles were immediately dialyzed in a 100 kDa dialysis tube at 4°C. The dialysate was changed every 2 hours for a total of 4 hours to remove residual ethanol. After dialysis, ultrafiltration was performed at 3000g for 15 minutes, repeated three times to concentrate the LNP concentration to the desired level. The LNP was then filtered using a 0.22 μm filter and characterized using a DLS dynamic light scattering analyzer. The preparation methods for LNP-circRNA and LNP-mRNA nanoparticles were the same.

[0044] In the LNP protocol: the total flow rate was controlled at 4 mL / min and the lipid concentration was 4 mg / mL to prepare LNP-circRNA. The particle size was determined to be 114.3 nm and the PDI was 0.118 by DLS dynamic light scattering analysis instrument.

[0045] Example 4 Fish immunity Immunization: Rainbow trout weighing 6–10 g were randomly divided into groups of 50 each. They were temporarily held in a circulating water tank (65cm×65cm×70cm) at a water temperature maintained at (13.5±1)℃. After 14 days of rearing, they were immunized by injection with the LNP-circRNA and LNP-mRNA obtained in Example 3 of this invention. The immunization protocols for each group of rainbow trout are shown in Table 2. 50 μL of RNA vaccine was injected intramuscularly at the base of the dorsal fin. The trout were fasted for 3 days before the experiment. The immunization dose of circRNA and mRNA vaccines was 10 μg / tail. A blank control group was also included, receiving 50 μL / tail phosphate solution.

[0046] Twenty-eight days after immunization, the fish were anesthetized with MS-222, and each rainbow trout was intraperitoneally injected with 100 μL of IHNV GS21 strain virus solution (10 3 TCID 50(Tail), after challenge with the virus, feeding was stopped, and the water temperature in the rearing environment was controlled at 12-15℃. The fish were placed in a circulating system and observed continuously for 21 days. The number of dead rainbow trout was recorded twice daily, and survival curves were plotted to compare the effects of different RNA vaccines on the survival rate of rainbow trout. The survival curves for rainbow trout are shown below. Figure 4 The survival rates of rainbow trout after viral challenge in each group are shown in Table 3.

[0047] The survival rates of rainbow trout were 21.88% in the PBS group, 17.14% in the TBS group, 66.67% in the G-mRNA group, 75.68% in the IRES-G-free group, 71.43% in the CVB3-G group, 88.24% in the HCV-G group, 94.44% in the IPNV-G group, 100.00% in the EMCV-G group, and 90.00% in the Ythdc2-G group, demonstrating that the circRNA of the present invention can provide immune protection for rainbow trout, and the immune protection effect is better than that of linear mRNA.

[0048] The rainbow trout survival rates in the IPNV-G, EMCV-G, and Ythdc2-G groups were all above 90%, demonstrating that the IPNVIRES, EMCV IRES, and Ythdc2 IRES screened in this invention can effectively initiate translation in rainbow trout. Within the circRNA framework of this invention, EMCV-G-circRNA provides 100% immune protection for rainbow trout, and within this circRNA framework, EMCV IRES exhibits a stronger translation initiation effect.

[0049] The rainbow trout IHNV circRNA vaccine of the present invention, with an injection of 10 μg per trout, showed an improvement of more than 40% compared with the control group, and can provide better immune protection with a smaller dose.

[0050] In this specification, the invention has been described with reference to specific embodiments thereof. However, it will be apparent that various modifications and variations can be made without departing from the spirit and scope of the invention. Therefore, the specification and drawings should be considered illustrative rather than restrictive.

Claims

1. A circRNA vaccine for combating infectious hematopoietic organ necrosis virus, characterized in that, The circRNA vaccine is a covalently closed circular structure, including an internal ribosome entry site, a G protein sequence of infectious hematopoietic necrosis virus, and a Kozak sequence located between the internal ribosome entry site and the G protein sequence of infectious hematopoietic necrosis virus. The circRNA vaccine comprises tRNA from Anabaena algae. Leu Circular connection sequences formed by self-splicing of type I introns; The internal ribosome entry site is one or more of Coxsackievirus 3 IRES, infectious pancreatic necrosis virus IRES, encephalomyocarditis virus IRES, Ythdc2 IRES, and hepatitis C virus IRES; The amino acid sequence of the G protein of the infectious hematopoietic necrosis virus has at least 90% sequence identity with the amino acid sequence encoded by SEQ ID NO.

1.

2. The circRNA vaccine for combating infectious hematopoietic necrosis virus according to claim 1, characterized in that, The nucleotide sequence of the internal ribosome entry site is shown in SEQ ID NO.7; the Kozak sequence is GCCACC.

3. The circRNA vaccine for combating infectious hematopoietic organ necrosis virus according to claim 1, characterized in that, The circular linker of the circRNA vaccine is formed by a covalent bond between the 3' end of the G protein coding sequence and the 5' end of the internal ribosome entry site.

4. A method for constructing a circRNA vaccine against infectious hematopoietic necrosis virus, characterized in that, The method includes: (1) Provide a circRNA precursor, wherein the circRNA precursor comprises, from 5' to 3': a 5' EGS homologous fragment and an Anabaena tRNA. Leu Type I intron, 5' stem homolog, internal ribosome entry site, Kozak sequence, G protein sequence of infectious hematopoietic necrosis virus, 3' stem homolog and 3' EGS homolog; The internal ribosome entry site is one or more of Coxsackievirus 3 IRES, infectious pancreatic necrosis virus IRES, encephalomyocarditis virus IRES, Ythdc2 IRES, and hepatitis C virus IRES; The amino acid sequence of the G protein of the infectious hematopoietic necrosis virus has at least 90% sequence identity with the amino acid sequence encoded by SEQ ID NO.1; (2) Based on the aforementioned circRNA precursor, in vitro transcription is performed to obtain in vitro transcribed RNA; and (3) The RNA transcribed in vitro is self-splicing and circularized to form the circRNA vaccine.

5. The construction method according to claim 4, characterized in that, The 5' EGS homologous fragment sequence is shown in SEQ ID NO.3, the 5' stem homologous fragment sequence is shown in SEQ ID NO.4, the 3' stem homologous fragment sequence is shown in SEQ ID NO.5, and the 3' EGS homologous fragment sequence is shown in SEQ ID NO.

6.

6. The construction method according to claim 4, characterized in that, The nucleotide sequence of the internal ribosome entry site is shown in SEQ ID NO.7; the Kozak sequence is: GCCACC; The aforementioned anabaena tRNA Leu The nucleotide sequence of type I introns is shown in SEQ ID NO.

2.

7. The construction method according to claim 4, characterized in that, circRNA precursors include in vitro transcription promoters.

8. The construction method according to claim 4, characterized in that, In vitro transcription was performed using T7 RNA polymerase.

9. The construction method according to claim 4, characterized in that, The specific steps (2) are as follows: The circRNA precursor sequence was cloned into a vector to obtain the recombinant plasmid p-TRIC-IRES; p-TRIC-IRES was spliced ​​with the G protein sequence by homologous recombination to obtain the recombinant plasmid p-TRIC-IRES-G; p-TRIC-IRES-G fragments were recovered after p-TRIC-IRES-G enzyme digestion or p-TRIC-IRES-G fragments were obtained by PCR amplification using p-TRIC-IRES-G template. Using the p-TRIC-IRES-G fragment as a template, in vitro transcription was performed, and DNA was removed by digestion to obtain in vitro transcribed RNA.

10. The construction method according to claim 4, characterized in that, The RNA transcribed in vitro was circularized by self-splicing of the LeuI type intron of Anabaena tRNA, and then treated with RNase R to remove linear RNA molecules, thus obtaining the circRNA vaccine.

11. The use of the circRNA vaccine of claim 1 or the circRNA vaccine constructed by the construction method of claim 4 in the preparation of a medicament for the prevention of infectious hematopoietic necrosis virus infection.

Images