A pathogenic bacteria causing root rot symptoms related to red heart disease of astragalus and application thereof

Abstract

The present application relates to the field of microbiological technology, and particularly relates to a pathogenic bacterium causing root rot symptoms of red heart disease of Astragalus membranaceus and application thereof, the pathogenic bacterium is Fusarium sp. Fusarium sp. FUS-001-2025, preserved in China General Microbiological Culture Collection Center on March 16, 2026, with the preservation number of CGMCC No. 42529; it is determined to be a new recorded strain of Fusarium sp. through morphological and molecular identification, and the bactericide sensitivity determination shows that 25% silthiofam·prochloraz has the strongest inhibition effect, 25% bromothalonil, 50% azoxystrobin and 70% methylthiophanate have significant inhibition at high concentrations. The present application provides an important pathogenic bacterium resource for the pathogenic mechanism, disease resistance evaluation and development of control agents of red heart disease of Astragalus membranaceus.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a pathogen that causes root rot symptoms associated with Astragalus membranaceus red heart disease and its applications. Background Technology

[0002] Astragalus ( Astragalus membranaceus Astragalus membranaceus (Huangqi) is a perennial herbaceous plant belonging to the legume family. It is one of the major traditional Chinese medicinal herbs, possessing properties such as tonifying qi and strengthening the exterior, promoting diuresis and detoxification. It is widely used in traditional Chinese medicine clinical practice and health product fields. In recent years, with the continuous expansion of the planting area, its disease problems have become increasingly prominent. Among them, red heart disease has become one of the main diseases affecting the yield and quality of Astragalus membranaceus. This disease mainly manifests as reddish-brown to dark red lesions in the center of the root; in severe cases, the roots rot, the plant wilts, and even dies.

[0003] Currently, the control of Astragalus membranaceus red heart disease mainly relies on chemical fungicides, such as broad-spectrum fungicides like carbendazim, thiophanate-methyl, and hymexazol. However, due to the long-term use of single-drug and indiscriminate application in production, pathogen resistance has been continuously increasing, leading to decreased control efficacy. More importantly, the screening of existing fungicides is mostly based on known pathogens, while the types of pathogens vary in different production areas and for different disease types. This results in incomplete antibacterial effects of existing fungicides, inconsistent control efficacy, and difficulty in achieving efficient control. Summary of the Invention

[0004] To address the above problems, this invention provides a pathogen that causes root rot symptoms associated with Astragalus membranaceus red heart disease and its application.

[0005] This invention is achieved through the following technical solution: A pathogen causing root rot symptoms associated with Astragalus membranaceus red heart disease, said pathogen is Fusarium (… Fusariumsp. FUS-001-2025 was deposited on March 16, 2026, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 42529.

[0006] Preferably, the nucleotide sequence of the pathogen is shown in SEQ ID NO:3.

[0007] Application of the aforementioned pathogen in the study of the pathogenesis mechanism of root rot symptoms related to Astragalus membranaceus red heart disease.

[0008] Application of the described pathogen in the evaluation of disease resistance to root rot symptoms associated with Astragalus membranaceus red heart disease.

[0009] The application of the aforementioned pathogen in the development of chemical and biological control agents for root rot symptoms associated with Astragalus membranaceus red heart disease.

[0010] Preferably, Astragalus membranaceus is inoculated with the Fusarium oxysporum FUS-001-2025.

[0011] A fungicide for the prevention and treatment of root rot symptoms associated with Astragalus membranaceus red heart disease, the fungicide being used to control the pathogens causing root rot symptoms associated with Astragalus membranaceus red heart disease.

[0012] Preferably, the control agent is one or a combination of two or more of the following: silazole-prochloraz, bromodiphenyl ether, cymoxanil, azoxystrobin, and thiophanate-methyl.

[0013] Preferably, the control agent is silazole·prochloraz; Preferably, the silazole·imazalil is 25% silazole·imazalil, and the concentration of the 25% silazole·imazalil used is 0.10 μg / mL to 5.00 μg / mL.

[0014] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a novel pathogen, *Fusarium sp.* FUS-001-2025, which causes root rot symptoms associated with *Astragalus membranaceus* red heart disease. This strain was confirmed as a pathogen through morphological, molecular biological, and re-inoculation experiments, filling a gap in the classification of pathogens causing this disease and laying a material foundation for subsequent research on its pathogenic mechanism. Simultaneously, the biological characteristics of this pathogen were systematically studied, identifying its optimal growth temperature (25℃~30℃), suitable pH (7~8), preferred culture media (CZ, CDBA), and light conditions (alternating light and dark), providing a scientific basis for the laboratory culture and prediction of its field occurrence patterns. Furthermore, the sensitivity of this pathogen to seven commonly used fungicides was determined, and agents with significant antifungal effects, such as 25% silazole·prochloraz, 25% bromuconazole, 50% azoxystrobin, and 70% thiophanate-methyl, were screened out. This provides precise guidance for the chemical control of *Astragalus membranaceus* red heart disease, helping to reduce indiscriminate application and the development of drug resistance. This pathogen can also be used for the evaluation of disease-resistant germplasm resources of Astragalus membranaceus, the discovery of pathogenic genes, and the development of biological control agents, and has broad application prospects.

[0015] Information on the preservation of biological materials Fusarium ( Fusariumsp. FUS-001-2025, taxonomically named Fusarium. Fusariumsp. It was deposited on March 16, 2026, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 42529. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This is a colony characteristic diagram of the present invention; wherein, A is a front view of the colony; B is a back view of the colony; C is a sporulation structure diagram; D is a conidial shape diagram; the scale bar in C and D is 20 μm.

[0018] Figure 2 The images show the results of the re-inoculation experiment of Fusarium FUS-001-2025 of this invention; where A is the result after 7 days of culture of the bacterial cake inoculation; B is the culture of the original inoculated pathogen; and C is the culture of the re-isolated pathogen.

[0019] Figure 3 The image shows the results of the reinoculation experiment of Fusarium oxysporum FUS-001-2025 according to the present invention; where A is an image of the infected root segment; and B is an image of the cross-section of the infected root segment.

[0020] Figure 4 The figure shows the effect of 25℃ on the mycelial growth of Fusarium f. U.S. FUS-001-2025 according to the present invention; where A is parallel experiment 1 of Fusarium culture at 25℃; B is parallel experiment 2 of Fusarium culture at 25℃; C is parallel experiment 3 of Fusarium culture at 25℃; D is parallel experiment 1 of Fusarium culture at 30℃; E is parallel experiment 2 of Fusarium culture at 30℃; and F is parallel experiment 3 of Fusarium culture at 30℃.

[0021] Figure 5 The figure shows the effect of different pH conditions on the mycelial growth of Fusarium f. U.S. FUS-001-2025. Among them, A is parallel experiment 1 of Fusarium f. U.S. FUS-001-2025 cultured at pH 7; B is parallel experiment 2 of Fusarium f. U.S. FUS-001-2025 cultured at pH 7; C is parallel experiment 3 of Fusarium f. U.S. FUS-001-2025 cultured at pH 7; D is parallel experiment 1 of Fusarium f. U.S. FUS-001-2025 cultured at pH 8; E is parallel experiment 2 of Fusarium f. U.S. FUS-001-2025 cultured at pH 8; and F is parallel experiment 3 of Fusarium f. U.S. FUS-001-2025 cultured at pH 8.

[0022] Figure 6 The figure shows the effect of CDBA medium on the mycelial growth of Fusarium f. U.S. FUS-001-2025. Among them, A is parallel experiment 1 of Fusarium culture in CDBA medium; B is parallel experiment 2 of Fusarium culture in CDBA medium; C is parallel experiment 3 of Fusarium culture in CDBA medium; D is parallel experiment 1 of Fusarium culture in CZ medium; E is parallel experiment 2 of Fusarium culture in CZ medium; and F is parallel experiment 3 of Fusarium culture in CZ medium.

[0023] Figure 7 The figure shows the effect of different light conditions on the mycelial growth of Fusarium f. U.S. FUS-001-2025 according to the present invention; where A is parallel experiment 1 of Fusarium f. U.S. FUS-001-2025 cultured under dark conditions; B is parallel experiment 2 of Fusarium f. U.S. FUS-001-2025 cultured under dark conditions; C is parallel experiment 3 of Fusarium f. U.S. FUS-001-2025 cultured under dark conditions; D is parallel experiment 1 of Fusarium f. U.S. FUS-001-2025 cultured under light conditions; E is parallel experiment 2 of Fusarium f. U.S. FUS-001-2025 cultured under light conditions; FUS-001-2025 cultured under light conditions; G is parallel experiment 1 of Fusarium f. U.S. FUS-001-2025 cultured under dark conditions; H is parallel experiment 2 of Fusarium f. U.S. FUS-001-2025 cultured under dark conditions; and I is parallel experiment 3 of Fusarium f. U.S. FUS-001-2025 cultured under dark conditions.

[0024] Figure 8 The graph shows the results of the susceptibility test of Fusarium oxysporum FUS-001-2025 to fungicides according to the present invention; where A is Fusarium oxysporum - 25% bromuconazole - 0.1ug / mL - parallel experiment 1; B is Fusarium oxysporum - 25% bromuconazole - 0.1ug / mL - parallel experiment 2; C is Fusarium oxysporum - 25% bromuconazole - 0.1ug / mL - parallel experiment 3; D is Fusarium oxysporum - 25% bromuconazole - 1.25ug / mL - parallel experiment 1; E is Fusarium oxysporum - 25% bromuconazole - 1.25ug / mL - parallel experiment 2; F is Fusarium oxysporum - 25% bromuconazole - 1.25ug / mL - parallel experiment 3; G is Fusarium oxysporum - 25% bromuconazole - 1.5ug / mL. L - Parallel Experiment 1; H - Fusarium - 25% bromuconazole - 1.5ug / mL - Parallel Experiment 2; I - Fusarium - 25% bromuconazole - 1.5ug / mL - Parallel Experiment 3; J - Fusarium - 25% bromuconazole - 2.5ug / mL - Parallel Experiment 1; K - Fusarium - 25% bromuconazole - 2.5ug / mL - Parallel Experiment 2; L - Fusarium - 25% bromuconazole - 2.5ug / mL - Parallel Experiment 3; M - Fusarium - 25% bromuconazole - 5ug / mL - Parallel Experiment 1; N - Fusarium - 25% bromuconazole - 5ug / mL - Parallel Experiment 2; O - Fusarium - 25% bromuconazole - 5ug / mL - Parallel Experiment 3. Detailed Implementation

[0025] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0026] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0027] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0028] Example 1: Isolation and identification of pathogens causing Astragalus membranaceus red heart disease (a) Methods Sample source: Astragalus membranaceus plants with red heart disease were collected from two sampling plots in Deshenggou Township and Shangtuhai Township, Wuchuan County in 2024. Nine diseased plants were taken from each plot. After washing the soil surface of the roots with running water to remove impurities, the roots were dried with absorbent paper. The roots were cut off about 5 cm from the middle, placed in separate sealed bags, numbered, and brought back to the laboratory in an insulated box with ice packs.

[0029] Pathogen isolation: Diseased tissue from the roots of Astragalus membranaceus was removed. The tissue surface was first rinsed with sterile distilled water, then disinfected in 75% alcohol for 1 minute, then soaked in 75% ethanol for 1 hour, and finally rinsed three times with sterile water. The tissue was then dried in a sterile operating table. After the tissue surface was dried, it was cut in half and the cross-section was inoculated onto PDA medium. The culture was carried out in a constant temperature incubator at 28°C. After the hyphae grew, the edge hyphae were picked and purified on a new PDA medium. The purified strain was mixed with magnetic beads and stored at -80°C for later use.

[0030] Pathogen identification: (1) Morphological identification of the strain The isolated and purified strains were inoculated into PAD medium and cultured in a constant temperature incubator at 28°C for 5 days. The colony morphology and colony diameter were recorded.

[0031] The morphological characteristics of large conidia are one of the main features for the classification and identification of Fusarium. Spore shape, curvature, and number of septa are all key observational features. The presence or absence of small conidia is a major characteristic for Fusarium identification. In addition, the borne arrangement of most chlamydospores—single, opposite, chain-like, or intercalary—can also be used as a basis for identification. The differentiation of conidiophores is currently the main method for identifying Fusarium, generally divided into three types: single phialidiophore (with only one conidiophore at the apex); compound phialidiophore (with two or more conidiophore pores); and cascading phialidiophore (where a new conidiophore emerges from the pore at the apex of the original conidiophore, gradually moving forward to repeat conidiophore production).

[0032] (2) Molecular identification of strains The isolated strain was inoculated onto PDA medium and cultured in the dark at 28°C for 5 days. Mycelia were then collected, ground into a fine powder using liquid nitrogen, and 100 mg was weighed into a 1.5 mL centrifuge tube. DNA extraction was performed using a fungal DNA extraction kit. Using the extracted total fungal genomic DNA as a template, the rDNA-ITS region was amplified using universal fungal primers ITS1 and ITS4. The nucleotide sequence of primer ITS1 is shown in SEQ ID NO:1: 5'-TCCGTAGGTAACCTGCGG-3'; the nucleotide sequence of primer ITS4 is shown in SEQ ID NO:2: 5'-TCCTCCGCTTATTGATATGC-3'. PCR products were subjected to 1.5% agarose gel electrophoresis, and the target fragment was observed under blue light. The gel was then purified and sequenced. The assembled sequence file was compared with data in the NCBI database using the NCBI Blast program; the comparison result was the identification result.

[0033] (II) Results Fungal culture was performed on the diseased Astragalus samples from the two locations mentioned above (bacterial culture was not very meaningful, and the preliminary experimental results of bacterial culture were all identified as non-pathogenic bacteria).

[0034] After isolation and identification of the pathogens, six pathogens were finally identified: Fusarium trifidum, Fusarium solani, Fusarium oatum, Fusarium putrefactionum, and pathogens of the genus *Fusarium*. Among them, the pathogens of the genus *Fusarium* were found to be unreported by NCBI Blast. Figure 1 As shown.

[0035] The sequencing results of pathogens of the genus Fusarium are shown in SEQ ID NO:3.

[0036] SEQ ID NO:3: GGCCGCGACGATTAGCAGTAACGAGGGTTTTACTACTACGCTATGGAAGCTCGACGTGACCGCCAATCAATTTGGGGAACGCGAATTAACGCGAGTGCCAACACCAAGCTGTGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTATTTATGGTTTTACTCAGAAGTTACATATAGAAACAGAGTTTAGGGGTCCTCTGGCGGGCCG TCCCGTTTTACCGGGAGCGGGCTGATCCGCCGAGGCAACAAGTGGTATGT TCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGTAAGGGT ACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAAC ATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACG GCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAA AACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCAT CGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCA GTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCG GGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTG GGACTCGCGTTAATTCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGC TTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCAC GCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATAC CCGCTGAACTTAAGCATATCAATAAGGCGGGAGGAA.

[0037] The colony characteristics are shown below: Fusarium ( Fusariumsp. It grows well on PDA medium, exhibiting variable color and a characteristic feature of producing pigment on the reverse side. Colonies are nearly circular, with a mostly fluffy edge. Initially, the colonies are white and fluffy, gradually turning reddish-brown in the center over time. Aerial hyphae are well-developed, ranging from 0.2 cm to 1 cm in length, often approaching or touching the plate lid. Water-soluble pigment, appearing pink, is frequently produced on the reverse side. Figure 1 As shown.

[0038] The microscopic features are shown below: Large conidia are slender, sickle-shaped or fusiform, mainly with 1-3 septa, and the conidia are slightly curved. Small conidia are oval or elliptical, with a higher proportion being septate, and occasionally septate conidia are seen. They are borne in a pseudocapital form on the phialpinioidea and are not arranged in a beaded pattern.

[0039] The hyphae are colorless, septate, with few branches, and relatively uniform in thickness; the phialpinioides are short and thick, arranged in whorls or clusters; the conidiophores have simple branching, such as... Figure 1 As shown.

[0040] The pathogenic strain was named Fusarium (Fusarium oxysporum). Fusariumsp. FUS-001-2025 was deposited on March 16, 2026, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 42529.

[0041] Example 2: Fusarium reinoculation experiment (a) Methods The in vitro root inoculation method was used for determination: One-year-old Astragalus membranaceus roots were selected, and 5cm sections were cut as test materials and shallowly pierced with a needle. Fusarium oxysporum, the pathogen causing Astragalus membranaceus red heart disease, was pre-cultured on PDA plates at 28℃ in the dark for 5 days. Using a sterile punch, 5mm diameter mycelial cakes were vertically pressed into the pierced root section, with the mycelial side facing the pierced root. PDA medium without pathogen inoculation served as a blank control. Each pathogen was tested in triplicate. The plates were incubated at 28℃ for 7 days, and the disease status was observed. The pathogen was re-isolated from the diseased area and simultaneously inoculated with the original pathogen. Once the mycelium had completely covered the medium, the re-isolated strain was observed to determine if it was the same as the original strain. A re-isolation rate greater than 50% was considered indicative of pathogenicity.

[0042] (II) Results The results showed that the re-isolation rate of the pathogen *Fusarium* was 9 / 9. Infected root segments became soft and exhibited browning and root rot, indicating that the *Fusarium* isolated in this invention can reproduce the root rot and browning symptoms of red heart disease, and is a significant pathogenic factor leading to tissue necrosis and plant death in this disease. Figure 2 and 3 As shown.

[0043] Example 3: Study on the biological characteristics of Fusarium (a) Methods (1) Effects of different temperature conditions on the mycelial growth of Fusarium pathogen Fusarium oxysporum, the pathogen causing red heart disease of Astragalus membranaceus, was activated on PDA medium and cultured at 28°C for 5 days. Approximately 5 mm hyphae from the activated Fusarium oxysporum were then inoculated into the center of PDA medium and cultured at 5°C, 10°C, 15°C, 20°C, 25°C, 30°C, 35°C, and 40°C, with three replicates for each group (experiments 1, 2, and 3). After 5 days of culture, colony morphology was observed, and colony diameter was measured and recorded using the cross-crossing method.

[0044] (2) Effects of different pH conditions on the mycelial growth of Fusarium pathogen PDA medium was adjusted to pH values ​​of 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, and 11.0 using 1 mol / L hydrochloric acid and 1 mol / L sodium hydroxide, respectively. Fusarium wilt pathogens, the causal agent of Astragalus membranaceus red heart disease, were activated on PDA medium and incubated at 28°C for 5 days. Approximately 5 mm hyphae of the activated Fusarium wilt were then inoculated into the center of PDA medium at different pH values, placed face up, and incubated at 28°C. Three parallel experiments (1, 2, and 3) were set up for each group. After 5 days of incubation, colony morphology was observed, and colony diameter was measured and recorded using the cross-cross method.

[0045] (3) Effects of different culture media on the mycelial growth of Fusarium pathogen Five different culture media were used: Czapek's agar (CZ), potato dextrose agar (PDA), potato sucrose agar (PSA), water agar (WA), and corn flour-dextrose-bromocresol-green agar (CDBA). *Fusarium oxysporum*, the pathogen of *Astragalus membranaceus* red heart disease, was activated on PDA medium and incubated at 28°C for 5 days. Approximately 5 mm mycelia of the activated *Fusarium oxysporum* were then inoculated into the center of each culture medium, face up, and placed in a 28°C incubator. Each group had three parallel experiments (1, 2, and 3). After 5 days of incubation, colony morphology was observed, and colony diameter was measured and recorded using the cross-crossing method. All culture media used in this invention are common media. CZ and PSA media were purchased from Beijing Solarbio Science & Technology Co., Ltd.; PDA medium was purchased from Beijing Luqiao Technology Co., Ltd.; and WA water agar was purchased from Savill Biotechnology Co., Ltd.

[0046] Corn flour, glucose, bromocresol, and green agar medium (CDBA): 2g NaNO3, 1g K2HPO4, 0.5g MgSO4·7H2O, 0.5g KCl, 0.01g FeSO4·7H2O, 30g sucrose, 15g agar powder, 1000mL water, sterilized at 121℃ for 30min.

[0047] (4) Effects of different light conditions on the mycelial growth of Fusarium pathogen Fusarium pathogens were activated on PDA medium and cultured at 28°C for 5 days. Approximately 5 mm hyphae of the activated Fusarium were picked and inoculated into the center of PDA medium. The medium was then placed in a 28°C incubator under light, darkness, and alternating light and dark conditions (12 hours light, 12 hours darkness), with three replicates per group (experiments 1, 2, and 3). After 5 days of culture, colony morphology was observed, and colony diameter was measured and recorded using the cross-cross method.

[0048] (II) Results (0) Effects of different temperature conditions on the mycelial growth of Fusarium pathogen Table 1. Colony size under different temperature conditions Conclusion: The growth of *Fusarium oxysporum*, the pathogen of *Astragalus membranaceus*, is significantly affected by different culture temperatures (5℃~40℃), with the optimal growth temperature ranging from 25℃ to 30℃, as shown in Table 1. Figure 4 As shown in Table 1, the specific results of colony size under different temperature conditions are presented. Figure 4 The results shown are only for temperatures of 25℃ and 30℃, as examples.

[0049] (0) Effects of different pH conditions on the mycelial growth of Fusarium pathogen Table 2 Colony size under different pH conditions Conclusion: Mycelia can grow under different pH values ​​(5-10), and grow well at pH values ​​(7-8), as shown in Table 2. Figure 5 As shown in Table 2, the specific results of colony size under different pH conditions are presented. Figure 5 The results for pH 7 and 8 are shown only as examples.

[0050] (0) Effects of different culture media on the mycelial growth of Fusarium pathogen Table 3 Colony sizes on different culture media Conclusion: Growth varied slightly on different culture media, with good growth observed on CZ and CDBA media, as shown in Table 3. Figure 6 As shown in Table 3, the specific results of growth on different culture media are presented. Therefore, Figure 6 The CDBA culture medium shown here is only an example.

[0051] (4) Effects of different light conditions on the mycelial growth of Fusarium pathogen Table 4. Colony size under different light conditions Conclusion: Compared to culture conditions under pure light and pure darkness, growth was better under alternating light and darkness conditions. (See Table 4 and...) Figure 7 As shown.

[0052] Example 4: Determination of the susceptibility of Fusarium pathogens to fungicides (a) Methods Fusarium pathogen strains were inoculated onto PDA plates and pre-cultured at 28°C in the dark for 5 days. Mycelial blocks with a diameter of 5 mm were vertically pressed into PDA plates containing different fungicides using a sterile punch. The tested fungicides included: 70% thiophanate-methyl, 10% mixed amino acid copper, 25% silazole·prochloraz, 30% hymexazol, 50% fludioxonil, 50% azoxystrobin, and 25% bromuconazole (percentages represent the mass fraction of the active ingredient in each fungicide). Five concentration gradients were set for each fungicide: 0.10 μg / mL, 1.25 μg / mL, 1.50 μg / mL, 2.50 μg / mL, and 5.00 μg / mL. PDA plates without fungicide were used as controls. Each treatment was replicated in triplicate. After inoculation, the cells were incubated in the dark at 28℃ for 5 days. Colony morphology was observed, and the colony diameter (mm) was measured and recorded using the cross-cross method. 70% thiophanate-methyl, 10% mixed amino acid copper, 25% silazole·prochloraz, 30% hymexazol, 50% fludioxonil, 50% azoxystrobin, and 25% bromuconazole were all purchased from Shandong Xinxing Pesticide Co., Ltd.

[0053] (II) Results Table 5. Colony sizes at different concentrations of different fungicides Table 5 (continued) Note: " / " indicates that this item is not present.

[0054] Conclusion: In the experiment on the antibacterial effect of different concentrations of fungicides on Fusarium, the inhibitory effect of different concentrations of 10% mixed amino acid ketone on Fusarium was not significant. 25% silazole·prochloraz showed significant inhibitory effect on Fusarium. 25% bromuconazole, 30% cymoxanil, 50% azoxystrobin, and 70% thiophanate-methyl all showed antibacterial effects at a concentration of 5 μg / mL. Among them, 25% bromuconazole, 50% azoxystrobin, and 70% thiophanate-methyl showed significant antibacterial effects, and 50% fludioxonil showed a significant antibacterial effect at a concentration of 0.1 μg / mL. (See Table 5 and...) Figure 8 As shown in Table 5, the results of the bactericide sensitivity test are presented. Therefore, Figure 8 The image only shows different concentrations of bromodiphenyl ether as examples.

[0055] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0056] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. A pathogen causing root rot symptoms associated with Astragalus membranaceus red heart disease, characterized in that, The pathogen is Fusarium (Fusarium spp.) Fusarium sp. FUS-001-2025 was deposited on March 16, 2026, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 42529.

2. The pathogen of Astragalus membranaceus red heart disease as described in claim 1, characterized in that, The nucleotide sequence of the pathogen is shown in SEQ ID NO:

3.

3. The application of the pathogen as described in claim 1 in the study of the pathogenesis mechanism of root rot symptoms related to Astragalus membranaceus red heart disease.

4. The application of the pathogen as described in claim 1 in the evaluation of disease resistance to root rot symptoms associated with Astragalus membranaceus red heart disease.

5. The application of the pathogen as described in claim 1 in the development of chemical and biological control agents for root rot symptoms associated with Astragalus membranaceus red heart disease.

6. The application as described in any one of claims 3 to 5, characterized in that, Astragalus was inoculated with the Fusarium strain FUS-001-2025 described above.

7. A fungicide for the prevention and treatment of root rot symptoms associated with Astragalus membranaceus red heart disease, characterized in that, The agent is used to control the pathogens that cause root rot symptoms associated with Astragalus membranaceus red heart disease as described in claim 1 or 2.

8. The agent for preventing and treating root rot symptoms related to Astragalus membranaceus red heart disease as described in claim 7, characterized in that, The control agent is one or a combination of two or more of the following: silazole-prochloraz, bromochlorothalonil, cymoxanil, azoxystrobin, and thiophanate-methyl.

9. The agent for preventing and treating root rot symptoms related to Astragalus membranaceus red heart disease as described in claim 8, characterized in that, The control agent is silazole·prochloraz.

10. The agent for preventing and treating root rot symptoms related to Astragalus membranaceus red heart disease as described in claim 9, characterized in that, The silazole·prochloraz is 25% by mass, and the concentration of the 25% silazole·prochloraz used is 0.10 μg / mL to 5.00 μg / mL.

Images