Application of cmalkbh10b protein and its encoding gene in stable anthocyanin under high temperature condition

By regulating the expression of the CmALKBH10B protein in chrysanthemums and using genetic engineering techniques to downregulate or inhibit the expression of the CmALKBH10B gene, the problem of chrysanthemum petals fading easily at high temperatures was solved, and stable regulation of flower color was achieved. This method is applicable to chrysanthemum breeding and ornamental breeding.

CN122445696APending Publication Date: 2026-07-24SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY
Filing Date
2026-04-28
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Chrysanthemum petals are prone to fading under high temperatures, resulting in poor color stability. Existing gene regulation methods lack stability and specificity under high-temperature conditions, affecting ornamental quality and market competitiveness.

Method used

By regulating the expression of CmALKBH10B protein in chrysanthemum, recombinant overexpression vectors and recombinant silencing vectors were used to downregulate or inhibit CmALKBH10B gene expression to delay petal fading, or to overexpress CmALKBH10B protein to promote petal lightening. Genetic engineering was carried out using amiRNA interference technology and RNAi technology.

Benefits of technology

Under high temperature conditions, downregulating the expression of the CmALKBH10B gene can delay petal fading and maintain stable flower color; overexpression of the CmALKBH10B protein can promote petal fading, thus achieving stability and controllability of flower color regulation, which is suitable for cultivating new chrysanthemum varieties with stable flower color under high temperature conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses the application of the CmALKBH10B protein and its encoding gene in stabilizing flower color under high temperature conditions. The amino acid sequence of the CmALKBH10B protein is shown in SEQ ID NO:3, and the genomic nucleotide sequence and CDS sequence of its encoding gene are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. Experimental results show that inhibition... CmALKBH10B Gene expression can significantly delay the fading process of chrysanthemum petals under high temperature conditions and maintain stable flower color; overexpression CmALKBH10B Genes can exacerbate the fading of chrysanthemums in high-temperature environments, leading to lighter flower colors. This invention provides a key target for cultivating new chrysanthemum varieties with stable flower colors under high-temperature conditions, and can be applied to stress-resistant breeding of ornamental chrysanthemums and their widespread cultivation in tropical regions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and molecular biology, specifically to the application of the CmALKBH10B protein and its encoding gene in stabilizing flower color under high temperature conditions. Background Technology

[0002] chrysanthemum( Chrysanthemum morifolium As a traditional Chinese flower and one of the world's important cut flowers, chrysanthemums possess high ornamental and economic value. Flower color is a key trait for evaluating the ornamental quality and commercial value of chrysanthemums, but the color stability of many cut chrysanthemum varieties is easily affected by environmental factors. Among them, the fading of petals caused by high temperatures is particularly prominent, seriously affecting the commercial quality and market competitiveness of cut chrysanthemums. This problem is even more pronounced in summer cultivation in year-round greenhouse production and in the introduction and cultivation of chrysanthemums in low-latitude and tropical regions. Therefore, elucidating the molecular mechanism of chrysanthemum fading due to high temperatures and identifying key regulatory factors that can be used for breeding is of great significance.

[0003] Previous studies have shown that high-temperature stress can significantly inhibit the accumulation of anthocyanins in chrysanthemum petals, leading to fading of red chrysanthemum petals (Li et al., 2024). Analysis of the gene expression profile of chrysanthemum petals under high-temperature stress revealed that several structural genes in the anthocyanin biosynthesis pathway, such as... CHS , CHI , DFR , F3H , ANS , 3GT and F3'H Significant changes were observed in the expression of various factors, including light and temperature, as well as some related regulatory transcription factors (Shi et al., 2022). Further studies showed that the expression level of the bZIP-type transcription factor CmHY5 decreased under high temperature conditions, and its expression level was positively correlated with anthocyanin content (Shi et al., 2022). In model plants, HY5 has been shown to integrate light and temperature signals and promote pigment accumulation by regulating the expression of anthocyanin synthesis-related genes (Kim et al., 2017).

[0004] However, current research on chrysanthemum flower color stability mainly focuses on the regulation of anthocyanin synthesis structural genes and their upstream transcription factors. While some reported genes are related to flower color formation or stress response, their regulatory stability, specificity, or breeding application value under high-temperature conditions remain limited. For example, the regulatory effects of certain MYB-type transcription factors are unstable under different environments (Yang et al., 2022); although HSF-type genes participate in heat stress response, their direct link with flower color metabolism pathways remains unclear (Andrási et al., 2021); and SVP-type genes may also be involved in other biological processes such as flowering regulation (Fernández et al., 2016). Therefore, identifying key genes that can specifically respond to high temperatures and effectively regulate chrysanthemum flower color stability is of great significance for breeding new chrysanthemum varieties with stable flower color under high-temperature conditions. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide the application of CmALKBH10B protein and its encoding gene in regulating chrysanthemum flower color and cultivating new chrysanthemum varieties with stable flower color under high temperature conditions, so as to solve the problem that chrysanthemums are prone to petal fading and poor flower color stability under high temperature conditions in the prior art.

[0006] Technical solution: This invention provides the application of CmALKBH10B protein in regulating chrysanthemum flower color or cultivating new chrysanthemum varieties with stable flower color under high temperature conditions. The amino acid sequence of the CmALKBH10B protein is shown in SEQ ID NO:3.

[0007] The present invention also provides the application of the gene encoding the above-mentioned CmALKBH10B protein in regulating the flower color of chrysanthemums or cultivating new chrysanthemum varieties with stable flower color under high temperature conditions, wherein the genomic nucleotide sequence of the gene is shown in SEQ ID NO:1, or the CDS nucleotide sequence is shown in SEQ ID NO:2.

[0008] Furthermore, the chrysanthemum is a type of chrysanthemum ( Chrysanthemum morifolium The preferred species is the cultivated variety 'Nanong Fencui'.

[0009] The present invention also provides a method comprising the above. CmALKBH10B Applications of recombinant overexpression vectors of genes, recombinant silencing vectors that specifically inhibit the expression of the gene, and recombinant transformants containing any of the above vectors in regulating chrysanthemum flower color or cultivating new chrysanthemum varieties with stable flower color under high temperature conditions.

[0010] Furthermore, downregulation or suppression CmALKBH10B Gene expression can slow down the fading process of chrysanthemum petals under high temperature conditions and maintain stable flower color; overexpression CmALKBH10BGenes can promote the lightening of chrysanthemum flower color under high temperature conditions.

[0011] Furthermore, the recombinant silencing vector for gene expression was constructed using... amiRNA Interference fragments were obtained by overlapping PCR amplification using the following primer combinations: SEQ ID NO:12 and SEQ ID NO:16, SEQ ID NO:14 and SEQ ID NO:13, SEQ ID NO:17 and SEQ ID NO:15, and SEQ ID NO:16 and SEQ ID NO:17.

[0012] Furthermore, the recombinant overexpression vector is used to... CmALKBH10B The CDS sequence of the gene is constructed from the vector obtained in the expression vector.

[0013] Furthermore, the aforementioned CmALKBH10B The CDS sequence of the gene was obtained by amplification using the primers shown in SEQ ID NO:10 and SEQ ID NO:11.

[0014] This invention also provides a method for cultivating new chrysanthemum varieties with stable flower color under high temperature conditions. The method includes downregulating or inhibiting the expression of CmALKBH10B protein or its encoding gene in chrysanthemums through plant genetic engineering technology. The amino acid sequence of the CmALKBH10B protein is shown in SEQ ID NO:3.

[0015] Furthermore, the plant genetic engineering technology is amiRNA interference technology, RNAi interference technology, or antisense RNA technology.

[0016] The present invention also provides a method for promoting the lightening of chrysanthemum petals under high temperature conditions, the method comprising overexpressing CmALKBH10B protein or its encoding gene in chrysanthemum through plant genetic engineering technology, wherein the amino acid sequence of CmALKBH10B protein is shown in SEQ ID NO:3.

[0017] Beneficial effects: Compared with the prior art, the present invention provides CmALKBH10B Its application as a key factor in regulating the stability of chrysanthemum flower color at high temperatures. Research results show that downregulation or inhibition... CmALKBH10B Gene expression can slow down the fading process of chrysanthemum petals under high temperature conditions and maintain stable flower color; overexpression CmALKBH10B Genes can cause chrysanthemum petals to fade and the flower color to become lighter under high temperatures. CmALKBH10BIn plants transformed with overexpression or amiRNA silencing, apart from changes in flower color, other plant traits remained largely normal, indicating that this gene has good breeding application potential. Therefore, this invention can provide a key target for breeding new chrysanthemum varieties with stable flower color under high temperature conditions, and can be applied to stress-resistant breeding of ornamental chrysanthemums and their widespread cultivation in tropical and subtropical regions. Attached Figure Description

[0018] Figure 1 Phenotypic images of chrysanthemums under high temperature treatment; where A: records the ambient temperature data during the high-temperature field cultivation of 'Nanong Fencui'; B: laboratory simulation of the effects of room temperature and high temperature treatments on the fading of 'Nanong Fencui' flower color.

[0019] Figure 2 The graph shows the determination and statistical analysis of anthocyanin content; where A: anthocyanin extract pigment phenotype; B: anthocyanin content; and C: total flavonoid content.

[0020] Figure 3 This is a diagram showing the expression analysis of structural genes related to anthocyanin synthesis.

[0021] Figure 4 This is a graph summarizing the results of the transcriptome data analysis.

[0022] Figure 5 Under high temperature stress CmALKBH10B Expression analysis diagram; where A: qRT-PCR analysis of the relative expression levels of CmALKBH10B under room temperature control and high temperature treatment; B: transcriptome analysis. CmALKBH10B FPKM values ​​under normal temperature control and high temperature treatment.

[0023] Figure 6 This study presents the analysis of high-temperature mediated m6A RNA methylation. A: Liquid chromatography-tandem mass spectrometry (LC-MS / MS) detection of the m6A / A ratio in the high-temperature and control samples; B: m6A methylation sequencing analysis results; C: IGV visualization showing anthocyanin-regulated genes undergoing m6A methylation modification.

[0024] Figure 7 for 35S :: CmALKBH10B Schematic diagram of the overexpression vector.

[0025] Figure 8 for CmALKBH10B Phenotypic analysis, expression, and anthocyanin content analysis of stably genetically transformed plants; where A: under high temperature conditions. CmALKBH10B Comparison of flower color phenotype between overexpressing plants and wild-type plants; B: Under high temperature conditions CmALKBH10B - amiRNAComparison of flower color phenotypes between silent plants and wild-type plants; C: Phenotypes of anthocyanin extracts from petals of different transgenic lines and wild-type plants; D: CmALKBH10B Analysis of relative expression levels in overexpressing plants; E: CmALKBH10B - amiRNA Analysis of relative expression levels in silent plants; F: Determination of total anthocyanin content in petals of different transgenic lines and wild-type plants under high temperature conditions. Detailed Implementation

[0026] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0027] Example 1: Chrysanthemum flower color regulation gene under high temperature CmALKBH10B Cloning 1. Phenotypic Changes of Chrysanthemums under High Temperatures The effects of high temperature on the growth and development of chrysanthemums were observed under both naturally occurring and artificially simulated high-temperature conditions in the field. In April 2022, the ornamental chrysanthemum variety 'Nannong Fen Cui' was planted at the Batou base in Sanya City, Hainan Province. After the plants began to bud, meteorological data such as temperature and humidity were recorded, and the changes in flower color under normal and continuously high-temperature treatments were systematically observed. In the laboratory, 'Nannong Fen Cui' was treated with artificially simulated high-temperature conditions recorded in the field to further verify the effect of high temperature on flower color. The flower development stages were: S1, bud stage; S2, color emergence stage; S3, initial opening stage; S4, initial flowering stage; S5, full bloom stage; S6, senescence stage.

[0028] Compared to normal temperature treatment, the most obvious phenotypic change under sustained high temperature conditions in the field was petal fading. Specifically, under normal temperature conditions, the newly opened petals of 'Nannong Fencui' were deep pink; while under sustained high temperature conditions, the newly opened petals were light pink, gradually fading to white as the flowering process progressed. Figure 1 (A) This color fading phenotype was reproduced in an artificial climate chamber simulating high-temperature treatment; the simulated high-temperature treatment conditions were 8 hours of short-day light, 30°C for 3 hours, then increased to 35°C for 2 hours, and then 30°C for 3 hours ( ). Figure 1 (B in the middle).

[0029] The anthocyanin content in the petal samples was further determined. 0.2 g of fresh petals were weighed, flash-frozen in liquid nitrogen, and stored at -80℃ for later use. The petals were ground into powder in liquid nitrogen, and an extraction solution of methanol:water:formic acid:trifluoroacetic acid = 70:27:2:1 (V / V) was added. After shaking and mixing, the mixture was extracted at 4℃ in the dark for 24 h. The supernatant was collected by centrifugation, and three replicates were set for each sample. The absorbance (OD) at 530 nm and 657 nm was measured using a UV spectrophotometer, and the result was calculated according to the formula ΔOD = OD. 530 -1 / 4OD 657The total anthocyanin content was calculated. The results showed that the anthocyanin content of plants treated with high temperature was significantly reduced ( Figure 2 ).

[0030] Selecting structural genes related to anthocyanin synthesis CmCHS , CmCHI , CmDFR , CmF3H , CmF3'H , CmANS , Cm3GT , CmFLS and CmFNS qRT-PCR analysis was performed. Petals of 'Nannong Fencui' 'Nanjing Agricultural University' at different stages under high-temperature treatment (HS) and room-temperature treatment (CK) were collected, transported in liquid nitrogen and stored at -80℃. Total RNA was extracted using the TRIzol RNA extraction kit (Invitrogen, USA), and the RNA was reverse transcribed into cDNA using the PrimeScript RT reagent kit (TaKaRa, Dalian) according to the manufacturer's instructions.

[0031] qRT-PCR was performed using MonAmp™ SYBR. ® Green Master Mix kit (Mona Biotech, Suzhou), and used QuantStudio TM 5. Amplification and fluorescence detection were performed using a real-time PCR instrument (Applied Biosystems, USA). CmEF1α was used as an internal control, and the relative expression levels of each gene under different treatments were calculated using the 2-ΔΔCT method; among which, CmCHS The primers are CCACAGCCTCCCAACCACTA (SEQ ID NO:18) and TTAATACAAACGGATCCCTGCAA (SEQ ID NO:19), CmCHI The primers are CGCAGGTGTGAGAGGTATGGA (SEQ ID NO:20) and CTTACCAGCAAGCAACGGAAT (SEQ ID NO:21). CmDFR The primers are CGGAGAAAGCAGCATGGAAA (SEQ ID NO:22) and GGGAACGAGGGACTGATAAATG (SEQ ID NO:23). CmF3H The primers were CGGCCTAAGGTGCCATACAA (SEQ ID NO:24) and TCGGCCCTACGTGATTTGAT (SEQ ID NO:25). CmF3'HThe primers were AGTCTTGCATGATGGCAGGAT (SEQ ID NO:26) and AATTGGGTTGGGCCAGTTTTT (SEQ ID NO:27). Cm3GT The primers are GTACCCTGGGCACCACAAGT (SEQ ID NO:28) and CTACCAACGGCCTGCAAATC (SEQ ID NO:29). CmFLS The primers are ACCACTCTCCATGGCGTCTT (SEQ ID NO:30) and TCCCATGGTTCACCACTTGA (SEQ ID NO:31). CmFNS The primers were GCCCAGTCCTCCATCGTTAC (SEQ ID NO:32) and TAGCGGACCATAGCGAGTTGA (SEQ ID NO:33). CmANS The primers were CCTCCACGCCTAGCGATTAC (SEQ ID NO:34) and CAGCCCTCCGACTTCATTCTC (SEQ ID NO:35).

[0032] The quantitative real-time PCR reaction system consisted of: 5 μL SYBR Green Mix, 0.5 μL Forward Primer, 0.5 μL Reverse Primer, 1 μL cDNA, and 3 μL ultrapure water. The PCR program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 60℃ annealing and extension for 1 min, repeated 40 times; followed by a 30 s hold at 60℃. The melting curve was initiated at 60℃ and terminated at 95℃ for 1 s, with a temperature increment of 0.2℃ per cycle. The results showed that the transcriptional levels of the aforementioned anthocyanin synthesis-related structural genes were significantly downregulated under high-temperature conditions. Figure 3 ).

[0033] 2. Petal Transcriptome Analysis To elucidate the molecular mechanism by which high temperatures cause chrysanthemum petal color fading, transcriptome analysis was performed on chrysanthemum petals treated under different temperature conditions. Petal samples were collected from stages S2 to S5, where S2 represents the color-revealing stage, S3 the initial opening stage, S4 the initial flowering stage, and S5 the full bloom stage. Petals in the room-temperature treatment group were deep pink, while those in the high-temperature treatment group were light pink. Total RNA was extracted using TRIzol reagent, and qualified samples were screened for high-throughput sequencing, with three biological replicates for each treatment. Transcriptome sequencing was performed by Hangzhou Lianchuan Biotechnology Co., Ltd.

[0034] The raw data obtained from sequencing was first initially filtered using an in-house Perl script. Then, FastP software was used to further remove reads containing adapter sequences, reads shorter than 75 bp, reads with more than 5 uncertain bases, and low-quality reads (Q≤20), thus obtaining high-quality clean data for subsequent analysis. The high-quality reads were then aligned to the chrysanthemum reference genome using Hisat2 software. Chrysanthemum morifolium (Song A, Su J, Wang H, et al. Analyses of a chromosome-scale genome assembly reveal the origin and evolution of cultivated chrysanthemum[J]. Nature communications,2023, 14(1): 2021.), differential expression analysis was performed using DESeq2, with a screening criterion of qvalue < 0.05. Further, the Gene Ontology (GO) database and the Kyoto Encyclopedia of Genes and Genomes (KEGG) database were used to perform GO functional annotation and KEGG pathway enrichment analysis on the differentially expressed genes, respectively.

[0035] Transcriptome analysis results as follows Figure 4 As shown in the figure, GO enrichment analysis revealed that genes related to anthocyanin synthesis regulation were significantly enriched in pathways such as phenylalanine synthesis, anthocyanin metabolism, and flavonoid biosynthesis. Further cluster analysis of differentially expressed genes in the GO-enriched pathways divided them into five modules: module C1 mainly consisted of genes related to flavonoid biosynthesis and metabolism; modules C2 and C5 mainly involved abiotic stress response pathways; module C3 mainly participated in RNA synthesis and modification processes; and module C4 mainly covered regulatory pathways and hormone signal transduction pathways.

[0036] Analysis of flower color samples from the S2 stage revealed that high-temperature treatment significantly downregulated the expression levels of several key enzyme genes involved in anthocyanin synthesis pathways. Furthermore, the expression of RNA demethylase genes was also affected. CmALKBH10B Expression was significantly upregulated under high temperature conditions. The primers for qRT-PCR detection were F: GAAGGACGCGGTGATATCGT (SEQ ID NO:36) and R: CGATGAATCGCCCCGAAAAC (SEQ ID NO:37). The relevant results are shown below. Figure 5 A and Figure 5 B. Because CmALKBH10B Encoding an RNA demethylase suggests that it may work by affecting m6 A modification is involved in high-temperature-mediated regulation of anthocyanin metabolism.

[0037] Primers were designed based on the chrysanthemum genome sequence to target... CmALKBH10B Alleles of the gene in 'Nanjing Agricultural University's Fen Cui' were amplified and sequenced. Primer sequences are shown in Table 1. All PCR amplifications were performed using KOD FX DNA Polymerase (TOYOBOCO., LTD. Life Science Department, Osaka, Japan) on a Thermo Scientific Arktik thermal cycler according to the reaction system and conditions recommended in the product instructions. PCR products were sent to Nanjing Genscript Biotech Co., Ltd. for sequencing, and the sequencing results were analyzed using DNAman 6.0 software.

[0038] Table 1. Used for amplification CmALKBH10B primer pair sequence

[0039] Sequencing results showed that in 'Nanjing Agricultural University Pink Green', CmALKBH10B The genomic nucleotide sequence is shown in SEQ ID NO:1, the CDS nucleotide sequence is shown in SEQ ID NO:2, and the protein encoding sequence is shown in SEQ ID NO:3.

[0040] 3. m 6 A RNA methylation analysis To analyze whether the downregulation of anthocyanin gene expression under high temperature is related to m 6 A-related modifications were investigated. Three flower samples from the S2 stage were selected, and m-related modifications were detected in high-temperature and room-temperature control samples using liquid chromatography-tandem mass spectrometry (LC-MS / MS). 6 The ratio of A / A. The results show that the m of the high-temperature sample 6 The A / A ratio was not significantly different from the control at room temperature. Figure 6 (A in the middle).

[0041] Further whole transcriptome analysis was performed on samples from this period. 6A-sequencing analysis was performed, with two replicates for each treatment. The specific methods were as follows: petals of S2-stage 'Nannong Fencui' variegated ... 6 A specific antibody (Synaptic Systems, Germany) against m 6 The modified RNA fragment was subjected to immunoprecipitation, followed by cDNA synthesis and dUTP incorporation to complete the second-strand synthesis. Library construction included end repair, adapter ligation, AMPure XP magnetic bead screening, and PCR amplification steps, ultimately obtaining a library with an average length of approximately 300 bp, which was sequenced on the Illumina NovaSeq 6000 platform using 150 bp paired-end sequencing mode.

[0042] Raw sequencing data underwent quality control analysis using FastQC (v0.11.9). High-quality sequences after cleaning were aligned to the chrysanthemum reference genome using HISAT2 (v2.1.0). Chrysanthemum morifolium (Song A, Su J, Wang H, et al. Analyses of a chromosome-scale genome assembly reveal the origin and evolution of cultivated chrysanthemum[J]. Nature communications,2023, 14(1): 2021.); Subsequently, SAMtools (v1.15.1) was used to filter the alignment results, removing reads longer than 1000 bp and retaining alignment data of the expected length for subsequent analysis; MACS2 (v2.2.7.1) was used to identify m 6 A enrichment peak was set with parameters "-f BAMPE -g 8.2e9 -B --nomodel --extsize 150"; BEDTools (v2.25.0) was used to merge the sample-specific peaks to construct a consensus peak set, and featureCounts (v2.0.3) was used to quantify the number of reads within the consensus peak region; the difference m 6Peak A was analyzed using DESeq2 (v1.49.2); HOMER (v5.1.0) was further used to identify known and newly emerging m peaks. 6 A sequence motif, and m was processed using IGV (v2.18.2). 6 The distribution of peak A across the entire genome was visualized.

[0043] The results showed that high temperature caused m 6 The overall modification level of A showed no significant difference, but it was significantly downregulated in the CDS region and significantly upregulated in the 3'UTR region. Figure 6 (B in the text). Modification profile analysis detected m on multiple anthocyanin-related genes. 6 A modifications, including structural genes CmCHI , CmF3H and CmF3'H The widely reported positive regulator CmbHLH2, and the negative regulator CmPUB15 identified in chrysanthemum (… Figure 6 (C) in the text. CmALKBH10B The results of upregulation under high temperature conditions indicate that CmALKBH10B m may be involved in the transcription of anthocyanin metabolism-related genes under high temperature stress 6 A. Modification and regulation.

[0044] Example 2 CmALKBH10B Obtaining and phenotypic analysis of gene overexpression lines Based on the Gibson Assembly recombination principle, primers with homologous arms were designed to allow the amplified product to be directionally inserted into the EcoRI and BamHI restriction sites of the pORE-R4-35AA vector (Zhou LJ, Wang Y, Wang Y, Song A, Jiang J, Chen S, Ding B, Guan Z, Chen F. Transcription factor CmbHLH16 regulates petalanthocyanin homeostasis under different lights in Chrysanthemum. PlantPhysiology. 2022 Oct 1;190(2):1134-52.), thus constructing a recombinant overexpression vector driven by the 35S promoter. Using 'Nanjing Agricultural University's Fen Cui' cDNA as a template, primers R4-CmALKBH10B-F (SEQ ID NO:10) and R4-CmALKBH10B-R (SEQ ID NO:11) were used to amplify the product. CmALKBH10B The full-length CDS sequence was obtained and ligated into the pORE-R4-35AA vector, successfully constructing R4-E. GFP - CmALKBH10B Recombinant plasmids ( Figure 7 The plasmid was then transformed into *E. coli* DH5α competent cells for amplification, and further introduced into *Agrobacterium* EHA105 cells via electroporation to obtain the engineered strain Ab- 35S :: CmALKBH10B -GFP.

[0045] After cutting leaves from 'Nanong Fencui' aseptic tissue culture seedlings into leaf discs, Ab- 35S :: CmALKBH10B After infecting the plant with GFP bacterial solution for 10 min, the surface bacterial solution was blotted dry with filter paper and then inoculated into pre- / co-culture medium. The plant was incubated in the dark for 3 days, followed by four rounds of subculturing on selective medium. When the resistant shoots grew to 2-3 cm, they were transferred to rooting medium for further cultivation, thus obtaining resistant plants. All resistance screening, differentiation, and rooting stages were conducted at 20℃ with a light schedule of 16 h light / 8 h dark; each culture medium was used for 2 weeks.

[0046] The formulations of each culture medium are as follows (1 L): Basic MS medium: MS powder 4.74 g + sucrose 30 g + agar 6.6–7.0 g, pH 5.8; Pre- / co-culture medium: MS + 6-BA 2.0 mg + NAA 0.2 mg, pH 5.8; Selective medium: MS + 6-BA 1.0 mg + NAA 0.5 mg + Timentin 350 mg + Kan 15 mg, pH 5.8; Rooting medium: MS + Kan 15 mg + Timentin 350 mg, pH 5.8.

[0047] After resistance selection, differentiation, and rooting, four independent overexpression transgenic lines were obtained, named OE#9, OE#16, OE#18, and OE#31, respectively. The rooted transgenic plants were transplanted and cultured normally until they entered the budding stage. CmALKBH10B Expression levels were detected, and the flowers were then treated under the high-temperature conditions described in Example 1. The flower color phenotype was observed during the flowering stage. Phenotypic recording and sampling analysis were preferably performed during the peak flowering period of S5.

[0048] qRT-PCR analysis results showed that CmALKBH10B Transcriptional levels in all four overexpression lines were significantly higher than in the wild type, approximately 2–4 times higher. Figure 8(D in the text). Under high-temperature treatment, the petals of wild-type (WT) plants are light pink, while the flower color of overexpressed lines fades further, with the OE#9 line showing the most significant fading, its petals becoming almost white. Figure 8 (A) The total anthocyanin content in petals of different strains was measured, and it was found that the anthocyanin content of the overexpression strains was lower than that of the WT, with the OE#9, OE#16, OE#18 and OE#31 strains showing particularly significant decreases. Figure 8 The anthocyanin extract phenotype also showed that the overexpressing lines were significantly lighter in color (F); Figure 8 (C in the text). The above results indicate that overexpression CmALKBH10B It can promote the fading of chrysanthemum petals under high temperature conditions and reduce the accumulation of anthocyanins.

[0049] Example 3 CmALKBH10B Obtaining and phenotypic analysis of gene silencing lines Use WMD3 tool to filter. CmALKBH10B The amiRNA target of the gene was identified and corresponding primers were designed, resulting in the following 6 primer sequences: CmALKBH10B-I miR-s: gaTATTTCAGCACGTCGTGGCTCtctctcttttgtattcc (SEQ ID NO:12); CmALKBH10B-II miR-a: gaGAGCCACGACGTGCTGAAATAtcaaagagaatcaatga (SEQ ID NO:13); CmALKBH10B-III miRs: gaGAACCACGACGTGGTGAAATTtcacaggtcgtgatatg (SEQ ID NO:14); CmALKBH10B-IV miRa: gaAATTTCACCACGTCGTGGTTCtctacatatatattcct (SEQ ID NO:15); A: CTGCAAGGCGATTAAGTTGGGTAAC (SEQ ID NO:16); B: GCGGATAACAATTTCACACAGGAAACAG (SEQ ID NO:17).

[0050] Overlap PCR amplification was performed using primer combinations of CmALKBH10B-I miR-s / A, CmALKBH10B-III miRs / CmALKBH10B-II miR-a, B / CmALKBH10B-IV miRa, and A / B, respectively, to obtain complete amiRNA sequence DNA fragments. These fragments were then cloned into the pORE-R4-2×35AA vector between the KpnI and XbaI restriction sites, successfully constructing a DNA fragment targeting [a specific target / specific target]. CmALKBH10B Genes amiRNA Interference carrier 2×R4- CmALKBH10B The vector was then introduced into Agrobacterium EHA105 via electroporation to obtain the engineered strain Ab-2×R4- CmALKBH10B .

[0051] After cutting leaves from 'Nanjing Agricultural University Pink Green' aseptic tissue culture seedlings into leaf discs, Ab-2×R4- CmALKBH10B After 10 min of bacterial infection, the surface bacterial solution was blotted dry with filter paper and then inoculated into pre / co-culture medium. The culture was then incubated in the dark for 3 days, followed by transfer to selective medium for resistance screening, differentiation, and rooting culture, under the same conditions as in Example 2. Four independent regenerated transgenic lines were obtained through screening and named amiRNA#4, amiRNA#11, amiRNA#12, and amiRNA#15, respectively. The rooted transgenic plants were transplanted and cultured normally. Once the plants entered the budding stage, they were treated with the high-temperature conditions described in Example 1, and flower color phenotypes were observed during the flowering stage. Phenotypic recording and sampling analysis were preferably performed during the peak flowering period (S5).

[0052] qRT-PCR analysis results showed that CmALKBH10B The expression levels of amiRNA#4, amiRNA#11, amiRNA#12, and amiRNA#15 were significantly lower than those of the wild type, decreasing to approximately 0.6, 0.3, 0.7, and 0.25 times that of the wild type, respectively. Figure 8 E in the text). Under high-temperature treatment, the petals of wild-type (WT) plants were light pink, while the petals of all four amiRNA lines were significantly darker, turning pink. Figure 8 (B) The determination of total anthocyanin content in petals of different strains revealed that the anthocyanin content of the amiRNA strain was higher than that of WT (B). Figure 8 The anthocyanin extract phenotype also showed a significant darkening of the amiRNA line color (F in the text); Figure 8 (C in the text). The above results indicate that inhibiting... CmALKBH10B The expression of this substance can promote anthocyanin accumulation in chrysanthemums under high temperature conditions and delay petal fading, indicating that... CmALKBH10B It plays a negative regulatory role in the process of color regulation at high temperatures.

[0053] The above embodiments are used to illustrate the technical solutions of the present invention, and are not intended to limit the scope of protection of the present invention; all equivalent substitutions or modifications made within the spirit and principles of the present invention should be covered within the scope of protection of the present invention.

Claims

1. The application of a CmALKBH10B protein in regulating chrysanthemum flower color or cultivating new chrysanthemum varieties with stable flower color under high temperature conditions, characterized in that... The amino acid sequence of the CmALKBH10B protein is shown in SEQ ID NO:

3.

2. The application of the gene encoding the CmALKBH10B protein of claim 1 in regulating chrysanthemum flower color or cultivating new chrysanthemum varieties with stable flower color under high temperature conditions, characterized in that... The genomic nucleotide sequence of the gene is shown in SEQ ID NO:1, or the CDS nucleotide sequence is shown in SEQ ID NO:

2.

3. The application according to claim 1 or 2, characterized in that, The chrysanthemum mentioned is chrysanthemum ( Chrysanthemum morifolium The preferred species is the cultivated variety 'Nanong Fencui'.

4. Containing the contents of claim 2 CmALKBH10B Applications of recombinant overexpression vectors of genes, recombinant silencing vectors that specifically inhibit the expression of the gene, and recombinant transformants containing any of the above vectors in regulating chrysanthemum flower color or cultivating new chrysanthemum varieties with stable flower color under high temperature conditions.

5. The application according to claim 4, characterized in that, Downregulation or suppression CmALKBH10B Gene expression can slow down the fading process of chrysanthemum petals under high temperature conditions and maintain stable flower color; overexpression CmALKBH10B Genes can promote the lightening of chrysanthemum flower color under high temperature conditions.

6. The application according to claim 4, characterized in that, The recombinant silencing vector used to construct the gene expression was... amiRNA Interference fragments were obtained by overlapping PCR amplification using the following primer combinations: SEQ ID NO:12 and SEQ ID NO:16, SEQ ID NO:14 and SEQ ID NO:13, SEQ ID NO:17 and SEQ ID NO:15, and SEQ ID NO:16 and SEQ ID NO:

17.

7. The application according to claim 4, characterized in that, The recombinant overexpression vector is used to... CmALKBH10B The CDS sequence of the gene is constructed from the vector obtained in the expression vector.

8. The application according to claim 7, characterized in that, The CmALKBH10B The CDS sequence of the gene was obtained by amplification using the primers shown in SEQ ID NO:10 and SEQ ID NO:

11.

9. A method for cultivating new chrysanthemum varieties with stable flower color under high temperature conditions, characterized in that, The method includes downregulating or inhibiting the expression of CmALKBH10B protein or its encoding gene in chrysanthemum using plant genetic engineering technology, wherein the amino acid sequence of CmALKBH10B protein is shown in SEQ ID NO:

3.

10. A method for promoting the lightening of chrysanthemum petals under high temperature conditions, characterized in that, The method includes overexpressing the CmALKBH10B protein or its encoding gene in chrysanthemum using plant genetic engineering technology, wherein the amino acid sequence of the CmALKBH10B protein is shown in SEQ ID NO:3.