Preparation of aspergillus oryzae aspartic protease mutant and its application in production of light-flavor liquor
Patent Information
- Application Number
- CN202610867789.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-16
- Publication Date
- 2026-08-04
AI Technical Summary
但现阶段白酒酿造所用酸性蛋白酶多为天然菌株发酵产物,存在酶活力低、发酵环境适应性差等缺陷,调控效果有限,相关应用研究仍较少
[0029] The mutated protease described above was added together with Daqu (a type of starter culture) to the brewing raw materials for solid-state fermentation to produce light-aroma Baijiu. The optimal enzyme addition amount was 25 U/g. Under these conditions, the total activity of acidic protease in the mash increased, the metabolism rate of starch and reducing sugars accelerated, the total free amino acid content increased by 3.35 mg/g, and the alcohol yield increased by 5.22%. The total ester content of the finished liquor increased by 49.8%, and the contents of ethyl acetate, ethyl lactate, and 3-hydroxy-2-butanone increased by 78.7%, 59.7%, and 106.9%, respectively, while the fusel oil content decreased by 13.6%. The light-aroma Baijiu brewed with this enzyme exhibited aromas of starter culture, flowers, sweetness, and grassy aldehydes, with a richer flavor profile and better harmony. This invention provides an efficient and feasible enzyme preparation solution for improving the flavor and quality of light-aroma Baijiu and has broad application prospects.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the preparation of an Aspergillus oryzae aspartic protease mutant and its application in the production of light-aroma baijiu. Background Technology
[0002] Aspartic protease (EC 3.4.23.X) is an acidic protease that can catalyze the hydrolysis of protein peptide bonds into short-chain peptides and amino acids within a certain temperature range (30-60℃) and low pH environment (typically pH 2.0-5.0). It is widely used in food processing, alcohol brewing, and the feed industry. Currently, the production of acidic proteases mainly relies on microbial fermentation, but existing strains of fermented acidic proteases generally suffer from low enzyme activity, failing to meet the demands of large-scale industrial applications. Heterologous expression technology is an effective means to overcome this bottleneck, among which Pichia pastoris (… Komagataella phaffii , old name Pichia pastoris With its advantages of high expression efficiency and easy product purification, it has become the preferred host for heterologous and efficient expression of proteases, providing a reliable technical route for the preparation of high-activity aspartic proteases.
[0003] Fusel oil is a mixture of higher alcohols produced by yeast metabolism of amino acids during the fermentation of baijiu (Chinese liquor). Excessive fusel oil content can lead to post-consumption discomfort, inhibit yeast fermentation activity, and disrupt the flavor harmony of the liquor. It is a core control indicator for quality optimization in the baijiu industry. Currently, the main methods for removing fusel oil in the baijiu industry are distillation and resin adsorption. Chinese patent (CN201510376558.X) provides a method for removing fusel oil using slow distillation combined with rectification heads, achieving a removal rate of 23.5%-60.0%. Chinese patent (CN202011153079.3) uses macroporous resin as the treatment medium, employing activation pretreatment, wet packing, dynamic adsorption, gradient desorption, and enhanced regeneration steps to efficiently remove fusel oil from baijiu and improve its quality. Chinese patent (CN202211396226.9) uses adsorption resin modified with activated manganese dioxide to filter alcohol vapor, thereby reducing the fusel oil content. However, the above methods have obvious limitations. Distillation can easily lead to the loss of flavor substances, while resin adsorption has high operating costs and complicated adsorbent regeneration, making it difficult to achieve efficient, low-cost, and large-scale application.
[0004] Biological methods are an important development direction for regulating fusel oils, mainly including two categories: microbial catalysis and enzymatic catalysis. Regarding microbial catalysis, a Chinese patent (CN202010519069.0) describes the isolation and purification of a brewing yeast from baijiu mash. This yeast, when combined with other microorganisms such as Rhizopus, forms a mixed koji for use in the brewing of light-aroma baijiu, achieving a reduction in fusel oils in the original liquor. However, this method suffers from poor fermentation stability, limited compatibility with different aroma profiles, and significant challenges in large-scale implementation. In terms of enzymatic catalysis, acidic proteases can inhibit fusel oil formation mediated by the Ehrlich pathway by regulating amino acid metabolic flow. Chinese patent (CN201811433238.2) describes a method for fermenting rice-aroma baijiu by adding 0.05-0.1% acidic protease produced through the co-fermentation of Aspergillus oryzae and Bacillus subtilis, and 0.1-0.3% acid-resistant saccharifying enzyme from *E. emblica*, along with rice slurry (rich in lactic acid bacteria) and *Rhizopus oryzae* bran koji, followed by distillation after 13-15 days of fermentation, resulting in a rice-aroma baijiu with high ethyl lactate and low fusel oil content. However, currently, the acidic proteases used in baijiu brewing are mostly fermentation products of natural strains, which have drawbacks such as low enzyme activity and poor adaptability to the fermentation environment, limiting their regulatory effects, and related application research remains limited.
[0005] In the fermentation process of light-aroma baijiu, the low activity of endogenous acidic protease in the daqu (fermentation starter culture) is a significant reason for its high fusel oil content and insufficient flavor harmony. To date, there are no reports, either domestically or internationally, on the application of high-activity aspartic protease in light-aroma baijiu fermentation to regulate fusel oil content. Therefore, leveraging genetic engineering technology to enhance the heterologous expression level of aspartic protease, constructing high-activity recombinant engineered strains, and applying them to the light-aroma baijiu fermentation system to achieve precise regulation of fusel oil content is a key technical challenge urgently needing to be overcome in the field of light-aroma baijiu quality optimization, and it is also the core starting point and innovative direction of this invention. Summary of the Invention
[0006] The main problem this invention aims to solve is how to construct highly active recombinant engineered strains and use them to regulate the content of fusel oils during the fermentation of light-aroma baijiu, in order to improve the quality of baijiu.
[0007] To address the above problems, the present invention provides the following aspartic protease mutant, wherein the mutant is either A1) or A2): A1) Mutating one or more amino acid residues of the wild-type aspartic protease; specifically, the following mutation types: 1) Replace G with N at position 131 of the amino acid sequence of the wild-type aspartic protease; and / or 2) Replace F with W at position 218 of the wild-type aspartic protease amino acid sequence; and / or 3) Replace A with E at position 228 of the wild-type aspartic protease amino acid sequence; A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of A1); The wild-type aspartic protease was derived from Aspergillus oryzae (… Aspergillus oryzae Its amino acid sequence is SEQ ID No:1 and its nucleotide sequence is SEQ ID No:2.
[0008] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0009] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0010] In the above text, the fusion protein obtained by the linking tag and having the same function can specifically be a protein whose amino acid sequence is any of SEQ ID No:3 to SEQ ID No:6.
[0011] The present invention also provides biomaterials related to the said mutant, said biomaterials may be any of the following: B1) Encodes the nucleic acid molecule of the aspartic protease mutant described above; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecules described in B1); B4) A recombinant vector containing the expression cassette described in B2); B5) Recombinant microorganisms containing the nucleic acid molecules described in B1); B6) Recombinant microorganisms containing the expression cassette described in B2); B7) Recombinant microorganisms containing the recombinant vector described in B3); B8) Recombinant microorganisms containing the recombinant vector described in B4).
[0012] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0013] Those skilled in the art can easily mutate the nucleotide sequence of the protein encoding the present invention using known methods, such as directed evolution or point mutation.
[0014] Furthermore, the nucleic acid molecule described in B1) is any of the following DNA molecules: d1) The nucleotide sequence is the DNA molecule shown in SEQ ID No:7; d2) The nucleotide sequence is the DNA molecule shown in SEQ ID No:8; d3) The nucleotide sequence is the DNA molecule shown in SEQ ID No:9; d4) The nucleotide sequence is the DNA molecule shown in SEQ ID No:10; d5) Hybridizes under strict conditions with the nucleotide sequences defined by d1) to d4) and encodes the DNA molecule of the mutant described above.
[0015] The vectors described herein are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cos plasmids), Ti plasmids, or viral vectors.
[0016] In the above text, the recombinant microorganism is a recombinant yeast.
[0017] The recombinant yeast mentioned above is recombinant Pichia pastoris.
[0018] The recombinant Pichia pastoris described above was constructed according to the method described below.
[0019] The present invention also provides a method for constructing recombinant Pichia pastoris, the method comprising introducing the coding gene of any of the mutants described in claims 1-5 into the recipient Pichia pastoris.
[0020] Furthermore, the gene encoding the mutant can be generated by the alcohol oxidase promoter P. AOX1 Formaldehyde dehydrogenase promoter P FLD1 Formate dehydrogenase promoter P FDH1 or P (d1+2×201AOX1) Promoter-driven expression.
[0021] The alcohol oxidase promoter P AOX1The nucleotide sequence is SEQ ID No:11: 5’-GATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAA-3’; The formaldehyde dehydrogenase promoter P FLD1The nucleotide sequence is SEQ ID No:12: 5’-GCATGCAGGAATCTCTGGCACGGTGCTAATGGTAGTTATCCAACGGAGCTGAGGTAGTCGATATATCTGGATATGCCGCCTATAGGATAAAAACAGGAGAGGGTGAACCTTGCTTATGGCTACTAGATTGTTCTTGTACTCTGAATTCTCATTATGGGAAACTAAACTAATCTCATCTGTGTGTTGCAGTACTATTGAATCGTTGTAGTATCTACCTGGAGGGCATTCCATGAATTAGTGAGATAACAGAGTTGGGTAACTAGAGAGAATAATAGACGTATGCATGATTACTACACAACGGATGTCGCACTCTTTCCTTAGTTAAAACTATCATCCAATCACAAGATGCGGGCTGGAAAGACTTGCTCCCGAAGGATAATCTTCTGCTTCTATCTCCCTTCCTCATATGGTTTCGCAGGGCTCATGCCCCTTCTTCCTTCGAACTGCCCGATGAGGAAGTCCTTAGCCTATCAAAGAATTCGGGACCATCATCGATTTTTAGAGCCTTACCTGATCGCAATCAGGATTTCACTACTCATATAAATACATCGCTCAAAGCTCCAACTTTGCTTGTTCATCATTCTTGATATTCACA-3’; The formate dehydrogenase promoter P FDH1 The nucleotide sequence of the promoter P (d1+2×201AOX1) is SEQ ID No:14: 5’-AGATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGTTGTTGATCTTGACTACTTTTAACGATAACTTGAGAAGATCTAAGAATAACTAACTGTTTGAAACTATGGCTAT-3’。
[0022] Furthermore, the N-terminus of the coding gene of the mutant is fused with an S... MF4I Signal peptide, the S MF4I The nucleotide sequence of the signal peptide is SEQ ID No:15: 5'-ATGGCTATTCCAAGATTTCCATCTATTTTCATTGCTGTTTTGTTTGCTGCTTCTTCTGCTCTAGCTGCTCCAGTTAATACTACAACCGAAGATGAAACTGCTCAAATTCCAGCTGAGGCTGTTATTGGTTACTCTGATTT GGAAGGTGATTTTGATGTTGCCGTTTTGCCATTTTCTAACTCTACTAACAACGGTTTGTTGGAAGAGGCTGAAGCAGAGGCCGAACCAAAGTTTATCAACACTACTATAGCTTCTATTGCTGCAAAGGAAGAAGGAGTT-3'.
[0023] The present invention also provides a method for preparing an aspartic protease mutant, comprising introducing the coding gene of the mutant described above into a recipient microorganism to obtain a recombinant microorganism expressing the mutant described above, culturing the recombinant microorganism, and obtaining the aspartic protease mutant from the fermentation product.
[0024] In this document, the introduction can be described as transforming a vector carrying the DNA molecule of the present invention into a host bacterium using any known transformation method, such as chemical transformation or electroporation. The introduced DNA molecule can be a single copy or multiple copies. The introduction can be the integration of a foreign gene into the host chromosome or the expression of a plasmid outside the chromosome.
[0025] In one specific embodiment, the method for preparing the aspartic protease mutant includes culturing the recombinant Pichia pastoris described above, obtaining a fermentation product, and obtaining the aspartic protease mutant from the fermentation product.
[0026] The application of the mutant described above or the method for preparing the aspartic protease mutant in the solid-state fermentation of light-aroma baijiu is also within the scope of protection of this invention.
[0027] The present invention also provides a method for improving the quality of light-aroma baijiu, the method comprising mixing the protease described above with daqu and adding it to the brewing raw materials for solid-state fermentation to brew light-aroma baijiu, wherein the solid-state fermentation temperature is 25-40 ℃ and the fermentation time is 7-14 days; The brewing raw materials consist of sorghum, rice husks, and distiller's grains, wherein the amount of rice husks added is 20-25% of the total weight of sorghum, and the amount of distiller's grains added is 3.5-4.0 times the total weight of sorghum. The amount of protease added is 5-40 U / g (based on sorghum), and the amount of Daqu added is 20-25% of the total weight of sorghum; The following are methods to improve the quality of light-aroma baijiu: 1) Increase the content and accumulation rate of free amino acids in baijiu; 2) Increase the content of esters and decrease the content of higher alcohols in baijiu; 3) Increasing the moisture content in the mash increases the rate of starch and reducing sugar consumption, and decreases acidity; 4) Improves the astringency and harshness of the wine.
[0028] This invention uses Aspergillus oryzae ( Aspergillus oryzae Using aspartic protease derived from [a specific enzyme name] as the parent, four mutants with increased specific activity were obtained. Among them, mutant M4 (G131N / F218W / A228E) had the highest specific activity at 329.9 U / mg, which is 1.6 times that of the parent enzyme. A promoter and signal peptide substitution strategy was employed to achieve high-level expression of mutant M4 in Pichia pastoris GS115. The recombinant strain (pPIC9K-P [a specific enzyme name]) was also used. (d1+2×201AOX1) -S MF4I - Ao The enzyme activity of pepA(M4) in the fermentation broth reached 1,6620.0 U / mL in a 5 L fermenter. The optimal catalytic conditions for the pure enzyme were pH 3.0 and 50 °C, and it exhibited good stability at pH 2.0-6.0 and 40 °C.
[0029] The mutated protease described above was added together with Daqu (a type of starter culture) to the brewing raw materials for solid-state fermentation to produce light-aroma Baijiu. The optimal enzyme addition amount was 25 U / g. Under these conditions, the total activity of acidic protease in the mash increased, the metabolism rate of starch and reducing sugars accelerated, the total free amino acid content increased by 3.35 mg / g, and the alcohol yield increased by 5.22%. The total ester content of the finished liquor increased by 49.8%, and the contents of ethyl acetate, ethyl lactate, and 3-hydroxy-2-butanone increased by 78.7%, 59.7%, and 106.9%, respectively, while the fusel oil content decreased by 13.6%. The light-aroma Baijiu brewed with this enzyme exhibited aromas of starter culture, flowers, sweetness, and grassy aldehydes, with a richer flavor profile and better harmony. This invention provides an efficient and feasible enzyme preparation solution for improving the flavor and quality of light-aroma Baijiu and has broad application prospects. Attached Figure Description
[0030] Figure 1 Enzyme production process in a 5 L fermenter.
[0031] Figure 2 This is a purified electrophoresis image of the aspartic protease mutant M4.
[0032] Figure 3Figures A and B show the enzymatic properties of the aspartic protease mutant M4. A represents the optimum pH; B represents pH stability; C represents the optimum temperature; and D represents temperature stability. (In Figures A and B, ■ represents KCl-HCl (pH 1.0-2.0); ● represents lactic acid-sodium lactate (pH 2.0-3.0); ▲ represents citric acid-sodium citrate (pH 2.5-6.5); and ▼ represents sodium dihydrogen phosphate-disodium hydrogen phosphate (pH 6.0-7.0)).
[0033] Figure 4 The effect of aspartic protease mutants on the number of countable microorganisms in light-aroma baijiu mash; where: A represents the number of viable bacteria; B represents the number of viable Enterobacteriaceae; C represents the number of viable lactic acid bacteria; and D represents the number of viable fungi.
[0034] Figure 5 The effect of different amounts of aspartic protease mutants on the physicochemical properties of light-aroma baijiu mash was investigated. Where: A represents moisture; B represents temperature; C represents starch content; D represents acidity; and E represents reducing sugar. Detailed Implementation
[0035] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0037] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0038] pPIC9K- in the following embodiments AoThe pepA recombinant plasmid has been described in: Yibin Xue. High-level secretory expression and characterization of an acid protease in Komagataellaphaffii and its application in soybean meal protein degradation. International Journal of Biological Macromolecules, 2024, 282(Pt4): 137001. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.
[0039] The methods used to determine protease activity in the following examples are based on those of Anson et al. (Anson, ML Theestimation of pepsin, trypsin, papain and cathepsin with hemoglobin. Journal of General Physiology, 1938, 22: 79). 89) and GB / T23527.1—2023: Use 50 mM lactic acid Prepare a 1% casein solution using sodium lactate buffer (pH 3.0, water as solvent). Incubate 100 μL of enzyme solution and 100 μL of casein solution at 50 °C for 10 min, then terminate the reaction by adding 200 μL of 0.4 M trichloroacetic acid solution. Centrifuge at 12,000 rpm for 5 min, and take 100 μL of the supernatant. Add 500 μL of 0.4 M Na₂CO₃ solution and 100 μL of Folin reagent, incubate at 50 °C for 20 min, and then measure the OD₂O₃ concentration. 680nm The absorbance was measured. An enzyme solution in which trichloroacetic acid was added first to terminate the reaction was used as a control. The amount of enzyme required to hydrolyze casein to produce 1 μg of tyrosine per minute is defined as one unit of enzyme activity (U).
[0040] The following examples use statistical software to process the data, and the experimental results are expressed as mean ± standard deviation.
[0041] Example 1: Construction of aspartic protease mutant strain 1. Aspergillus oryzae ( Aspergillus oryzae Site-directed mutation of aspartic protease from ) Using site-directed mutagenesis to target Aspergillus oryzae ( Aspergillus oryzaeMutation screening was performed on aspartic protease (amino acid sequence as shown in SEQ ID No:1, nucleotide sequence as shown in SEQ ID No:2) from the source in order to obtain mutants with high aspartic protease activity.
[0042] According to reports, aspartic proteases enhance catalytic activity and thermal stability. Bs apa and pepsin, aspartic protease Ao Multiple sequence alignment was performed between the pepA sequence and the two sequences to analyze the location of the mutation sites in the three-dimensional structure of the protein. Loop flexible regions far from the catalytic active sites (D111, D293) and α-helical regions, which would not affect the catalytic activity of the enzyme, were selected, and the mutation sites were determined to be G131N, N208A, F218W and A228E.
[0043] pPIC9K- Ao Using the pepA recombinant plasmid as a template, all mutants were constructed by PCR amplification using the primers in Table 1.
[0044] Table 1. Primers used for mutations
[0045] PCR system: 10 × Fast PFU buffer 10 μL, dNTPs 4 μL, Mg2SO4 2 μL, forward and reverse primers 1 μL each, template 1 μL, Fast PFU DNA polymerase 1 μL, and pure water to a final volume of 50 μL. PCR reaction conditions: 95 ℃ for 2 min, 95 ℃ for 20 s, 55 ℃ for 20 s, 72 ℃ for 4 min, 34 cycles, 72 ℃ for 5 min, 4 ℃ for 10 min. The amplified PCR products were digested with DpnI digestive enzyme at 37 ℃ for 2 h, transformed into *E. coli* DH5α competent cells, plated on LB agar plates containing ampicillin (100 μg / mL), single colonies were picked, and sequencing was used to verify the correct transformants. The transformants were cultured overnight at 37 ℃ on a shaker, and all mutant plasmids pPIC9K- were extracted. Ao pepA-M1, pPIC9K- Ao pepA-M2, pPIC9K- Ao pepA-M3, pPIC9K- Ao pepA-M4.
[0046] mutant plasmid pPIC9K- Ao pepA-M1, pPIC9K- Ao pepA-M2, pPIC9K- Ao pepA-M3, pPIC9K- Ao pepA-M4 and pPIC9K- Ao The only difference between pepA and pepA is that: Ao The amino acid "G" at position 131 of the coding sequence pepA in SEQ ID No:1 is replaced with amino acid "N"; or the amino acid "F" at position 218 is replaced with amino acid "W"; or the amino acid "A" at position 228 is replaced with amino acid "E"; or the amino acid "G" at position 131 is replaced with amino acid "N" and the amino acid "F" at position 218 is replaced with amino acid "W" and the amino acid "A" at position 228 is replaced with amino acid "E".
[0047] All mutant plasmids were linearized using the restriction endonuclease SalI, recovered by alcohol precipitation, and electroporated into Pichia pastoris GS115 competent cells. The bacterial culture was plated on MD plates and incubated at 30 °C for 48 h. Single colonies from the MD plates were picked and inoculated into BMGY medium (1% yeast extract, 2% tryptone, 1.34% YNB, 4 × 10⁻⁶ biotin). -5 Yeast extract was cultured in 1% glycerol, 100 mmol / L phosphate buffer (pH 6.0) at 30 °C with shaking at 200 r / min for 24 h. After 24 h, it was transferred to BMMY medium (1% yeast extract, 2% tryptone, 1.34% YNB, 4 × 10⁻⁶ biotin). -5 The enzyme was induced to produce enzymes by adding 1.0% methanol (v / v) to a 100 mmol / L phosphate buffer (pH 6.0) solution every 24 h. After 5 days of culture, the enzyme was centrifuged at 8000 r / min for 5 min, and the supernatant was collected to determine the protease activity and protein concentration.
[0048] The results are shown in Table 2: Single-point mutations revealed that the enzyme activities of mutants at sites G131N, F218W, and A228E were increased compared to the parental enzyme, while the N208A mutant lost its enzyme activity. Combining mutations at these three effective sites yielded enzymes with further increased activity. Ao The pepA mutant M4 (G131N / F218W / A228E) has the highest specific enzyme activity, at 329.9 U / mg, which is 1.6 times that of the parent enzyme.
[0049] Table 2. Comparison of enzyme activities between parental enzymes and mutant enzymes
[0050] 2. High-efficiency expression of aspartic protease mutants derived from Aspergillus oryzae Based on the methanol-induced promoter P reported in the literature AOX1The mutant library was modified to modify the AOX1 promoter (nucleotide sequence as shown in SEQ ID No:11) on the pPIC9K vector.
[0051] To increase the expression level of the aspartic protease mutant, the recombinant plasmid pPIC9K- Ao The alcohol oxidase promoter P in pepA(M4) AOX1 (The nucleotide sequence is shown in SEQ ID No:11) Replace each of them with the formaldehyde dehydrogenase promoter P. FLD1 (nucleotide sequence as shown in SEQ ID No:12), formate dehydrogenase promoter P FDH1 (nucleotide sequence as shown in SEQ ID No:13) and P (d1+2×201AOX1) (The nucleotide sequence is shown in SEQ ID No:14), and it is linked to the aspartic protease gene to form a loop, constructing the recombinant expression plasmid pPIC9K-P. FLD1 -AopepA(M4), pPIC9K-P FDH1 -AopepA(M4), pPIC9K-P (d1+2×201AOX1) -AopepA(M4).
[0052] Recombinant expression plasmid PIC9K-P FLD1 -AopepA(M4), pPIC9K-P FDH1 -AopepA(M4), pPIC9K-P (d1+2×201AOX1) -AopepA(M4) and pPIC9K- Ao The only difference between pepA(M4) and pPIC9K- is that pPIC9K- Ao The DNA molecule with the nucleotide sequence shown in SEQ ID No:11 in pepA(M4) is replaced with SEQ ID No:12, SEQ ID No:13, and SEQ ID No:14.
[0053] The recombinant expression plasmid was transformed into Pichia pastoris GS115 (a product of Shanghai Weidi Biotechnology Co., Ltd.) for expression. Based on the codon bias of Pichia pastoris, the α-factor signal peptide sequence of Saccharomyces cerevisiae derived from the pPIC9K vector was codon optimized, and three amino acids, AIP (GCTATTCCA), were added after the starting amino acid M, naming it S. MF4I The modified signal peptide nucleotide sequence is shown in SEQ ID No:15.
[0054] pPIC9K-P (d1+2×201AOX1) - Ao S on pepA(M4) recombinant plasmid α-MF(The nucleotide sequence is SEQ ID No:16:5'-ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAG AAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT-3') replaced with S MF4I (The nucleotide sequence is shown in SEQ ID No:15), and it was linked to the aspartic protease gene to form a circular structure to construct a recombinant expression plasmid. The recombinant plasmid was then transformed into Pichia pastoris GS115 (a product of Shanghai Weidi Biotechnology Co., Ltd.) for expression.
[0055] The enzyme activity assay results are shown in Table 3: strain GS115 / pPIC9K-P (d1+2×201AOX1) -S MF4I - Ao The enzyme activity of the fermentation supernatant of pepA (M4) was 227.5 U / mL, which is pPIC9K- Ao The activity of pepA(M4) enzyme is 1.4 times that of pPIC9K- Ao It has 2.2 times the activity of pepA enzyme.
[0056] Table 3. Comparison of enzyme activities among different recombinant strains
[0057] Example 2: Production and purification of aspartic protease mutant M4 in a 5 L fermenter 1. Fermentation production of aspartic protease mutant The mutant strain GS115 / pPIC9K-P with the highest enzyme activity from Example 1 was used. (d1+2×201AOX1) -S MF4I - Ao pepA(M4) was inoculated into a 5 L fermenter for scale-up culture. The fermentation method and the preparation of the culture media (seed medium BMGY, basic fermentation medium BSM, glycerol fed-batch medium and 100% methanol induction medium) were in accordance with the Pichia Fermentation Process Guidelines (Version B, 053002, Invitrogen).
[0058] The entire fermentation process consists of three stages: basic culture, fed-batch glycerol culture, and 100% methanol-induced culture.
[0059] Seed culture: Select strains with high enzyme production levels during shake-flask fermentation, inoculate into 150 mL of BMGY medium, and simultaneously add 0.05% (w / v) yeast extract and 0.02% (w / v) monosodium glutamate as supplementary nitrogen sources. Incubate at 30 ℃ and 200 rpm until OD reaches [value missing]. 600nm It is around 10.0.
[0060] Basic culture: Inoculate into a 5 L fermenter (containing 1.5 L of basic fermentation medium BSM, with 0.3% (w / v) sodium glycerophosphate added as a phosphorus source supplement), sterilize the fermenter, control the pH to 5.0, add 14.35 mL / L of PTM starting fermentation broth, inoculate 10%, rotate at 600 rpm, and maintain the temperature at 30 ℃. Once the glycerol is completely consumed (dissolved oxygen level rises rapidly and remains stable for about 30 minutes), begin the glycerol feeding stage.
[0061] Feed-on culture with glycerol: 50% (w / v) glycerol was fed on, maintaining a temperature of 30 °C and pH of 5.0. Dissolved oxygen was constantly monitored, and the feeding rate was adjusted to maintain dissolved oxygen above 15%. The feeding time was 8-10 h, and feeding was stopped when the cell wet weight reached 220-250 g / L. Induction culture stage with 100% methanol and 50% D-sorbitol: Glycerol feeding was stopped, and the strain was starved for 0.5-1.5 h. The fermentation speed was adjusted to 800-900 r / min, the pH was adjusted to 6.0, the fermentation temperature was adjusted to 27 °C, and the aeration rate was controlled at 1-2 vvm. A 1:1 ratio of 100% methanol and 50% D-sorbitol medium containing 12 mL / L PTM1 solution was fed on, with an initial feeding rate of 3.5 mL / h / L. The feeding rate was then gradually increased according to the dissolved oxygen level (>20%). During fermentation, samples were taken to determine cell wet weight, protein content, and enzyme activity.
[0062] See results Figure 1 The enzyme activity reached its peak after 192 h of fermentation, with the enzyme activity in the fermentation supernatant being 16,620 U / mL and the protein concentration being 45.7 g / L.
[0063] 2. Purification of aspartic protease mutant M4 Collect the fermentation supernatant from step 1 and dialyze it overnight in 50 mmol / L pH 6.0 phosphate buffer. After dialyzing, centrifuge at 10,000×g for 5 min to obtain crude enzyme solution.
[0064] The crude enzyme solution was further purified into recombinant protein using Q-Sepharose anion exchange chromatography. The specific steps are as follows: Equilibrate the Q-Sepharose column (1×5 cm) to 5-10 column volumes using the above buffer solution, and load the collected enzyme solution at a flow rate of 0.5 mL / min. Elute linearly to OD using 50 mmol / L phosphate buffer containing 500 mmol / L NaCl (pH 6.0) until the flow rate reaches 0.5 mL / min. 280nm For samples with a protein concentration <0.1, the eluted fractions exhibiting aspartic protease activity were collected. Protein purity was analyzed using SDS-PAGE, and the purified product was obtained by dialysis. Protein content was determined using the Lowry method, with bovine serum albumin as the standard protein.
[0065] The aspartic protease mutant M4 was further purified by Q-Sepharose anion exchange chromatography to obtain electrophoretic grade pure enzyme with a molecular weight of approximately 42.5 kDa. Figure 2 The enzyme recovery rate was 78.5%, the purification fold was 1.7 times, and the specific enzyme activity was 618.3 U / mg (Table 4).
[0066] Table 4. Purification results of aspartic protease mutant M4
[0067] Example 3: Enzymatic properties of aspartic protease mutant M4 1. Optimal pH and pH stability The electrophoretic-grade purified enzyme from Example 2 was used as the test enzyme solution. According to the aforementioned enzyme activity assay method, the optimal pH value of the enzyme was determined using the following buffer systems (50 mM) with different pH values: KCl-HCl, pH 1.0-2.0; lactate-sodium lactate, pH 2.0-3.0; citric acid-sodium citrate, pH 2.5-6.5; sodium dihydrogen phosphate-disodium hydrogen phosphate, pH 6.0-7.0. Then, the protease activity was determined at 40℃ using the standard method, with the highest enzyme activity considered as 100%, and the relative enzyme activity measured at each pH was calculated.
[0068] The electrophoretic-grade purified enzyme from Example 2 was used as the test enzyme solution. It was placed in buffer solutions with pH values ranging from 1.0 to 7.0, and treated in a 40°C water bath for 30 min. Afterward, it was rapidly cooled in ice water for 30 min. The enzyme activity was then measured using the method described above. The relative enzyme activity of the untreated aspartic protease mutant M4 was calculated as 100% after different pH treatments.
[0069] The results are as follows Figure 3 As shown, the optimal pH for mutant M4 is 3.0, and after incubation for 30 min in the pH range of 2.0-6.0, more than 80% of the enzyme activity remains.
[0070] 2. Optimal temperature and temperature stability The electrophoretic grade pure enzyme from Example 2 was used as the enzyme solution to be tested. According to the enzyme activity assay method described above, it was appropriately diluted in 50 mM pH 3.0 lactate-sodium lactate buffer and the enzyme activity of the protease was measured at different temperatures ranging from 30 to 70 °C. The highest enzyme activity value was taken as 100%, and the relative enzyme activity measured at each temperature was calculated.
[0071] The electrophoretic-grade purified enzyme from Example 2 was used as the test enzyme solution. It was incubated at 30-70 °C for 30 min, then rapidly cooled in ice water for 30 min. After cooling, the enzyme activity was measured using the method described above. The relative enzyme activity of the mutant M4 after treatment at different temperatures was calculated, with the activity of the untreated aspartic protease M4 as 100%.
[0072] The results are as follows Figure 3 As shown, the optimal temperature for mutant M4 is 50 ℃, and it can maintain more than 80% of its enzyme activity below 40 ℃.
[0073] Example 4: Effects of aspartic protease mutant M4 on the microbial structure of light-aroma baijiu mash. The raw materials for Baijiu (Chinese liquor) come from Beijing Red Star Co., Ltd. (Beijing, China). The preparation of light-aroma Baijiu uses 60 kg of sorghum, 0.3 kg of rice husks, and 4.8 kg of distiller's grains as raw materials. 42 kg of 70°C hot water is added to the sorghum and rice husks, stirred, and allowed to stand for 30-40 minutes. The moistened materials are then steamed at 110°C for 40 minutes in a traditional museum-style still. The steamed materials are then added to the distiller's grains, mixed, and cooled to 25-30°C. 12 kg of Daqu (a type of starter culture) is added and mixed thoroughly. Then, aspartic protease with enzyme activities of 0, 10, 15, 20, and 25 U / g (based on sorghum content) and 0.18 kg of cooled water are added, mixed, and transferred to fermentation tanks. The tanks are placed in a 30°C environment for fermentation for 7-14 days.
[0074] After fermentation, the mash is lightly spread and placed into a special still for baijiu (Chinese liquor) using a method of steaming. Saturated steam is introduced for distillation, and the temperature at the top of the still is controlled at 95-100 ℃ and the steam pressure at 0.02-0.04 MPa. Subsequently, a fractional distillation process is adopted. In the initial stage of distillation, the heads (≥75% vol) are collected and stored separately. In the middle stage, the body (60-70% vol) is collected, and in the later stage, the tails (40-55% vol) are collected. The body and tails are retained. Finally, the retained body and tails are blended in a certain proportion to obtain the finished base liquor with a target alcohol content of 65% vol.
[0075] Nine-point sampling was used to collect samples of the fermented mash. Each fermentation tank was divided into three sampling areas: upper, middle, and lower. Samples were taken from the middle and two corners of each layer, for a total of nine points. Samples of the fermented mash at different fermentation stages were collected, packaged, labeled, and frozen at -80℃ for later use.
[0076] The experimental group was supplemented with 25 U / g of purified aspartic protease mutant M4 enzyme, while the control group was not supplemented with purified aspartic protease mutant M4 enzyme. The number of culturable microorganisms in the mash samples was analyzed using the dilution plate count method. The specific procedure was as follows: 1 g of sample (dry weight) was mixed with 9 mL of sterile water, and 1 mL of the diluent was diluted 10-fold. Three suitable dilutions were selected, and each dilution was repeated at least three times.
[0077] The results are as follows Figure 4 As shown, the trends in the number of bacteria, fungi, lactic acid bacteria, and enterobacteria in the mash of the control and experimental groups were quite similar, both reaching their peak on the second day of fermentation, with the experimental group showing a faster growth rate. After 14 days of fermentation, the number of bacteria and enterobacteria in the mash of the experimental group was significantly lower than that in the control group, while the number of lactic acid bacteria was significantly higher, and the number of fungi was not significantly different.
[0078] Example 5: Effect of aspartic protease mutant M4 on the content of free amino acids in light-aroma baijiu mash. The baijiu mash from Example 4 was used as the experimental sample. The experimental group consisted of baijiu mash supplemented with 25 U / g of aspartic protease mutant M4 pure enzyme, while the control group did not contain the aspartic protease mutant M4 pure enzyme. Free amino acids in the mash were detected using high-performance liquid chromatography (method II) as specified in GB / T30987—2020 "Determination of Free Amino Acids in Plants".
[0079] The results are shown in Tables 5 and 6. The total free amino acid content in both the control and experimental groups generally increased with the fermentation process, with slight fluctuations in between. Compared to the control group, the accumulation rate of free amino acids in the experimental group was significantly higher, with the total free amino acid content at the fermentation endpoint increasing by 3.35 mg / g. Specifically, the fermentation endpoint contents of umami amino acids (aspartic acid Asp, glutamic acid Glu) and sweet amino acids (serine Ser, threonine Thr, alanine Ala, proline Pro) in the experimental group were higher than those in the control group. The contents of bitter amino acids (valine Val, leucine Leu, isoleucine Ile, phenylalanine Phe, etc.) also showed varying degrees of increase compared to the control group. Furthermore, almost all essential amino acids (such as Thr, Val, Met, Ile, Leu, Phe, Lys, and His) accumulated in the experimental group, especially the increases in threonine Thr, phenylalanine Phe, isoleucine Ile, and leucine Leu.
[0080] Table 5. Changes in total free amino acid content in the control group mash
[0081] Table 6. Changes in total free amino acid content in the experimental group mash
[0082] Example 6: Effects of aspartic protease mutant M4 on the physicochemical properties of light-aroma baijiu mash. The baijiu mash from Example 4 was used as the experimental sample. The physicochemical properties of the mash were determined according to the methods specified in "General Analytical Methods for Solid-State Fermentation Mash" (T / CBJ 004-2018), including moisture, starch content, reducing sugar content, and acidity. Fermentation temperature was recorded using a thermometer.
[0083] The results are as follows Figure 5 As shown: 1) The changes in physicochemical properties during fermentation of the control group and the other experimental mash showed a similar trend overall. The moisture content of all groups continued to increase with the number of fermentation days. The moisture content change trends of different enzyme activity groups were basically the same as those of the control group. The moisture content of the 25 U / g enzyme addition group increased by 7%, with the highest moisture accumulation. 2) Under temperature control, the temperature of each group of mash rose rapidly from about 26 ℃ in the first 6 days of fermentation, reaching a peak of 34-36 ℃ on the 8th day, and then remained stable. 3) The starch degradation trends of different enzyme activity groups and the control group were consistent, all showing a continuous decrease with increasing fermentation days. The 25 U / g protease addition group consumed starch the fastest, and the final starch consumption rate was 10.6% higher than that of the control group. 4) The acidity of each group gradually fluctuated and increased with the increase of fermentation days. The acidity of the enzyme treatment group was slightly lower than that of the control group in the later stage. The acidity of the 25 U / g enzyme addition group was the largest at the end of fermentation, which was 0.27 mmol / 10 g. 5) The reducing sugar consumption trend of different enzyme activity groups and the control group was consistent, reaching a peak on the second day of fermentation and then gradually decreasing. Among them, the 25 U / g protease addition group accumulated and consumed reducing sugar the fastest.
[0084] Example 7: Effects of aspartic protease mutant M4 on the yield and volatile flavor compounds of light-aroma baijiu mash. The finished liquor from Case Study 4 was used as the experimental sample. Based on the alcohol content, temperature, and volume parameters of the liquor body and tails obtained from the distillation of each group of fermented mash, the yield of the corresponding group was calculated.
[0085] The results are shown in Table 7: As the amount of aspartic protease mutant M4 added gradually increased, the alcohol yield of the mash showed a significant upward trend. The 25 U / g addition group showed the best improvement in alcohol yield, which was 11.3% higher than the control group.
[0086] Table 7. Effect of the amount of aspartic protease mutant M4 added on the alcohol yield of light-aroma baijiu mash (20 ℃)
[0087] The finished liquor from Implementation Case 5 was used as the experimental sample. After aging for one month, the content of volatile components in the liquor was determined by gas chromatography. The chromatographic conditions were as follows: DB-WAX UI quartz capillary column (30 m × 0.25 mm × 0.5 μm); flame ionization detector (FID) at 240 ℃; injection port temperature at 250 ℃; temperature program: 35 ℃ for 4 min, increased to 100 ℃ at 5 ℃ / min, then increased to 230 ℃ at 10 ℃ / min and held for 13 min; carrier gas was nitrogen (N2); purge flow rate was 3 mL / min; split ratio was 1:30. Carrier gas flow rates: nitrogen 36.5 mL / min, hydrogen 40 mL / min, air 400 mL / min. Qualitative analysis was performed based on retention time, and quantitative analysis was performed using the internal standard method. The internal standards were tert-amyl alcohol (198.27 mg / L), n-amyl acetate (174.93 mg / L), and 2-ethylbutyric acid (198.20 mg / L).
[0088] The effects of the aspartic protease mutant M4 on 19 volatile flavor compounds and total esters in baijiu are shown in Table 8. Compared with the control group, the ethyl acetate content in the protease-added group increased from 1540.34 mg / L to 2752.06 mg / L, an increase of 78.7%. The contents of ethyl lactate and 3-hydroxy-2-butanone also increased significantly with increasing enzyme addition, with increases of 59.7% and 106.9%, respectively. The total ester content increased by 49.8%. The contents of fusel oil components generally showed a decreasing trend, with n-butanol showing the most significant decrease, from 10.34 mg / L to 4.70 mg / L, a decrease of 54.5%. n-propanol, isobutanol, active pentanol, isopentanol, n-pentanol, and n-hexanol all decreased to varying degrees. In addition, the contents of methanol, furfuryl alcohol, and propionic acid were all lower than those in the control group, and the acetaldehyde content decreased by 49.3%, from 608.14 mg / L to 308.40 mg / L.
[0089] The results above show that the amount of aspartic protease mutant added is positively correlated with the content of esters in baijiu and negatively correlated with the content of higher alcohols, thus having the ideal effect of "increasing esters and reducing alcohols", reducing off-flavors and spiciness, and improving the drinking experience.
[0090] Table 8. Effects of different amounts of aspartic protease mutant M4 on volatile flavor compounds in Baijiu
[0091] Note: All values in the table are averages.
[0092] Example 8: Effects of aspartic protease mutant M4 on the sensory quality of light-aroma baijiu The sensory evaluation of light-aroma baijiu was conducted with the 25 U / g group as the experimental group and the 0 U / g group as the control group. Samples of the distilled product from Example 5 were placed in a storage room at a temperature of 20-25 ℃ and a relative humidity of 40%-60%. After one month of static storage, professional tasters conducted sensory evaluations of the aged samples according to the "Guidelines for Sensory Evaluation of Baijiu" (GB / T33404-2016) and completed a comprehensive evaluation of the flavor characteristics of the samples.
[0093] The results are shown in Table 9: The experimental group with added aspartic protease mutant M4 had a richer flavor and taste compared to the control group, which could improve the astringency and harshness of the wine.
[0094] Table 9. Effects of the addition of aspartic protease mutant M4 on the sensory properties of Baijiu.
[0095] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. An aspartic protease mutant, characterized in that, The mutant is either A1) or A2): A1) Mutating one or more amino acid residues of the wild-type aspartic protease; specifically, the following mutation types: 1) Replace G with N at position 131 of the amino acid sequence of the wild-type aspartic protease; and / or 2) Replace F with W at position 218 of the wild-type aspartic protease amino acid sequence; and / or 3) Replace A with E at position 228 of the wild-type aspartic protease amino acid sequence; A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of A1); The amino acid sequence of the wild-type aspartic protease is SEQ ID No:
1.
2. The biomaterial related to the mutant of claim 1, characterized in that, The biomaterial is any one of the following: B1) Encodes the nucleic acid molecule of the mutant described in claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecules described in B1); B4) A recombinant vector containing the expression cassette described in B2); B5) Recombinant microorganisms containing the nucleic acid molecules described in B1); B6) Recombinant microorganisms containing the expression cassette described in B2); B7) Recombinant microorganisms containing the recombinant vector described in B3); B8) Recombinant microorganisms containing the recombinant vector described in B4).
3. The biomaterial according to claim 2, characterized in that, B1) The nucleic acid molecule is any of the following DNA molecules: d1) The nucleotide sequence is the DNA molecule shown in SEQ ID No:7; d2) The nucleotide sequence is the DNA molecule shown in SEQ ID No:8; d3) The nucleotide sequence is the DNA molecule shown in SEQ ID No:9; d4) The nucleotide sequence is the DNA molecule shown in SEQ ID No:10; d5) Hybridizes under stringent conditions with the nucleotide sequences defined by d1) to d4) and encodes the DNA molecule of the mutant of claim 1.
4. The biomaterial according to claim 2, characterized in that, The recombinant microorganism is a recombinant yeast.
5. A method for constructing recombinant Pichia pastoris, characterized in that, The method includes introducing the coding gene of any of the mutants described in claims 1-5 into the recipient Pichia pastoris.
6. The method according to claim 5, characterized in that, The mutant's encoding gene is generated by the alcohol oxidase promoter P. AOX1 Formaldehyde dehydrogenase promoter P FLD1 Formate dehydrogenase promoter P FDH1 or P (d1+2×201AOX1) Promoter-driven expression; The alcohol oxidase promoter P AOX1 The nucleotide sequence is SEQ ID No:11; The formaldehyde dehydrogenase promoter P FLD1 The nucleotide sequence is SEQ ID No:12; The formate dehydrogenase promoter P FDH1 The nucleotide sequence is SEQ ID No:13; The P (d1+2×201AOX1) The nucleotide sequence of the promoter is SEQ ID No:
14.
7. The method according to claim 5 or 6, characterized in that, The mutant's coding gene has an S-terminus fused to its N-terminus. MF4I Signal peptide, the S MF4I The nucleotide sequence of the signal peptide is SEQ ID No:
15.
8. A method for preparing an aspartic protease mutant, comprising introducing the coding gene of any of the mutants described in claims 1-4 into a recipient microorganism to obtain a recombinant microorganism expressing any of the mutants described in claims 1-4, culturing the recombinant microorganism, and obtaining the aspartic protease mutant from the fermentation product.
9. The application of the mutant of claim 1 or the method of any one of claims 6-8 in the production of solid-state fermented light-aroma baijiu.
10. A method for improving the quality of light-aroma baijiu, characterized in that, The method comprises mixing the protease described in claim 1 with Daqu (a type of starter culture) and adding it to the brewing raw materials for solid-state fermentation to brew a light-aroma baijiu. The solid-state fermentation temperature is 25-40 ℃ and the fermentation time is 7-14 days. The brewing raw materials consist of sorghum, rice husks, and distiller's grains, wherein the amount of rice husks added is 20-25% of the total weight of sorghum, and the amount of distiller's grains added is 3.5-4.0 times the total weight of sorghum. The amount of protease added is 5-40 U / g (based on sorghum), and the amount of Daqu added is 20-25% of the total weight of sorghum; The improvement in the quality of light-aroma baijiu is manifested in the following ways: 1) Increase the content and accumulation rate of free amino acids in baijiu; 2) Increase the content of esters and decrease the content of higher alcohols in baijiu; 3) Increasing the moisture content in the mash increases the rate of starch and reducing sugar consumption, and decreases acidity; 4) Improves the astringency and harshness of the wine.