Metrnl-a gene and application thereof in preparing DNA vaccine molecular adjuvant for grass carp hemorrhagic disease

Abstract

The application discloses Metrnl-a gene and application thereof in preparation of a DNA vaccine molecular adjuvant for grass carp hemorrhagic disease, and relates to the technical field of aquatic immunology and biological agents. The molecular adjuvant is that a grass carp Metrnl-a gene is constructed into a eukaryotic expression vector pcDNA3.1 to obtain a recombinant eukaryotic expression vector pcDNA3.1-Metrnl-a of the grass carp Metrnl-a. The pcDNA3.1-Metrnl-a plasmid and the pcDNA3.1-VP35 DNA vaccine can be stably expressed in the grass carp through muscle injection, significantly enhance the expression of immune-related genes and the antibody titer, significantly reduce the VP56 virus titer in the grass carp after challenge, and increase the survival rate of the grass carp after infection with grass carp reovirus by about 13.3%. The molecular adjuvant can effectively enhance the immune effect of the DNA vaccine of the grass carp and has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of aquatic immunology and biological agents, and particularly relates to a Metrnl-a gene and its application in the preparation of a molecular adjuvant for grass carp hemorrhagic disease DNA vaccine. Background Technology

[0002] Metrnl (Meteorin-like, also known as IL-41, Subfatin, or Cometin) is a novel cytokine homologous to the neurotrophic factor Metrn. It is widely expressed in mammalian barrier tissues (skin, intestinal epithelium), adipose tissue, and inflammatory cells, possessing diverse biological functions. It participates not only in neuronal differentiation, glucose and lipid metabolism, and tissue repair, but also plays a crucial role in regulating innate and adaptive immunity. Studies have shown that mammalian Metrnl can regulate the expression of various cytokines and chemokines in macrophages, playing an important role in the pathophysiology of inflammation-related diseases such as enteritis and arthritis. However, research on the immunomodulatory function of Metrnl in aquatic animals is relatively recent and remains in its early stages of exploration. Existing reports mainly focus on the cloning, tissue distribution, and expression response analysis of the Metrnl gene in fish after pathogen infection. For example, two homologous genes of Metrnl (Metrnl-a and Metrnl-b) have been found in grass carp. Among them, Metrnl-a is widely expressed in multiple tissues and can be upregulated in response to stimulation by Aeromonas hydrophila and grass carp reovirus (GCRV). However, its potential as a vaccine molecular adjuvant has not yet been developed. Currently, there are no research reports on Metrnl as a vaccine molecular adjuvant at home and abroad.

[0003] In the field of fish vaccines, especially DNA vaccines against grass carp hemorrhagic disease, weak immunogenicity is a major bottleneck restricting their application. To enhance the immunogenicity of DNA vaccines, researchers have attempted to use immune adjuvants. Traditional adjuvants, such as aluminum salt adjuvants and Freund's adjuvant, have drawbacks such as short duration of immunity and strong toxic side effects. Cytokines, as molecular adjuvants, have advantages such as regulating immune responses and avoiding the drawbacks of traditional adjuvants. Existing studies have used a few cytokines, such as interferon (IFN), interleukin-8 (IL-8), and IL-17, as molecular adjuvants for fish DNA vaccines, but problems such as limited immunogenicity and insignificant improvement in protection rates still exist. In addition, the preparation of existing molecular adjuvants mostly adopts the method of prokaryotic expression of recombinant proteins, which has drawbacks such as complex protein purification, easy formation of inclusion bodies, and the need for renaturation treatment. Moreover, recombinant protein adjuvants and DNA vaccines need to be prepared and mixed separately, which is cumbersome. Summary of the Invention

[0004] To address the aforementioned technical issues, this invention proposes a Metrnl-a gene and its application in preparing a molecular adjuvant for grass carp hemorrhagic disease DNA vaccine. The full-length coding sequence of the grass carp Metrnl-a gene was analyzed and cloned, and it was directly constructed into the eukaryotic expression vector pcDNA3.1 to obtain the molecular adjuvant pcDNA3.1-Metrnl-a. This adjuvant, in plasmid form, is co-immunized with the grass carp hemorrhagic disease DNA vaccine via intramuscular injection, eliminating the need for in vitro protein expression and purification, thus simplifying the process.

[0005] To achieve the above objectives, the present invention provides the application of the Metrnl-a gene in the preparation of a molecular adjuvant for a grass carp hemorrhagic disease DNA vaccine, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] On the other hand, the present invention also provides a recombinant expression vector containing the above-mentioned Metrnl-a gene.

[0007] Furthermore, the recombinant expression vector is pcDNA3.1-Metrnl-a.

[0008] On the other hand, the present invention also provides a molecular adjuvant for a grass carp hemorrhagic disease DNA vaccine, comprising the above-mentioned recombinant expression vector.

[0009] Preferably, the molecular adjuvant is pcDNA3.1-Metrnl-a obtained by constructing the grass carp Metrnl-a gene into the eukaryotic expression vector pcDNA3.1.

[0010] On the other hand, the present invention also provides a method for preparing the molecular adjuvant as described above, wherein the grass carp Metrnl-a gene fragment is obtained by PCR amplification technology, and the grass carp Metrnl-a gene fragment is recombinantly ligated with the eukaryotic expression plasmid pcDNA3.1 to construct pcDNA3.1-Metrnl-a.

[0011] Preferably, the primer pair sequences used for amplifying the Metrnl-a gene of grass carp are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0012] On the other hand, the present invention also provides the application of the molecular adjuvant as described above in the preparation of a grass carp hemorrhagic disease DNA vaccine, wherein the molecular adjuvant is used in combination with the grass carp hemorrhagic disease DNA vaccine to enhance the immune protection effect of the vaccine.

[0013] Preferably, the grass carp hemorrhagic disease DNA vaccine is a eukaryotic expression vector pcDNA3.1-VP35 expressing the VP35 protein of grass carp reovirus GCRV type II strain; the molecular adjuvant and the DNA vaccine are co-immunized with grass carp via intramuscular injection at a 1:1 mass ratio.

[0014] Compared with the prior art, the present invention has the following advantages and technical effects: (1) This invention uses fish cytokine Metrnl-a as a molecular adjuvant for DNA vaccines, opening up new applications for Metrnl-a and providing a new strategy for the development of molecular adjuvants for fisheries.

[0015] (2) The pcDNA3.1-Metrnl-a adjuvant constructed in this invention can effectively enhance the immunogenicity of grass carp hemorrhagic disease DNA vaccine and significantly improve cellular and humoral immunity levels. Moreover, co-immunization with the DNA vaccine using the pcDNA3.1-Metrnl-a adjuvant can effectively reduce the viral load in grass carp after challenge and increase the immune protection rate by about 13.3%, showing superior adjuvant effects.

[0016] (3) The molecular adjuvant used in this invention is a cytokine derived from grass carp itself, which has high biosafety and meets the requirements of green and healthy aquaculture. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Image of double enzyme digestion verification of the grass carp Metrnl-a recombinant expression plasmid pcDNA3.1-Metrnl-a (M: Marker, 1: digested plasmid and Metrnl-a). Figure 2 The results validated the expression of grass carp pcDNA3.1-Metrnl-a and the DNA vaccine. A shows the expression of VP35 in muscle cells detected by qPCR; B shows the expression of Ma in muscle cells detected by qPCR; C shows the expression of VP35 in muscle cells at days 5 and 35 post-injection detected by agarose gel electrophoresis; D shows the expression of Ma in muscle cells at days 5 and 35 post-injection detected by agarose gel electrophoresis. Significant differences are indicated by *. P <0.05 and ** P <0.01 indicates that there is no significant difference (ns). Figure 3Immunofluorescence assays of Metrnl-a and VP35 protein expression in grass carp muscle tissue sections were performed. A represents VP35 expression in muscle 5 days after injection; B represents Ma expression in muscle 5 days after injection; C represents VP35 expression in muscle 35 days after injection; and D represents Ma expression in muscle 35 days after injection. Figure 4 Changes in immune-related genes in the head kidney, spleen, and intestine of grass carp after immunization with Metrnl-a molecular adjuvant combined with DNA vaccine; where A represents the expression changes of CD4 in the head kidney at 5 and 35 days after injection; B represents the expression changes of CD8 in the head kidney at 5 and 35 days after injection; C represents the expression changes of MHC I in the head kidney at 5 and 35 days after injection; D represents the expression changes of MHC II in the head kidney at 5 and 35 days after injection; E represents the expression changes of CD4 in the spleen at 5 and 35 days after injection; F represents the expression changes of CD8 in the spleen at 5 and 35 days after injection; G represents the expression changes of MHC I in the spleen at 5 and 35 days after injection; H represents the expression changes of MHC II in the spleen at 5 and 35 days after injection; I represents the expression changes of CD4 in the intestine at 5 and 35 days after injection; J represents the expression changes of CD8 in the intestine at 5 and 35 days after injection; K represents the expression changes of MHC I in the intestine at 5 and 35 days after injection. Changes in MHC II expression; L represents changes in MHC II expression in the gut at 5 and 35 days after injection; data are expressed as mean ± standard deviation (N=3), and statistical significance is indicated by *. P <0.05 and ** P <0.01 indicates that there is no significant difference (ns). Figure 5 This study investigated the changes in IgM gene expression in the head kidney, spleen, and intestine, and the serum specific antibody titer in grass carp immunized with a combination of Metrnl-a molecular adjuvant and DNA vaccine. Specifically, A represents the change in IgM gene expression in the head kidney at 5 and 35 days after injection; B represents the change in IgM gene expression in the spleen at 5 and 35 days after injection; C represents the change in IgM gene expression in the intestine at 5 and 35 days after injection; and D represents the change in serum specific antibody titer. Data are expressed as mean ± standard deviation (N=3), with statistically significant differences indicated by *. P <0.05 and ** P <0.01 indicates that there is no significant difference (ns). Figure 6 Figure 1 shows the changes in viral load in the head kidney, spleen, and intestine of grass carp after challenge. In Figure 2, A shows the change in VP56 gene expression in the head kidney at 5 and 35 days after injection; B shows the change in VP56 gene expression in the spleen at 5 and 35 days after injection; and C shows the change in VP56 gene expression in the intestine at 5 and 35 days after injection. Data are expressed as mean ± standard deviation (N=3), and significant differences are indicated by *. P<0.05 and ** P <0.01 indicates that there is no significant difference (ns). Figure 7 This is a graph showing the changes in the survival rate of grass carp in different groups from 1 to 14 days after viral infection. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Unless otherwise specified, the term "parts" in this invention refers to parts by weight.

[0025] Example 1 The construction of Escherichia coli expressing recombinant grass carp IL-21 protein efficiently includes the following steps: S1. Search for the grass carp Metrnl-a gene (Genbank: MW713124.1) through NCBI. The CDS sequence of the grass carp Metrnl-a gene is shown as SEQ ID NO.1.

[0026] SEQ ID NO.1: ATGCTCTCGCCGTTCTTGGCGTATTTGCTGTCGGTTGTGGTTCTGTGTAGGATTGCGCGCTCACAGTACTCAAGCGACCAGTGCAGCTGGAGGGGCAGTGGTCTGACCCATGAGGGACACACGCGGGATGTGGAACAGGTGTATCTCCGCTGTGCCCAGGGGTTCCTGGAGTGGCTGTACCCTACAGGGGCCATCATCGTCAACCTGCGGCCAAACACGTTGTCCCCAGCGGCGTCTCTTCTCTCCGTCTGCATCAAACCCTCTAAGGAGTCCAGCGGGACCCACATCTACCTGGACCGACTGGGCAAACTGCGATTGCTCCTCCGTGAGGAAGATCAGGCAGAGGGAAGAGTGCACTGTTTCAGCATCCAGGATGGGGCGCTCTTCATCGAGGCAGTGCCTCAAAGGGACATCAGCCGAAAAATCACAGCCTTCCAGTATGAGCTGGTCAACCACAGACCAGGAGCAGATCCACAGTCATTATCTGCACCCTGCCAACCCTGTACAGATGCGGAGGTACTGCTGGCCGTTTGCACCAGTGACTTTGTGGCACGGGGAAATATTCTTGGTGTGGCAGAGGAGGACGATCAGACCTCTGTTACCGTGTCCCTGAGTCGCCTTTACAGACAGAAGACACAAGTGTTTGTGTCAGGGGGCGGCCGGGCCAAGCGCTGGACGGGCTTTGTGAAGATGCCCAGCCAGTGCGGGGTTAAACCAGGGGAGGGCGAGTTCCTCTTCACTGGGACTGTGCGGTTCGGAGAGGCCTGGCTTAGCTGCGCTCCACGGTACAAGGACTTCCTTAGGGTGTATCAGGACGCACAGCAGCGAGGGACCAACCCATGTCATTTGGACACAGACTGA.

[0027] S2. Select the target gene SEQ ID NO.1 sequence and design a pair of primers using NCBI: primer 1 and primer 2, which are synthesized at Suzhou Genewise Biotechnology Co., Ltd. for PCR amplification of the grass carp Metrnl-a sequence (where the underlined part of AAGCTT represents the HindIII restriction site and the underlined part of GGATCC represents the BamHI restriction site).

[0028] Primer 1, SEQ ID NO.2: 5′-CC AAGCTT GCCACCATGCTCTCCGCCGTTCTTGGCGTA-3′; Primer 2, SEQ ID NO.3: 5′-CG GGATCC TCAGTGATGGTGATGGTGATGGTCTGTGTCCAAATG-3′.

[0029] S3. Total RNA was extracted from the head and kidney tissue of healthy grass carp and reverse transcribed into cDNA. Using the cDNA as a template, the grass carp Metrnl-a sequence was amplified by PCR using the primers in S2.

[0030] PCR reaction system: 25 μL of 2×PrimeSTAR Max Premix, 1 μL each of primer 1 and primer 2 (50 pmol / μL), 1 μL of grass carp head and kidney cDNA template, and 22 μL of sterile ddH2O. The PCR reaction program was: 95℃, 3 min; 98℃, 10 s, 55℃, 10 s, 72℃, 30 s, 30 cycles; 72℃, 7 min; stored at 4℃.

[0031] The PCR product and pcDNA3.1 vector were double-digested with HindIII and BamHI enzymes. The digested products were then extracted using a gel extraction kit. After extraction, the target fragment was ligated into the pcDNA3.1 vector in a 10µL reaction mixture (1µL vector, 5µL target fragment, and 4µL Solution I). The mixture was incubated overnight at 16°C and then transformed. 50µL of *E. coli* DH5α competent cells were added to the recombinant expression vector pcDNA3.1-Metrnl-a. The cells were incubated on ice for 30 min, then heat-shocked in a 42°C water bath for 90 s, and immediately placed on ice for 3 min. 200µL of antibiotic-free LB medium was added, and the cells were incubated at 37°C with shaking at 150 rpm for 1 h. 100µL of the bacterial culture was evenly spread onto LB agar plates containing ampicillin. After incubation at 37°C overnight, single colonies were picked for detection.

[0032] The reaction system consisted of 1 µL of bacterial culture as template, 1 µL each of primers 11 and 12, 5 µL of ExTaq DNA polymerase, and 2 µL of ddH2O, totaling 10 µL. The reaction conditions were: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 10 s; annealing at 55 °C for 10 s; extension at 72 °C for 30 s, for 30 cycles; 72 °C for 10 min; and storage at 16 °C. Three positive clones were then sequenced and the plasmid was retrieved. After double enzyme digestion verification, the eukaryotic expression plasmid expressing grass carp pcDNA3.1-Metrnl-a was obtained.

[0033] Primer 11, SEQ ID NO.4: CTAGAGAACCCACTGCTTAC; Primer 12, SEQ ID NO.5: TAGAAGGCACAGTCGAGG.

[0034] The agarose gel electrophoresis results of the amplification products are as follows: Figure 1 As shown, the size is consistent with the expected size. Sequencing results further confirmed that the Metrnl-a gene was correctly inserted into the pcDNA3.1 vector without mutation, indicating that the pcDNA3.1-Metrnl-a molecular adjuvant was successfully constructed. The double enzyme digestion verification system is shown in Table 1.

[0035] Table 1. Double enzyme digestion verification system

[0036] Example 2 Verification of recombinant plasmid expression in grass carp.

[0037] Healthy grass carp (15±2g) were temporarily raised for two weeks, and five fish were randomly selected for GCRV-specific primers (Vp56-F and Vp56-R) to test for GCRV infection, confirming negative results. The fish were divided into four groups of 60 each. The immunized group (1cm to the right of the middle dorsal fin) received an intramuscular injection of 50μL pcDNA3.1 / pcDNA3.1-VP35 / pcDNA3.1-VP35+pcDNA3.1-Metrnl-a (15μg). The blank control group received an equal volume of PBS buffer. A booster immunization was performed four weeks after the initial immunization. On days 5 and 35 after the first immunization, qPCR and frozen tissue sections were used to detect the mRNA and protein levels of the adjuvant Metrnl-a (Ma) and the vaccine (VP35) at the injection site.

[0038] The primer sequences for the adjuvant Metrnl-a gene are shown in SEQ ID NO.6-SEQ ID NO.7; the primer sequences for the VP35 gene are shown in SEQ ID NO.8-SEQ ID NO.9.

[0039] CiMetrnl-aF , SEQ ID NO.6: GTACGAGCTGGTGAACCACA; CiMetrnl-aR , SEQ ID NO.7: GTTGCCTCTAGCCACGAAGT; Vp35-F , SEQ ID NO.8: ATGGAGCCCGCCAAGCCCCTGACC; Vp35-R , SEQ ID NO.9: TCACTGCCCTTGGATCTCGGGCTT.

[0040] mRNA level detection: Total RNA was extracted from muscle tissue, and the mRNA expression of Metrnl-a (Ma) and VP35 was detected by RT-PCR and qPCR. Figure 2 China A and Figure 2 As shown in Figure B, both Metrnl-a and VP35 were significantly expressed on days 5 and 35 post-immunization. Agarose gel electrophoresis was used to detect the expression of VP35 and Ma in muscle on days 5 and 35 post-injection, respectively. Figure 2 As shown in C and D, specific bands for Metrnl-a and VP35 can also be detected in the co-immunized group.

[0041] Protein level detection: Frozen sections of muscle tissue from the injection site were prepared and immunofluorescence staining was performed using anti-Metrnl-a monoclonal antibody (CY5 labeled) and anti-VP35 monoclonal antibody (CY5 labeled), respectively. Results are as follows: Figure 3 As shown, parts A and B represent the expression of VP35 and Ma in muscle 5 days after injection; parts C and D represent the expression of VP35 and Ma in muscle 35 days after injection. The results showed that on days 5 and 35 after immunization, both VP35 and Metrnl-a showed positive signals in the muscle tissue of the co-immunized group, indicating that both plasmids were successfully expressed in grass carp.

[0042] Example 3 Evaluation of the immune-enhancing effect of molecular adjuvants on DNA vaccines.

[0043] Healthy grass carp (15±2g) were temporarily held for two weeks, and five fish were randomly selected using GCRV-specific primers for virus testing, which confirmed GCRV negativity. They were divided into four groups of 60 fish each. The immunized group (1cm to the right of the middle dorsal fin) received an intramuscular injection of 50μL pcDNA3.1 / pcDNA3.1-VP35 / pcDNA3.1-VP35+pcDNA3.1-Metrnl-a (15μg), while the blank control group received an equal volume of PBS buffer. A booster immunization was performed four weeks after initial immunization, and GCRV-II infection and challenge were performed six weeks later. Head kidney, spleen, hindgut, and peripheral blood were collected on days 5, 35, and 7 after the initial immunization and challenge. Changes in CD4, CD8, MHC I, MHC II, and IgM genes, serum specific antibody titers, and viral load in immune tissues were detected using qPCR or ELISA. The immunoprotection rate of different groups was observed and recorded within two weeks after GCRV challenge.

[0044] The primer sequences for the CD4 gene are shown in SEQ ID NO.10-SEQ ID NO.11.

[0045] CiCD4-F , SEQ ID NO.10: GGATGATGCTGACATATGCTGCGT; CiCD4-R , SEQ ID NO. 11: CGTCTGTACATCATTATCTGTTTGTG.

[0046] The primer sequences for the CD8 gene are shown in SEQ ID NO.12-SEQ ID NO.13.

[0047] CiCD8-F , SEQ ID NO.12:GAGTCTCTGCACGGATCTAT; CiCD8-R , SEQ ID NO. 13: GTGTAGTGTTCCGAATTTAAGT.

[0048] The primer sequences for the MHC I gene are shown in SEQ ID NO.14-SEQ ID NO.15.

[0049] CiMHCI-F , SEQ ID NO.14: CCTGGCAGAAAAATGGACAAG; CiMHCI-R , SEQ ID NO. 15: CCAACAACACCAATGACAATC.

[0050] The primer sequences for the MHC II gene are shown in SEQ ID NO.16-SEQ ID NO.17.

[0051] CiMHCII-F , SEQ ID NO.16: CCCTTCTCTACAGACCCTCAGTC; CiMHCII-R , SEQ ID NO. 17: CTCCATACGGAATGCAGTCATTC.

[0052] The primer sequences for the IgM gene are shown in SEQ ID NO.18-SEQ ID NO.19.

[0053] CiIgM-F, SEQ ID NO.18: TCTACCTCCAACTCCACCACC; CiIgM-R, SEQ ID NO. 19: GTTTATTGTATTTGCCACCTGAT.

[0054] Changes in immune-related genes (CD4, CD8, MHC I, and MHC II) in the head kidney, spleen, and intestine of grass carp after immunization with Metrnl-a molecular adjuvant combined with DNA vaccine are shown below. Figure 4 As shown, the changes in IgM gene and serum specific antibody titers are as follows: Figure 5 As shown in the figure. Results indicated that on days 5 and 35 post-immunization, the vaccine and adjuvant combination group significantly enhanced the expression levels of CD8, MHC II, and IgM in the head kidney, spleen, and intestine. Only after booster immunization did it promote the expression of CD4 and MHC II genes. This demonstrates that pcDNA3.1-Metrnl-a, as an adjuvant, can significantly enhance the specific cellular and humoral immune responses in grass carp. Furthermore, the titers of GCRV-specific IgM antibodies in the immune tissues and serum of the vaccine and adjuvant combination group were significantly higher than those in the vaccine-only immunization group, further confirming that the Metrnl-a molecular adjuvant can effectively enhance the humoral immune response induced by DNA vaccines.

[0055] Example 4 Six weeks after the initial immunization (i.e., two weeks after the booster immunization), GCRV-II infection and challenge were performed. On day 7 post-challenge, head kidney, spleen, and intestinal tissues of surviving grass carp from each group were collected, and RNA was extracted. The expression level of the GCRV VP56 gene was detected by qPCR using primers such as SEQ ID NO.20-SEQ ID NO.21 to assess the viral load in each tissue.

[0056] Vp56-F , SEQ ID NO.20: AGCAGGCTATTCATCACCAGT; Vp56-R , SEQ ID NO. 21: GTTCTAACGCTCACCGTCTTTTC.

[0057] The following graph shows the changes in viral load in the head, kidney, spleen, and intestines of grass carp after challenge. Figure 6 As shown, compared with the vaccine-only immunization group, the combined immunization group showed significantly reduced VP56 gene expression levels in the head kidney, spleen, and intestine. P The value <0.05 indicates that the Metrnl-a adjuvant can effectively help the body clear the virus.

[0058] After viral challenge, grass carp were observed for 14 consecutive days. Mortality was recorded in each group, and cumulative survival rate and relative immune protection rate (RPS) were calculated. The experimental results are as follows: Figure 7 As shown, the mortality rate of grass carp in the PBS control group and the pcDNA3.1 empty vector group was close to 90% within 14 days after challenge. The survival rate of the vaccine-only immunization group was 56.67%. However, the survival rate of the Metrnl-a combined immunization group was significantly improved to 70%, with a relative protection rate approximately 13.3% higher than that of the vaccine-only immunization group. These results indicate that the pcDNA3.1-Metrnl-a molecular adjuvant provided by this invention can effectively enhance the immunoprotective effect of the grass carp hemorrhagic disease DNA vaccine.

[0059] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the Metrnl-a gene in the preparation of molecular adjuvants for grass carp hemorrhagic disease DNA vaccines, characterized by: The nucleotide sequence of the Metrnl-a gene is shown in SEQ ID NO.

1.

2. A recombinant expression vector comprising the Metrnl-a gene as described in claim 1.

3. The recombinant expression vector according to claim 2, characterized in that: The recombinant expression vector is pcDNA3.1-Metrnl-a.

4. A molecular adjuvant for a grass carp hemorrhagic disease DNA vaccine, characterized in that: It includes the recombinant expression vector as described in claim 2 or 3.

5. The molecular adjuvant for the grass carp hemorrhagic disease DNA vaccine according to claim 4, characterized in that: The molecular adjuvant is pcDNA3.1-Metrnl-a, obtained by constructing the grass carp Metrnl-a gene into the eukaryotic expression vector pcDNA3.

1.

6. The method for preparing the molecular adjuvant as described in claim 4 or 5, characterized in that: The grass carp Metrnl-a gene fragment was obtained by PCR amplification. The grass carp Metrnl-a gene fragment was then recombinantly ligated with the eukaryotic expression plasmid pcDNA3.1 to construct pcDNA3.1-Metrnl-a.

7. The preparation method according to claim 6, characterized in that: The primer pair sequences used to amplify the Metrnl-a gene of grass carp are shown in SEQ ID NO.2 and SEQ ID NO.

3.

8. The use of the molecular adjuvant as described in claim 4 or 5 in the preparation of a grass carp hemorrhagic disease DNA vaccine, characterized in that: The aforementioned molecular adjuvant was used in combination with a grass carp hemorrhagic disease DNA vaccine to enhance the vaccine's immunoprotective effect.

9. The application according to claim 8, characterized in that: The grass carp hemorrhagic disease DNA vaccine is a eukaryotic expression vector pcDNA3.1-VP35 expressing the VP35 protein of grass carp reovirus GCRV type II strain; the molecular adjuvant and the DNA vaccine are co-immunized with grass carp via intramuscular injection at a 1:1 mass ratio.

Images