Application of epinephelus fuscoguttatus efbag4 gene in resisting nervous necrosis virus infection

Abstract

This invention discloses the brown-spotted grouper. EfBAG4 The application of genes in combating neuronecrosis virus infection involves the field of genetic engineering technology. EfBAG4 The nucleotide sequence of the gene is shown in SEQ ID NO.1. Experiments have shown that overexpression... EfBAG4 The gene can significantly reduce RGNNV virus titers, decrease hepatocyte shedding and damage caused by viral infection, and effectively inhibit viral replication in host cells. It can also promote immune genes in fish. IRF3 , IRF7 , ISG15 and IFN‑α This invention enables precise antiviral immune activation through the expression of [specific expression]. It provides a novel drug intervention strategy for the prevention and treatment of RGNNV infection, and has significant application value in the control of RGNNV-related diseases in aquaculture.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and particularly to the brown-spotted grouper. EfBAG4 Application of genes in the fight against neuronecrosis virus infection. Background Technology

[0002] Based on differences in molecular characteristics, NNVs can currently be divided into four genotypes: Red-spotted grouper nervous necrosis virus (RGNNV), striped bass nervous necrosis virus (SJNNV), tiger pufferfish nervous necrosis virus (TPNNV), and flounder nervous necrosis virus (BFNNV). Among them, Red-spotted grouper nervous necrosis virus (RGNNV) is the core viral pathogen affecting marine aquaculture fish such as brown-spotted grouper. This virus is highly infectious and spreads rapidly, causing large-scale mortality in grouper after infection, making it a key disease restricting the large-scale and intensive aquaculture of grouper. Currently, the prevention and control technologies for RGNNV infection in aquaculture mainly focus on traditional methods such as chemical disinfection, aquaculture environment control, and routine immunization. At the level of gene-based immune control, existing research mainly focuses on the pathogenic mechanism of the virus's own proteins and the broad-spectrum disease resistance function of fish's routine immune genes. The discovery and precise regulation technology of key functional genes specific to RGNNV infection in brown-spotted grouper are relatively lacking.

[0003] BAG family proteins are important stress regulatory proteins in animals and plants. In humans and mammals, BAG family proteins have been shown to participate in cellular protein folding, degradation, and viral stress immune responses. However, functional studies of the BAG4 gene (Epinephelus fuscoguttatus Bcl-2-associated athanogene 4, EfBAG4) in aquatic fish, especially the brown-spotted grouper, are currently lacking, and no information is available regarding its function. EfBAG4 Technical solutions and publicly reported information on gene regulation of grouper resistance to RGNNV infection. Summary of the Invention

[0004] To address the aforementioned shortcomings of existing technologies, this invention proposes the brown-spotted grouper. EfBAG4 The application of genes in the fight against neuronecrosis virus infection aims to address the problems raised in the background section.

[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides brown-spotted grouper. EfBAG4 The application of genes in the preparation of drugs against neuronecrosis virus infection, the aforementioned EfBAG4 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] Preferably, the nerve necrosis virus is red-spotted grouper nerve necrosis virus (RGNNV).

[0007] Preferably, the anti-neural necrosis virus infection drug further contains pharmaceutically acceptable excipients.

[0008] Preferably, the route of administration of the anti-neural necrosis virus infection drug is oral or injection.

[0009] Preferably, the dosage form of the anti-neural necrosis virus infection drug includes at least one of tablets, powders, granules, pills, and solutions.

[0010] Preferably, the application includes promoting immune genes in fish. IRF3 , IRF7 , ISG15 and IFN-α The expression, the IRF3 The nucleotide sequence is shown in SEQ ID NO.16. IRF7 The nucleotide sequence is shown in SEQ ID NO.17. ISG15 The nucleotide sequence is shown in SEQ ID NO.18. IFN-α The nucleotide sequence is shown in SEQ ID NO.19.

[0011] This invention also provides a brown-spotted grouper. EfBAG4 Gene cloning methods include the following steps: (1) cDNA was obtained by reverse transcription using total RNA from the liver tissue of brown-spotted grouper as a template; (2) Using the cDNA obtained in step (1) as a template, PCR amplification was performed using the upstream primer EfBAG4-F and the downstream primer EfBAG4-R to obtain the amplification product; The nucleotide sequence of the upstream primer EfBAG4-F is shown in SEQ ID NO.2; The nucleotide sequence of the downstream primer EfBAG4-R is shown in SEQ ID NO.3; (3) The amplification product obtained in step (2) is purified and recovered to obtain high-purity product as shown in SEQ ID NO.1. EfBAG4 Gene fragments.

[0012] Preferably, the PCR amplification reaction system in step (2) includes: 2 μL cDNA template, 25 μL 2×PhantaUniFi Master Mix, 2 μL upstream primer, 2 μL downstream primer, and water added to 50 μL.

[0013] Preferably, the PCR amplification reaction program in step (2) includes: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for 35 cycles, and 72℃ final extension for 7 min.

[0014] Compared with the prior art, the beneficial effects of the present invention are: the present invention is the first to clearly identify the brown-spotted grouper. EfBAG4 The anti-RGNNV function of the gene fills the technological gap in the research of antiviral mechanisms of the BAG4 gene in fish, and provides a new exclusive gene target for the prevention and control of viral diseases in grouper; through overexpression EfBAG4 This gene therapy can significantly reduce RGNNV viral titers, decrease hepatocyte shedding and damage caused by viral infection, and effectively inhibit viral replication in host cells. Compared with traditional broad-spectrum immunomodulatory methods, it is based on... EfBAG4 Intervention strategies are more targeted and have more stable antiviral effects; at the mechanistic level, EfBAG4 It exerts its antiviral effect by positively regulating the interferon immune response and upregulating... IRF3 , IRF7 , ISG15 and IFN-α Gene expression, thus providing a complete theoretical basis and technical path for precise prevention and control of RGNNV based on host immune factors. Attached Figure Description

[0015] Figure 1 for EfBAG4 Electrophoresis image of full-length gene amplification by PCR; Figure 2 for EfBAG4 The relative mRNA expression level of the gene; Figure 3 for EfBAG4 The effect of overexpression on the inhibition of RGNNV replication; where A is the result of crystal violet staining of cells; and B is the result of viral titer determination. Figure 4 for EfBAG4 Overexpression of genes related to the interferon pathway IRF3 , IRF7 , ISG15 and IFN-α The impact of transcriptional levels. Detailed Implementation

[0016] To enable those skilled in the art to better understand the technical content of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0017] Example 1: Brown Spotted Grouper EfBAG4 Gene cloning and construction of recombinant plasmid pcDNA3.1-EfBAG4 The experimental method includes the following steps: (1) PCR amplification: Liver tissue from healthy brown-spotted grouper was taken, and RNA was extracted using Trizol reagent. After reverse transcription into cDNA, the RNA was amplified using a designed PCR amplification method. EfBAG4 Specific primers: EfBAG4-F: ATGCACCATCATCAAATGCAGT (SEQ ID NO. 2), EfBAG4-R: TCAGAAGGCTTTCTTCTCCAGC (SEQ ID NO. 3), amplified using a 50 μL PCR reaction system. EfBAG4 The complete ORF consists of 2 μL cDNA template, 25 μL 2×Phanta UniFi Master Mix, 2 μL each of forward and reverse primers, and water added to a final volume of 50 μL. PCR reaction conditions: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for 35 cycles, and a final extension at 72℃ for 7 min. Store at 16℃ for later use.

[0018] (2) Gel recovery and purification: The PCR amplification products were extracted and purified using the FastPure® Gel DNA Extraction Mini Kit. High purity was obtained by gel dissolution, adsorption column purification, ethanol washing, and preheated sterile water elution. EfBAG4 Gene fragments, after concentration determination, are stored at -20℃ for later use.

[0019] (3) Vector linearization: The eukaryotic expression vector pcDNA3.1 was subjected to double digestion with EcoRI and BamHI to obtain a linearized vector. The 50 μL plasmid double digestion reaction system is shown in Table 1. Table 1. Plasmid double enzyme digestion reaction system

[0020] (4) Seamless cloning: Using the ClonExpress Ultra One Step Cloning Kit V3, the optimal ratio of 0.02 × vector base pairs to 0.04 × insert fragment base pairs was used to clone the fragment. EfBAG4 The gene fragment was homologously recombinated with the linearized pcDNA3.1 vector. The 10 μL homologous recombination system is shown in Table 2. Table 2 Homologous Recombination System

[0021] Homologous recombination products were obtained by reacting at 50℃ for 5-15 min. The homologous recombination products were cooled on ice and transformed into DH5α competent cells. The transformed bacterial culture was plated on LB agar plates containing 1 mg / mL ampicillin resistance and incubated at 37℃ for 20-24 h until single colonies formed. Single colonies were picked and identified by PCR and sequencing using universal primers for pcDNA3.1 vector (T7: TAATACGACTCACTATAGGG (SEQ ID NO.4) and BGH: TAGAAGGCACAGTCGAGG (SEQ ID NO.5)) to verify the size of the inserted fragment and obtain the positive recombinant plasmid pcDNA3.1-EfBAG4.

[0022] (5) Extraction of endotoxin-free plasmids: Positive plasmids were extracted using the FastPure EndoFree Plasmid Mini Plus Kit. After resuspension, lysis, impurity removal, column purification, washing with anhydrous ethanol, and elution with sterile water, high-purity endotoxin-free plasmids were obtained for subsequent cell transfection experiments.

[0023] Experimental results are as follows Figure 1 As shown, [the following is a description of a successful amplification of a specific gene] from brown-spotted grouper tissue using RT-PCR. EfBAG4 The specific bands of the gene indicate that the gene can be effectively detected at the transcriptional level, providing a reliable amplification target for subsequent gene function analysis in this study.

[0024] EfBAG4 The specific nucleotide sequence of the gene (SEQ ID NO.1) is as follows:

[0025] Example 2 Cell transfection and EfBAG4 Overexpression processing The experimental method includes the following steps: Transfection was performed using Lipomaster 2000 transfection reagent. EfBAG4 The overexpression group used 1 μg of pcDNA3.1-EfBAG4 recombinant plasmid, and the empty vector control group used 1 μg of pcDNA3.1 empty vector plasmid. These were mixed with transfection reagent and Opti-MEM medium, respectively, and incubated at room temperature for 10 min. The resulting plasmid-liposome complex was then slowly added to the wells containing brown-spotted grouper hepatocytes, gently mixed, and cultured for 6–8 h. The culture medium was then replaced with fresh medium to achieve the desired effect in brown-spotted grouper hepatocytes. EfBAG4 Highly efficient overexpression of genes.

[0026] Experimental results are as follows Figure 2 As shown, in brown-spotted grouper hepatocytes transfected with the pcDNA3.1-EfBAG4 recombinant plasmid, EfBAG4 The mRNA expression level in the overexpression group was significantly upregulated compared to the empty vector control group, providing a basis for further investigation at the cellular level. EfBAG4 This provides a reliable foundation for understanding the biological functions and regulatory mechanisms of RGNNV infection.

[0027] Example 3 EfBAG4 Effect of overexpression on viral replication The experimental method includes the following steps: (1) Preparation of RGNNV: First, take diseased grouper fry from the farm at -80℃, cut off their heads with sterile scissors and place them in multiple 1.5mL centrifuge tubes containing 300μL PBS buffer. Grind with a pestle for 30sec, centrifuge at 1000rpm for 20sec at 4℃, and collect the supernatant into sterile 50mL centrifuge tubes. Then place them in a -80℃ freezer and freeze-thaw cycle 3 times. Centrifuge at 4500rpm for 15min at 4℃ and collect the supernatant. Add triple antibody and let stand overnight at 4℃. The next day, use a 20mL syringe to draw the supernatant and filter it through a 0.22μm filter membrane. The clear liquid obtained is the crude virus extract. When passage SSN-1 cells, take 500μL of the above crude virus extract diluted with serum-free medium and add it to the culture flask. Let stand for 2min and shake the culture flask every 5min for a total of 3 times. Then discard the medium and use 1mL After washing the cells with PBS buffer, add 5 mL of fresh culture medium and incubate in a CO2 incubator. Observe the cytopathic effect (CPE) every 12 h. When the CPE reaches 80%, place the culture flask in a -80℃ freezer and freeze-thaw it three times. Centrifuge at 5000 rpm for 15 min at 4℃. The supernatant obtained is the purified RGNNV virus.

[0028] (2) 24 hours after cell transfection, a titer of 1×10⁻⁶ was used. 6 Brown-spotted grouper hepatocytes were infected with RGNNV virus solution with a TCID50 / mL and cultured for 72 h. The culture medium was aspirated (reserved for virus titer determination), and the cells were washed twice with PBS. 500 μL of 4% paraformaldehyde was added to each well, and the cells were fixed at room temperature for 10–15 min, washed three times with pure water for 5 min each time, covered with crystal violet staining solution, stained at room temperature for 3–10 min, washed with pure water, and photographed. Simultaneously, TCID50 was calculated using the Reed-Muench method, and the results were compared. EfBAG4 Difference in viral titer between the overexpression group and the empty vector control group.

[0029] Experimental results are as follows Figure 3 As shown, with EfBAG4 Compared to the overexpression group, the empty vector control group showed more severe cell shedding. Figure 3 A in the text). Meanwhile, the viral titer test results indicate that (…). Figure 3 In section B), the viral titer of the empty vector control group was significantly higher than that of the control group. EfBAG4 Overexpression group, therefore, overexpression EfBAG4 It can effectively inhibit the replication of RGNNV. This result clarifies that... EfBAG4 Its positive protective function against RGNNV infection in fish also provides functional evidence for further in-depth analysis of its molecular mechanism.

[0030] Example 4 EfBAG4 Overexpression can significantly upregulate the transcriptional expression of interferon pathway-related genes. The experimental method includes the following steps: (1) Cell culture, transfection and RGNNV infection, total RNA extraction and cDNA synthesis were performed in accordance with the methods described in the above examples; (2) qRT-PCR detection: Real-time quantitative PCR analysis was performed using the SYBR Green method, and the relative expression level of the target gene was calculated using the 2^(-ΔΔCt) method. The specific experimental reaction conditions were as follows: First, in the pre-denaturation stage, the reaction system was heated to 95℃ and held for 30 seconds; then, the cyclic reaction stage was entered, with a total of 40 cycles, each cycle including 10 seconds at 95℃ and 30 seconds at 60℃; finally, the melting curve stage was entered, in which the instrument's default melting curve acquisition program was used. IRF3 The nucleotide sequence is shown in SEQ ID NO.16. IRF7 The nucleotide sequence is shown in SEQ ID NO.17. ISG15 The nucleotide sequence is shown in SEQ ID NO.18. IFN-αThe nucleotide sequence is shown in SEQ ID NO.19. Actin The nucleotide sequence is shown in SEQ ID NO. 20. The qRT-PCR primer sequences used are shown in Table 3, and the 20 μL qRT-PCR reaction system is shown in Table 4. Table 3 qRT-PCR primers

[0031] Table 4 qRT-PCR reaction system

[0032] Experimental results are as follows Figure 4 As shown, compared with the empty control group, overexpression of EfBAG4 can significantly improve... IRF3 , IRF7 , ISG15 and IFN-α The mRNA level. This result indicates that, EfBAG4 Overexpression can effectively activate the interferon signaling cascade in brown-spotted grouper, providing a basis for subsequent... EfBAG4 This provides direct evidence for a strategy to target and control RGNNV infection by activating the endogenous interferon pathway.

[0033] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Brown-spotted grouper EfBAG4 The application of genes in the preparation of drugs against neuronecrosis virus infection is characterized by, The EfBAG4 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the nerve necrosis virus is the red-spotted grouper nerve necrosis virus.

2. The application according to claim 1, characterized in that, The anti-neurone necrosis virus infection drug also contains pharmaceutically acceptable excipients.

3. The application according to claim 1, characterized in that, The drug for treating nerve necrosis virus infection is administered orally or by injection.

4. The application according to claim 1, characterized in that, The dosage forms of the anti-neural necrosis virus infection drug include at least one of tablets, powders, granules, pills, and solutions.

5. The application according to claim 1, characterized in that, The application includes promoting immune genes in fish. IRF3 , IRF7 , ISG15 and IFN-α The expression, the IRF3 The nucleotide sequence is shown in SEQ ID NO.

16. IRF7 The nucleotide sequence is shown in SEQ ID NO.

17. ISG15 The nucleotide sequence is shown in SEQ ID NO.

18. IFN-α The nucleotide sequence is shown in SEQ ID NO.19.

Images