Whole canine antibodies and uses thereof

Abstract

Provided are canine antibodies (e.g., specific for canine programmed death 1) having improved yield and reduced antibody-dependent cell-mediated cytotoxicity effects in manufacturing processes. Also disclosed are nucleic acids encoding the antibodies, methods of treatment, and other methods or uses of the antibodies.

Description

[0001] Cross-referencing This application claims the benefit of International Patent Application No. PCT / CN2023 / 135191, filed on November 29, 2023, the entire contents of which are incorporated herein by reference. Background Technology

[0002] There is a need in the art to develop non-immunogenic canine antibodies (e.g., canine antibodies against immune checkpoint molecules such as PD-1) that can be used to treat veterinary diseases or conditions (e.g., cancer) in canine subjects. In particular, there is a need in the art to develop non-immunogenic canine antibodies that exhibit increased yield and reduced antibody-dependent cell-mediated cytotoxicity during manufacturing. Summary of the Invention

[0003] In one respect, this article discloses an antibody that contains canine IgG subclass IgG. A IgG B IgG C or IgG D The Fc region, and canine IgG subclass IgG A IgG B IgG C or IgG D The hinge region, where the Fc region and the hinge region belong to different canine IgG subclasses. In some embodiments, the Fc region belongs to the canine IgG subclass IgG. D In some implementations, the hinge region belongs to the canine IgG subclass IgG. B .

[0004] In one respect, this article discloses an isolated nucleic acid that encodes the antibody disclosed herein.

[0005] In one respect, this article discloses a vector containing isolated nucleic acids encoding the individuals disclosed herein.

[0006] In one respect, this article discloses a host cell containing the isolated nucleic acids disclosed herein.

[0007] In one aspect, this document discloses a pharmaceutical composition comprising the antibody disclosed herein, and pharmaceutically acceptable excipients, carriers, or diluents.

[0008] In one aspect, this document discloses a kit comprising the antibody or pharmaceutical composition disclosed herein, along with instructions for use.

[0009] In one aspect, this document discloses a method for treating a disease or condition in a subject of need, comprising administering to the subject an antibody disclosed herein, or a pharmaceutical composition disclosed herein.

[0010] In one aspect, this document discloses a method for preparing a pharmaceutical composition disclosed herein, comprising mixing an antibody disclosed herein with a pharmaceutically acceptable excipient, carrier, or diluent.

[0011] In one aspect, this document discloses a method for producing the antibodies disclosed herein, which includes culturing the host cells disclosed herein.

[0012] The antibodies disclosed herein, when administered to subjects, do not induce or induce reduced antibody-dependent cell-mediated cytotoxicity. Furthermore, the antibodies disclosed herein exhibit increased yield during manufacturing, at least due to reduced production of half-antibodies and HC dimers generated during the manufacturing process.

[0013] Incorporation All publications, patents and patent applications mentioned in this specification are incorporated by reference to the same extent that each individual publication, patent or patent application is specifically and individually indicated to be incorporated by reference. Attached Figure Description

[0014] The following detailed description of preferred embodiments of the present disclosure will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the present disclosure, the accompanying drawings show presently preferred embodiments. However, it should be understood that the present disclosure is not limited to the precise arrangement and means of the embodiments shown in the drawings.

[0015] Figure 1 A bar graph plots the binding of polyclonal phages to canine PD-1 as determined by ELISA, showing the incremental increase in binding after four rounds of panning. Recombinant canine PD-1 was adsorbed onto microtiter plates overnight at 4°C. Wells were washed and blocked with 2% milk in PBS (MPBS) at 37°C for 1 hour. The initial unpanned library (P0) and phage libraries obtained after each round of selection (P1 to P4) were added to the coated plates and incubated at 37°C for 1 hour. The plates were washed with PBS supplemented with 0.1% Tween (PBST), and the bound phages were detected using HRP-conjugated anti-M13 mAb diluted 1:5000 in MPBS. Bound phages were detected using ABTS. After 30 min, the OD at 405 nm was read using a Molecular Devices SpectraMax 340 spectrophotometer.

[0016] Figure 2(Left) Bar graph plotting the binding of eight monoclonal phages from the third and fourth rounds of panning to canine PD-1, as determined by ELISA, and showing the variability in binding strength between clones. No binding against the unrelated human CD19 antigen was observed. (Right) Bar graph plotting the binding of another eight monoclonal phages from the third and fourth rounds of panning to canine PD-1, as determined by ELISA, and showing the variability in binding strength between clones. No binding against the unrelated canine IL-13Ra2 antigen was observed. Antigens include human CD19 and canine IL-13Ra2. Polyclonal phages from the third round of panning against human CD19 (left), polyclonal phages from the fourth round of panning against IL-13Ra2 (right), and polyclonal phages from the fourth round of panning against cPD-1 (two graphs) were used as positive controls against human CD19 (left), human IL-13Ra2 (right), and canine PD-1 (two graphs), respectively. Evaluate the binding of each monoclonal phage to PD-1 once.

[0017] Figure 3 (Left) Line graph showing the binding of soluble scFv to increased plate-bound cPD-1 as determined by ELISA. Six out of 14 clones showed a dose-dependent increase in binding. No binding with unrelated MERS soluble scFv was observed. (Right) Line graph showing the binding of soluble scFv to increased plate-bound cPD-1 as determined by ELISA. Four out of six clones showed a dose-dependent increase in binding. No binding with unrelated MERS soluble scFv was observed. Binding of 19 unique soluble scFvs to cPD-1 was tested by ELISA. Increased amounts of biotinylated canine PD-1 were added to streptavidin-coated ELISA plate wells and incubated for 1 hour. 0.25 mg / ml of soluble HA-tagged scFv was added to the wells, and the bound scFv was detected using an AP-conjugated anti-HA antibody. Use an irrelevant soluble HA-tagged scFv for MERS (Middle East Respiratory Syndrome) as a negative control.

[0018] Figure 4(Figure A) Schematic diagram of PD-1:PD-L1 inhibition assay. Biotinylated cPD-1 was incubated with cPD-L1 Fc, the complex was tethered to a streptavidin ELISA plate, and a signal for complex formation was provided by an anti-Fc antibody. In the presence of a soluble scFv that inhibits cPD-1:cPD-L1 interaction, no complex formed and no signal was detected. (Figure B) Bar graph of colorimetric density providing readings if the cPD-1:cPD-L1 complex was detected. Increasing amounts of cPD-L1 were added to cPD-1 in the presence of different soluble cPD-1-specific scFvs. Different scFvs showed varying degrees of cPD-1:cPD-L1 complex inhibition, with complete inhibition resulting in no detected signal for the P3C6 soluble scFv.

[0019] Figure 5 Single flow cytometry plot of soluble scFv clones binding to target cells expressing or not expressing membrane-bound cPD-1. Binding scFs were detected using an anti-HA antibody. This plot shows that unrelated MERS scFvs did not bind to target cells with or without cell surface cPD-1. Four of the six clones shown demonstrated binding to target cells expressing cPD-1, but not to the same target cells not expressing cPD-1. Human erythroleukemia cell line K562 was gene-edited to eliminate FcgRII (CD32) (KTd32). The edited cells were retrovirally transduced to express cPD-1, and cPD-1-positive target cells were selected using puromycin. Soluble, purified HA-tagged scFvs were incubated with target cells, and binding scFvs were detected using a fluorescent anti-HA antibody. Soluble scFvs targeting MERS and clones 3-7, which showed low affinity for cPD-1 by ELISA, were used as negative controls.

[0020] Figure 6 (Figure A) Comparison of the VH amino acid sequence of PD-1 specific scFv clones, showing differences between clones and canine IGHV3-38. 01. High sequence homology between VH genes. The amino acid sequences of the VL chains of clones P4B1 and P3C6 were also compared, highlighting their very different sequences, reflecting their λ and κ origins, respectively.

[0021] Figure 6 (Figure B) Single flow cytometry image of full-length IgG containing the VH chain mutation of the P3C6 clone. D The antibody bound to target cells expressing cPD-1, but not to the same target cells not expressing cPD-1, confirming the specificity of cPD-1 binding. The figure shows that the unrelated full-length MERS antibody did not bind to target cells with or without cPD-1 on their cell surface.

[0022] Figure 7 (Figure A) Histograms showing the expression of cCD20 and cPD-L1 on target cells engineered to express each target antigen. Cells not transduced to express either cCD20 or cPD-L1 are negative. K562 cells were engineered to express canine CD20 (K562-cCD20) and canine PD-L1 (K562-cCD20-cPD-L1), and cell surface expression was confirmed by flow cytometry. (Figure B) Overlapping histograms showing cell proliferation at CTV dilutions. cPD-L1 expression on target cells inhibits T cell proliferation shown by lower CTV dilutions. Histograms showing T cell proliferation against cPD-L1 positive and negative cells overlap in the presence of P3C6mut3.1 antibody. Canine CD20 CAR-T cells from a dog were labeled with cell tracer violet (CTV) and co-cultured with K562-cCD20 or K562-cCD20-cPD-L1 at a 1:1 E:T ratio in the presence of anti-MERS antibody or P3C6mut3.1 mAb. After 72 hours of culture, CD8+ cells were assessed by flow cytometry. + CAR-T cell proliferation. The image shows live CD5+ cells. + CD8 + CAR + Cell gating. (Fig. C) Flow cytometry plots showing degranulation markers on the x-axis relative to forward scattering on the y-axis. Each plot shows canine CAR-T cells cultured with cCD20-expressing target cells (with or without cPD-L1) in the presence of unassociated antibody or P3C6mut3.1 antibody. In the presence of the latter antibody, the inhibitory effect of cPD-L1 on T cell degranulation was significantly reduced. Canine CD20 CAR-T cells from one dog were co-cultured with the same target cells in A at a 1:1 E:T ratio. CD107b expression was determined after 4 hours of co-culture. The plot shows the expression of live CD5+. + CD8 + CAR + Cells perform gating.

[0023] Figure 8The figures are bi-line plots showing the bi-exponential serum concentration-time curves and dose-normalized PK curves for two different doses of P3C6mut3.1 antibody. These plots show similar serum drug concentrations after the second dose of P3C6mut3.1 antibody, indicating the lack of anti-drug antibody formation. On days 0 and 21, healthy dogs were administered P3C6mut3.1 intravenously at 2 mg / kg (n=2) or 10 mg / kg (n=2). Blood samples were collected at specified time points, and the presence of P3C6mut3.1 in serum was analyzed using a custom-designed Meso Scale Discovery immunoassay. (Figure A) Serum pharmacokinetics of P3C6mut3.1, data expressed as mean ± SD. (Figure B) Dose-normalized concentration versus time curves of P3C6mut3.1.

[0024] Figure 9 P3C6mut3.1 exhibited nanomolar binding affinity for soluble cPD-1. As described above, the full-length P3C6mut 3.1 IgG was evaluated by surface plasmon resonance. D Affinity and binding kinetics with the extracellular domain of cPD-1. Using P3C6mut3.1 IgG. D A series of diluents (0-200 nM).

[0025] Figure 10 P3C6 marker in canine lymph node tissue. (Top image) Isotype control; (Bottom image) Full-length P3C6 mut3.1 IgG with HA tag. D Marker. Arrows indicate lymphocytes with strong PD-1 staining. Bars = 35 mM Figure 11 SDS-PAGE analysis of P3C6mut3.1. P3C6mut3.1 IgG original sequence under reducing (R) and non-reducing (NR) conditions (left). D Sequence (left image) and IgG D / B The sequence (after hinge modification) (right figure) is subjected to SDS page generation. Compared with the modified clone (right), the heavy chain dimer (approximately 100 kD) and single-chain antibody fragment (approximately 80 kD) are more prominent in the original sequence clone (left). Detailed Implementation

[0026] definition Certain specific details are set forth in the detailed description to provide a thorough understanding of the various embodiments. However, those skilled in the art will understand that the embodiments provided can be practiced without these details. Unless the context requires otherwise, the word “comprise” and its variations (such as “comprises” and “comprising”) shall be interpreted in an open, inclusive sense, meaning “including but not limited to”, in the following specification and claims. As used in this specification and the appended claims, the singular forms “a / an” and “the” include plural referents unless the context expressly indicates otherwise. It should also be noted that the term “or” is generally used to include the meaning of “and / or” unless the content expressly indicates otherwise. Furthermore, the headings provided herein are for convenience only and do not explain the scope or meaning of the claimed embodiments.

[0027] In this article, the article "a / an" refers to one or more of the grammatical objects of the article (i.e., at least one). For example, "element" refers to one or more elements.

[0028] As used herein, the term "about" means an amount close to 10% or less of the stated amount. As used herein, the terms "individual," "patient," or "object" mean an individual diagnosed with, suspected of having, or at risk of developing at least one disease for which the compositions and methods can be used to treat. In some embodiments, the individual is a mammal. In some embodiments, the mammal is a mouse, rat, rabbit, dog, cat, horse, cow, sheep, pig, goat, llama, alpaca, or yak. ​​In some embodiments, the individual is a dog or canine.

[0029] As used in this article, the term "antibody" refers to an immunoglobulin molecule that binds specifically to an antigen. Antibodies can be complete immunoglobulins derived from natural or recombinant sources, and can be the immunoreactive portion of a complete immunoglobulin. Antibodies are typically tetramers of immunoglobulin molecules comprising two heavy chains and two light chains. Each polypeptide chain contains three complementarity-determining regions (CDRs) that bind to the antigen and define the antigen specificity of the antibody.

[0030] As used herein, the terms “antibody” and “antibodies” may also include polypeptides or polypeptide complexes derived from full-length antibodies. These polypeptide complexes may be naturally occurring or constructed from single-chain antibodies or antibody fragments and retain antigen-specific binding capabilities. The antibodies of this disclosure may exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab')2, as well as single-chain antibodies, scFv, canine-derived antibodies, canine antibodies, humanized antibodies and human antibodies (Harlow et al., 1999, in: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, in: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). To prepare suitable antibodies, such as recombinant antibodies, monoclonal antibodies, or polyclonal antibodies, many techniques known in the art can be used (see, for example, Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., pp. 77-96, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985); Colligan, Current Protocols in Immunology (1991); Harlow & Lane, Antibodies, A Laboratory Manual (1988); and Goding, Monoclonal Antibodies: Principles and Practice (2nd edition, 1986)). Genes encoding the heavy and light chains of the antibody of interest can be cloned from cells; for example, genes encoding monoclonal antibodies can be cloned from hybridomas and used to produce recombinant monoclonal antibodies. Gene libraries encoding the heavy and light chains of monoclonal antibodies can also be prepared from hybridomas or plasma cells. Random combinations of heavy and light chain gene products produce large antibody libraries with different antigen specificities (see, for example, Kuby, Immunology (3rd edition, 1997)).The techniques used for producing single-chain or recombinant antibodies (US Patent Nos. 4,946,778, 4,816,567) are applicable to the production of the antibodies disclosed herein. Furthermore, transgenic mice or other organisms such as other mammals can be used to express humanized or human antibodies and canine or canine antibodies (see, for example, U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, Marks et al., Bio / Technology 10:779-783 (1992); Lonberg et al., Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994); Fishwild et al., Nature Biotechnology 14:845-51 (1996); Neuberger, Nature Biotechnology 14:826 (1996); and Lonberg & Huszar, Intern. Rev. Immunol. 13:65-93). (1995)). Alternatively, phage display technology can be used to identify antibodies and heterologous Fab fragments that specifically bind to selected antigens (see, for example, McCafferty et al., Nature 348:552-554 (1990); Marks et al., Biotechnology 10:779-783 (1992)). Antibodies can also be made bispecific, i.e., capable of recognizing two different antigens (see, for example, WO 93 / 08829, Traunecker et al., EMBO J. 10:3655-3659 (1991); and Suresh et al., Methods in Enzymology 121:210 (1986)). Antibodies can also be heteroconjugates, such as two covalently linked antibodies or immunotoxins (see, for example, U.S. Patent No. 4,676,980, WO 91 / 00360; WO 92 / 200373; and EP 03089).

[0031] In this article, molecules, peptides, polypeptides, antibodies, or antibody fragments may be referred to as "bispecific" or "dual-specific," including grammatical equivalents. Bispecific molecules possess the ability to specifically bind to at least two structurally different targets. Specific binding can result from two distinct binding sites with different structures at the molecular level, including but not limited to different amino acid sequences; or from binding with high affinity (e.g., KD less than approximately 1 x 10⁻⁶). -6A multispecific antibody is a single binding region that specifically binds to two structurally different targets. A molecule, peptide, polypeptide, antibody, or antibody fragment referred to as "multispecific" is one that has the ability to specifically bind to at least three structurally different targets. A "bispecific antibody" (including syntactic equivalents) is a bispecific molecule that retains at least one antibody fragment capable of specifically binding to a target (e.g., from the variable region, heavy chain, or light chain of the antibody molecule, or one or more complementarity-determining regions).

[0032] The term "connector" as used herein is also referred to as a "connector sequence," "spacer region," "tethering sequence," or their grammatical equivalents. A "connector" as described herein links two distinct molecules that are themselves target-binding, catalytically active, or naturally expressed and assembled into a single polypeptide, or contain a single domain of the same polypeptide. Examples include two distinct binding moieties or heavy / light chain pairs. Many strategies can be used to covalently link molecules together. The connectors described herein can be used to link the variable regions of the light and heavy chains in scFv molecules; or to bind scFv or other antigen-binding fragments to the N- or C-terminus of the antibody heavy chain; or the N- or C-terminus of the light chain to produce bispecific or multispecific binding molecules. These include, but are not limited to, polypeptide linkages between the N- and C-termini of proteins or protein domains, linkages via disulfide bonds, and linkages via chemical cross-linking agents. In one aspect of this embodiment, the connector is a peptide bond generated through recombinant technology or peptide synthesis. The connector peptide may primarily comprise the following amino acid residues: Gly, Ser, Ala, or Thr. The length of the connector peptide should be sufficient to link two molecules so that they present the correct conformation to each other, thereby maintaining their desired activity. In one embodiment, the linker is about 1 to 50 amino acids long or about 1 to 30 amino acids long. In one embodiment, a linker of 1 to 20 amino acids long can be used. Available linkers include glycine-serine polymers, including, for example, (GS)n, (GSGGS)n, (GGGGS)n, and (GGGS)n, where n is an integer of at least 1; glycine-alanine polymers; alanine-serine polymers; and other flexible linkers. Exemplary linkers for attaching antibody fragments or single-chain variable fragments may include AAEPKSS, AAEPKSSDKTHTCPPCP, GGGG, or GGGGDKTHTCPPCP. Alternatively, a variety of non-protein polymers can be used as linkers, including but not limited to polyethylene glycol (PEG), polypropylene glycol, polyoxyethylene, or copolymers of polyethylene glycol and polypropylene glycol.

[0033] The terms “complementarity-determining region” and “CDR”, known in the art as synonyms for “hypervariant region” or “HVR,” refer to a non-continuous amino acid sequence within the variable region of an antibody that confers antigen specificity and / or binding affinity. Typically, there are three CDRs in each heavy chain variable region (CDR-H1, CDR-H2, CDR-H3) and three CDRs in each light chain variable region (CDR-L1, CDR-L2, CDR-L3). The terms “frame region” and “FR”, known in the art, refer to the non-CDR portions of the variable regions of the heavy and light chains. Typically, there are four FRs in each full-length heavy chain variable region (FR-H1, FR-H2, FR-H3, and FR-H4) and four FRs in each full-length light chain variable region (FR-L1, FR-L2, FR-L3, and FR-L4).The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of many well-known schemes, including Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th edition, Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al-Lazikani et al., (1997) JMB 273, 927-948 (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), "Antibody-antigen interactions: Contact analysis and binding site topography," J. Mol. Biol. 262, 732-745. (“Contact” numbering scheme); Lefranc MP et al., "IMGT uniquenumbering for immunoglobulin and T cell receptor variable domains and Igsuperfamily V-like domains," Dev Comp. Immunol, January 2003; 27(1): 55-77 (“IMGT” numbering scheme); Honegger A and Plückthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” JMol Biol, June 8, 2001; 309(3): 657-70 (“Aho” numbering scheme); and Whitelegg NR and ReesAR, “WAM: an improved algorithm for modelling antibodies on the WEB,” ProteinEng, December 2000; 13(12): 819-24 (“AbM” numbering scheme). In some embodiments, the CDR of the antibodies described herein can be defined by a method selected from Kabat, Chothia, IMGT, Aho, AbM, or combinations thereof.

[0034] The boundaries of a given CDR or FR can vary depending on the scheme used for identification. For example, the Kabat scheme is based on structure alignment, while the Chothia scheme is based on structural information. Both the Kabat and Chothia schemes number antibodies based on the most common antibody region sequence lengths, where insertions are accommodated by an insertion letter, such as "30a," and deletions occur in some antibodies. These two schemes place certain insertions and deletions ("indels") in different positions, resulting in different numbering. The Contact scheme is based on the analysis of complex crystal structures and is similar to the Chothia numbering scheme in many respects. In some implementations, the CDR of the antibody described herein can be defined using the IMGT method.

[0035] The term "variable region" or "variable domain" refers to the structural domain of the antibody heavy or light chain involved in binding the antibody to the antigen. The heavy and light chains of natural antibodies (V1 and V2, respectively) H and V L The variable domains of ) typically have similar structures, where each domain contains four conservative frame regions (FRs) and three CDRs (see, for example, Kindt et al., Kuby). Immunology , 6th edition, WH Freeman and Co., page 91 (2007). Single V H or V L The structural domain is sufficient to confer antigen-binding specificity. Furthermore, V can be used. H or V L The structural domain separates antibodies that bind to specific antigens from those that bind to the antigen, in order to screen complementary V antibodies. L or V H Libraries of structural domains (see, for example, Portolano et al.) J. Immunol 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991)).

[0036] The specific binding or binding of antibody molecules described herein refers to binding mediated by one or more CDR moieties of the antibody. Not all CDRs require specific binding. Specific binding can be demonstrated, for example, by an ELISA targeting a specific enumerated target or antigen, which shows a significant increase in binding compared to an isotype control antibody.

[0037] An epitope is a binding determinant of an antibody or fragment, as described herein, that is minimal for the specific binding of the antibody or its fragment to a target antigen. When the target antigen is a polypeptide, the epitope can be continuous or discontinuous. A continuous epitope is formed from a single region of the target antigen, while a discontinuous epitope can be formed from two or more separate regions. For example, a discontinuous epitope can be formed when the target antigen employs a tertiary structure that brings two amino acid sequences close together to form a three-dimensional structure that the antibody binds to. When the target antigen is a polypeptide, the epitope is typically a chain of multiple amino acids linked together. Continuous epitopes can contain 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive amino acids. While an epitope can contain a continuous polymer of amino acids, not every amino acid in the polymer is contacted by an amino acid residue of the antibody. These non-contacting amino acids will still constitute part of the epitope because they may be important for the structure and linkage of the contacting amino acids. A person skilled in the art can determine whether any given antibody binds to an epitope of a reference antibody, for example, through a cross-blocking assay with a reference antibody. In some embodiments, the present invention describes an antibody that binds to the same epitope as the antibody. In some embodiments, the present invention describes an antibody that is competitively blocked by the antibody. In some embodiments, the present invention describes an antibody that competitively binds to the antibody.

[0038] The term "antibody fragment" refers to a polypeptide that contains or is derived from a portion of a complete antibody and includes the antigen-binding determining variable region of the complete antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, scFv antibodies, single-domain antibodies such as camel antibodies (Riechmann, 1999, Journal of Immunology Methods 231:25-38) consisting of VL or VH domains exhibiting sufficient affinity for the target, and multispecific antibodies formed from antibody fragments. Antibody fragments can be prepared by a variety of techniques, including, but not limited to, proteolytic digestion of complete antibodies and production via recombinant host cells. In some embodiments, the antibody is a recombinantly generated fragment, such as fragments containing non-naturally occurring arrangements, such as those having two or more antibody regions or chains linked by synthetic linkers (e.g., peptide linkers), and / or those not produced by enzymatic digestion of naturally occurring complete antibodies. In some aspects, the antibody fragment is scFv.

[0039] The Fab or Fab fragment contains a light chain constant domain and a first constant domain (CH1) of the heavy chain. The Fab' or Fab' fragment differs from the Fab fragment in that several residues are added to the carboxyl terminus of the heavy chain CH1 domain, including one or more cysteine ​​residues from the antibody hinge region. The Fab' fragment is generated by cleaving the disulfide bond on the hinge cysteine ​​residue of the F(ab')2 pepsin digestion product. Other chemical conjugations of antibody fragments are known to those skilled in the art. The Fab and F(ab')2 fragments lack the fragment crystallizable (Fc) region of the intact antibody, are cleared from animal circulation more quickly, and have less non-specific tissue binding than the intact antibody. The "Fv" fragment is the smallest fragment of the antibody containing complete target recognition and binding sites. This region consists of a heavy chain variable domain and a light chain variable domain in a tightly, non-covalently associated dimer (VH-VL dimer). It is in this configuration that the three CDRs of each variable domain interact to define the target binding site on the surface of the VHVL dimer. In some cases, six CDRs confer antibody target binding specificity. However, in other cases, even a single variable domain (or half of an Fv containing only three target-specific CDRs) can have the ability to recognize and bind to a target. Single-domain antibodies (sdAbs) / single-chain fragments consist of a single VH or VL domain exhibiting sufficient affinity for the antigen. Antibody fragments may also include portions of canine antibodies or canine-derived antibodies. scFvs (single-chain Fvs) refer to antibody-binding fragments containing both the VH and VL domains of the antibody, where these domains are present within a single polypeptide chain. Typically, scFv polypeptides also contain a polypeptide linker between the VH and VL domains, which allows the scFv to form a structure favorable for target binding.

[0040] The term "biantibody" refers to a small antibody fragment prepared by constructing an scFv fragment with a short linker (approximately 5-10 residues) between the VH and VL domains. This allows for interchain rather than intrachain pairing of variable domains, resulting in a bivalent fragment, i.e., a fragment with two antigen-binding sites. A bispecific biantibody is a heterodimer of two "crossover" scFv fragments, where the VH and VL domains of the two antibodies reside on different polypeptide chains.

[0041] The term "linear antibody" typically refers to an antibody containing a pair of tandem Fd regions (VH-CH1-VH-CH1), which together with a complementary light chain polypeptide form a pair of antigen-binding regions. Linear antibodies can be bispecific or monospecific.

[0042] As used in this article, “antibody heavy chain” refers to the larger of the two types of polypeptide chains that exist in all antibody molecules in their naturally occurring conformation.

[0043] As used in this article, "antibody light chain" refers to the smaller of two types of polypeptide chains that exist in all antibody molecules in their naturally occurring conformation. κ and λ light chains refer to the two main isotypes of antibody light chains.

[0044] As used herein, the term "synthetic antibody" refers to an antibody produced using recombinant DNA technology, such as an antibody expressed by a bacteriophage as described herein. The term should also be interpreted as referring to an antibody produced by synthesizing a DNA molecule encoding an antibody, wherein the DNA molecule expresses an antibody protein or an amino acid sequence specifying an antibody, wherein the DNA or amino acid sequence is obtained using synthetic DNA or amino acid sequence techniques available and well-known in the art.

[0045] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response may involve antibody production or activation of specific immune-active cells, or both. Those skilled in the art will understand that any macromolecule, including virtually all proteins or peptides, can be used as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. Those skilled in the art will understand that any DNA containing a nucleotide sequence or a portion of a protein encoding an immune response thus encodes the term "antigen" as used herein. Furthermore, those skilled in the art will understand that an antigen does not necessarily need to be encoded solely by the full-length nucleotide sequence of a gene. It is apparent that this disclosure includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in various combinations to elicit a desired immune response. Furthermore, those skilled in the art will understand that an antigen does not necessarily need to be encoded by a "gene". It is apparent that antigens can be synthesized or can be derived from biological samples. Such biological samples can include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.

[0046] As used herein, the term "antitumor effect" refers to a biological effect that can manifest as a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer. The "antitumor effect" can also manifest as the ability of the peptides, polynucleotides, cells, and antibodies disclosed herein to prevent tumorigenesis.

[0047] As used in this article, the term "self" means any material derived from the same individual that will subsequently be reintroduced into that individual.

[0048] "Also-alien" refers to grafts derived from different animals of the same species.

[0049] "Heterogeneous" refers to grafts derived from different animal species.

[0050] As used herein, the term "cancer" is defined as a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the bloodstream and lymphatic system. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, and lung cancer. In some implementations, the cancer is medullary thyroid carcinoma.

[0051] As used herein, the term "conserved sequence modification" is intended to refer to amino acid modifications that do not significantly affect or alter the binding properties of an antibody containing an amino acid sequence. Such conserved modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies of this disclosure using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conserved amino acid substitution is the replacement of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, one or more amino acid residues within the CDR region of the antibodies disclosed herein can be substituted with other amino acid residues from the same side chain family, and the ability of the modified antibody to bind GFRα4 can be tested using the functional assays described herein.

[0052] As used herein, the term "co-stimulatory ligand" includes molecules expressed by antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to homologous co-stimulatory molecules on T cells, thereby providing a signal that mediates T cell responses, including but not limited to proliferation, activation, and differentiation, in addition to the primary signal provided by, for example, the binding of the TCR / CD3 complex to a peptide-loaded MHC molecule. Co-stimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin β receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Costimulatory ligands also include, in particular, antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40L, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0053] "Co-stimulatory molecules" are cell surface molecules expressed by T cells that specifically bind to co-stimulatory ligands expressed by antigen-presenting cells (APCs), thereby providing a "secondary signal." This secondary signal combines with the "primary signal" delivered through the interaction of MHC / HLA antigens with the T cell receptor (TCR), leading to optimal T cell activation, including but not limited to cytokine production and proliferation. Co-stimulatory molecules include, but are not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40L, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0054] The term "dysregulation," when used to refer to the expression levels or activities of PD-1 or its ligands PD-L1 and PD-L2, refers to an expression level or activity that differs from the expression levels or activities of PD-1 or its ligands in otherwise identical healthy animals, organisms, tissues, cells, or components thereof. The term "dysregulation" also refers to alterations in the regulation of PD-1 and PD-L1 expression levels and activities compared to regulation in otherwise identical healthy animals, organisms, tissues, cells, or components thereof.

[0055] "Encoding" refers to the inherent characteristics of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA, or mRNA) that serves as a template in biological processes for the synthesis of other polymers and macromolecules having defined nucleotide sequences (i.e., rRNA, tRNA, and mRNA) or defined amino acid sequences and the resulting biological characteristics. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, then the gene encodes that protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing) and the non-coding strand (which serves as a template for gene or cDNA transcription) can be referred to as encoding the protein or other product of that gene or cDNA.

[0056] Unless otherwise stated, "nucleotide sequences encoding amino acid sequences" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNA may include introns.

[0057] The terms “effective amount” or “therapeutic effective amount” are used interchangeably herein and refer to the amount of a compound, formulation, material, or composition that effectively achieves a particular biological outcome as described herein. These outcomes may include, but are not limited to, inhibition of viral infection by any means applicable in the art.

[0058] As used in this article, “endogenous” means any material that originates from or is produced within an organism, cell, tissue, or system.

[0059] As used herein, the term “exogenous” means any material introduced or produced from an organism, cell, tissue, or system.

[0060] The term “expression” as used in this article is defined as the transcription and / or translation of a specific nucleotide sequence driven by its promoter.

[0061] "Expression vector" refers to a vector containing a recombinant polynucleotide that includes an expression control sequence operatively linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression may be provided by a host cell or an in vitro expression system. Expression vectors include all vectors known in the art, such as granules, plasmids (e.g., naked plasmids or plasmids contained in liposomes), and viruses incorporating recombinant polynucleotides (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses).

[0062] As used herein, “homology” refers to the identity of subunit sequences between two polymer molecules (e.g., between two nucleic acid molecules, such as two DNA molecules or two RNA molecules, or two polypeptide molecules). Two molecules are homologous when a subunit position is occupied by the same monomeric subunit; for example, if each of two DNA molecules has a position occupied by adenine. Homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half the positions in two sequences (e.g., five positions in a polymer of ten subunits) are homologous, then the two sequences are 50% homologous; if 90% of the positions (e.g., nine out of ten) are matching or homologous, then the two sequences are 90% homologous.

[0063] Humanized, canine, and chimeric non-human or non-dog (e.g., mouse) antibodies are immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) containing a minimal sequence derived from a non-human or non-dog immunoglobulin. In most cases, humanized, canine, and chimeric antibodies are human or canine immunoglobulins (receptor antibodies) where residues from the receptor complementarity-determining region (CDR) are replaced by residues from the CDR of a non-human or non-dog species (donor antibody) (such as a mouse, rat, or rabbit with the desired specificity, affinity, and ability). In some cases, Fv frame region (FR) residues of a human or canine immunoglobulin are replaced by corresponding non-human or non-dog residues. Furthermore, humanized, canine, and chimeric antibodies may contain residues not found in the receptor antibody or in the introduced CDR or frame sequence. These modifications are made to further refine and optimize antibody performance. Typically, humanized, canine-derived, and chimeric antibodies will substantially contain all of at least one (usually two) variable domains, wherein all or substantially all of the CDR regions correspond to those of non-human immunoglobulins, and all or substantially all of the FR regions are those of human or canine immunoglobulin sequences. Preferably, canine-derived and chimeric antibodies will also contain at least a portion of the immunoglobulin constant region (Fc) – typically the canine immunoglobulin constant region.

[0064] "Complete canine" or "canine antibody" refers to immunoglobulins, such as antibodies, whose amino acid sequences correspond to those of antibodies produced by dogs or canine cells, or of non-canine origin utilizing canine antibody libraries or other canine antibody-coding sequences, including canine antibody libraries. This term does not include canine-derived forms of non-canine antibodies containing non-canine antigen-binding regions (such as those where all or substantially all of the CDRs are non-canine). In some cases, complete canine antibodies do not include a portion of the antibody sequence from a non-canine species. Canine antibodies can be prepared by administering an immunogen to transgenic animals modified to produce complete canine antibodies or complete antibodies with canine variable regions in response to antigen challenge. These animals typically contain all or part of canine immunoglobulin loci, which substitute for endogenous immunoglobulin loci, or are present extrachromosomally or randomly integrated into the animal's chromosome. In such transgenic animals, endogenous immunoglobulin loci are typically inactivated. Canine antibodies can also be derived from canine antibody libraries, including phage display and cell-free libraries, containing antibody-coding sequences derived from canine libraries.

[0065] As used herein, “guidance material” includes publications, records, charts, or any other medium of expression that may be used to convey the usefulness of the compositions and methods of this disclosure. Guidance material for the kits of this disclosure may, for example, be attached to a container containing the nucleic acids, peptides, and / or compositions of this disclosure, or may be shipped together with the container containing the nucleic acids, peptides, and / or compositions. Alternatively, guidance material may be shipped separately from the container for the purpose of the recipient using the guidance material and the compound in tandem.

[0066] As used herein, “identity” refers to the percentage (%) of sequence identity relative to a reference polypeptide sequence. It is the percentage of amino acid residues in the candidate sequence that are identical to those in the reference polypeptide sequence after aligning the sequences and introducing gaps as needed to achieve the maximum percentage of sequence identity, without considering any conserved substitutions as part of the sequence identity. Alignments used to determine the percentage of amino acid sequence identity can be performed in various known ways, such as using publicly available computer software like BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR). Appropriate parameters for aligning sequences can be determined, including the algorithms required to achieve maximum alignment across the full length of the compared sequences. However, for the purposes of this paper, the amino acid sequence identity percentage values ​​were generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc., and the source code has been submitted with user documentation to the U.S. Copyright Office at 20559 Washington, D.C., and registered under U.S. Copyright Registry No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, California, or can be compiled from source code. The ALIGN-2 program should be compiled for use on UNIX operating systems, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and will not be changed.

[0067] When using ALIGN-2 for amino acid sequence comparison, the percentage of amino acid sequence identity between a given amino acid sequence A and, and, or for a given amino acid sequence B (which can be alternatively expressed as a given amino acid sequence A having or containing a certain percentage of amino acid sequence identity with, and, or for a given amino acid sequence B) is calculated as follows: 100 multiplied by the fraction X / Y, where X is the number of amino acid residues that are scored as identical matches by the sequence alignment program ALIGN-2 in the procedural alignment of A and B, and where Y is the total number of amino acid residues in B. It should be understood that when the length of amino acid sequence A is not equal to the length of amino acid sequence B, the percentage of amino acid sequence identity between A and B will not be equal to the percentage of amino acid sequence identity between B and A. Unless otherwise specified, all amino acid sequence identity percentage values ​​used herein were obtained using the ALIGN-2 computer program as described in the preceding paragraph.

[0068] "Separated" means altered or removed from its natural state. For example, nucleic acids or peptides naturally present in living animals are not "separated," but the same nucleic acids or peptides that are partially or completely separated from their natural counterparts are "separated." Separated nucleic acids or proteins can exist in substantially pure form or in non-natural environments, such as, for example, host cells.

[0069] In the context of this disclosure, the following abbreviations for common nucleic acid bases are used: “A” for adenosine, “C” for cytosine, “G” for guanosine, “T” for thymidine, and “U” for uridine.

[0070] Unless otherwise stated, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Where nucleotide sequences encoding proteins may contain introns in some versions, nucleotide sequences of phrases encoding proteins or RNA may also contain introns.

[0071] The term "operably linked" refers to a functional connection between a regulatory sequence and a heterologous nucleic acid sequence, resulting in the expression of the latter. For example, the first and second nucleic acid sequences are operably linked when they are functionally related. Similarly, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably linked to the coding sequence. Typically, operably linked DNA sequences are contiguous, and two protein-coding regions are linked within the same reading frame when necessary.

[0072] "Parenteral" administration of immunogenic compositions includes techniques such as subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection or infusion.

[0073] As used herein, the term "polynucleotide" is defined as a nucleotide chain. Furthermore, nucleic acids are polymers of nucleotides. Therefore, as used herein, nucleic acids and polynucleotides are interchangeable. Those skilled in the art will have general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by any means available in the art, including but not limited to recombinant methods, i.e., cloning nucleic acid sequences from recombinant libraries or cell genomes using common cloning techniques and PCR™, as well as synthetic methods.

[0074] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids interconnected by peptide bonds. As used herein, the term refers to both short chains (e.g., which are commonly referred to in the art as peptides, oligopeptides, and oligomers) and longer chains (which are commonly referred to in the art as proteins, of which there are many types). “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include native peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0075] As used in this article, the term "promoter" is defined as a DNA sequence that is recognized by the cell's synthetic mechanisms or introduced synthetic mechanisms and is required to initiate specific transcription of a polynucleotide sequence.

[0076] As used herein, the term "promoter / regulatory sequence" refers to the nucleic acid sequence required to express a gene product operatively linked to a promoter / regulatory sequence. In some cases, this sequence may be a core promoter sequence, and in others, it may include enhancer sequences and other regulatory elements required to express the gene product. For example, a promoter / regulatory sequence may be a sequence that expresses a gene product in a tissue-specific manner.

[0077] A "constitutive" promoter is a nucleotide sequence that, when operatively linked to a polynucleotide encoding or specifying a gene product, results in the production of the gene product in the cell under most or all physiological conditions.

[0078] An "inducible" promoter is a nucleotide sequence that, when operatively linked to a polynucleotide encoding or specifying a gene product, essentially produces the gene product in the cell only when an inducer corresponding to the promoter is present in the cell.

[0079] A tissue-specific promoter is a nucleotide sequence that, when linked to a gene-encoded or specified polynucleotide operation, produces a gene product in the cell only if the cell is a cell of the tissue type corresponding to the promoter.

[0080] "Signal transduction pathways" refer to the biochemical relationships between various signal transduction molecules that play a role in transmitting signals from one part of the cell to another. The phrase "cell surface receptors" includes molecules and molecular complexes that are capable of receiving signals and transmitting them across the cell membrane. An example of a "cell surface receptor" is human GFRα4.

[0081] "Single-chain antibody" refers to an antibody formed through recombinant DNA technology, in which immunoglobulin heavy and light chain fragments are linked together using engineered amino acid spans to reconstruct the Fv region of the antibody into a single polypeptide. Various methods for producing single-chain antibodies are known, including those described in U.S. Patent No. 4,694,778; Bird (1988) Science 242:423-442; Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; Ward et al. (1989) Nature 334:54454; and Skerra et al. (1988) Science 242:1038-1041.

[0082] The term "object" is intended to include a living organism (e.g., a mammal) in which an immune response can be elicited. As used herein, "object" or "patient" can be a human or a non-human mammal. For example, non-human mammals include livestock and companion animals such as sheep, cattle, pigs, canines, felines, and rodents. Preferably, the object is a canine.

[0083] As used herein, “substantially pure” cells are cells that substantially do not contain other cell types. Substantially pure cells also refer to cells that have been isolated from other cell types normally associated with them in their natural state. In some cases, a substantially pure cell population refers to a homogeneous cell population. In other cases, the term refers only to cells that have been isolated from cells naturally associated with them in their natural state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

[0084] As used in this article, the term "therapeutic" refers to treatment and / or prevention. Therapeutic effects are achieved by suppressing, alleviating, or eradicating a disease state.

[0085] As used herein, the terms “transfected,” “transformed,” or “transduced” refer to the process of transferring or introducing exogenous nucleic acids into host cells. “Transfected,” “transformed,” or “transduced” cells are cells that have been transfected, transformed, or transduced with exogenous nucleic acids. These cells include primary target cells and their progeny.

[0086] As used in this article, the phrases “under transcriptional control” or “operably linked” mean that the promoter is in the correct position and orientation relative to the polynucleotide to control the initiation of transcription by RNA polymerase and the expression of the polynucleotide.

[0087] A “vector” is a composition containing isolated nucleic acids and capable of delivering the isolated nucleic acids into the cell. Many vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term “vector” includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc. Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.

[0088] As used herein, the term “specific binding” refers to an antibody or ligand that recognizes and binds to homologous binding chaperone proteins (e.g., stimulating and / or co-stimulating molecules present on T cells) in a sample, but which does not substantially recognize or bind to other molecules in the sample.

[0089] The term "stimulus" refers to a primary response induced by the binding of a stimulating molecule (e.g., the TCR / CD3 complex) to its homologous ligand, thereby mediating signal transduction events, such as, but not limited to, signal transduction via the TCR / CD3 complex. Stimulus can mediate alterations in the expression of certain molecules, such as downregulation of TGF-β and / or reorganization of the cytoskeleton.

[0090] As used in this article, the term "stimulatory molecule" refers to a molecule on T cells that specifically binds to homologous stimulatory ligands present on antigen-presenting cells and / or tumor cells.

[0091] As used herein, "stimulatory ligand" refers to a ligand that, when present on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) or tumor cells, can specifically bind to homologous binding partners (referred to herein as "stimulatory molecules") on T cells, thereby mediating primary T cell responses, including but not limited to activation, initiation of immune responses, and proliferation. Stimulatory ligands are well known in the art and particularly include MHC class I molecules loaded with peptides, anti-CD3 antibodies, superagonist anti-CD28 antibodies, and superagonist anti-CD2 antibodies.

[0092] Scope: In this disclosure, various aspects of this disclosure may be presented in a scope format. It should be understood that descriptions in scope form are for convenience and brevity only and should not be considered as a fixed limitation on the scope of this disclosure. Therefore, a description of a scope should be considered as explicitly disclosing all possible sub-scopes within that scope and each individual numerical value. For example, a description of a scope such as 1 to 6 should be considered as explicitly disclosing its sub-scopes such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and individual numbers within that scope, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of how broad the scope may be.

[0093] Combining peptides, antibodies, and scFv In various respects, this document discloses antibodies or antigen-binding fragments thereof (or “binding peptides,” used interchangeably), characterized by specific functional features or properties of the antibody or antigen-binding fragments thereof. For example, binding peptides and antibodies specifically bind canine programmed death protein 1 (“cPD-1” or “canine PD-1”, used interchangeably). The binding peptides and antibodies of this disclosure can bind canine PD-1 with high affinity. The binding peptides and antibodies of this disclosure can specifically recognize naturally expressed canine PD-1 protein on cells. In some cases, the binding peptides and antibodies of this disclosure do not cross-react with other surface molecules on such cells. The binding peptides and antibodies of this disclosure can specifically bind canine PD-1 protein naturally expressed on cells, thus such binding prevents canine PD-1 from binding to its natural ligands, such as canine programmed death ligand 1 (“cPD-L1” or “canine PD-L1”). In some cases, the cell is a tumor cell (e.g., melanoma, non-small cell lung cancer, and hepatocellular carcinoma). In some cases, the cell is an immune cell. In some cases, the immune cells include T cells (e.g., activated T cells), B cells, natural killer (NK) cells, regulatory T cells, macrophages, or dendritic cells (DCs). In some cases, the immune cells include activated T cells. In some cases, the immune cells include tumor-infiltrating lymphocytes. In some cases, cPD-L1 is overexpressed on tumor cells. In some cases, antibodies or their antigen-binding fragments can bind to cPD-1 and inhibit the cPD-1 signaling pathway.

[0094] In some aspects, this disclosure provides antibodies or antigen-binding fragments thereof that specifically bind to canine programmed death protein 1 (PD-1). In some cases, the antibody or antigen-binding fragment includes a heavy chain complementarity-determining region 1 (HCDR1). In some cases, the antibody or antigen-binding fragment includes a heavy chain complementarity-determining region 2 (HCDR2). In some cases, the antibody or antigen-binding fragment includes a heavy chain complementarity-determining region 3 (HCDR3). In some cases, the antibody or antigen-binding fragment includes a light chain complementarity-determining region 1 (LCDR1). In some cases, the antibody or antigen-binding fragment includes a light chain complementarity-determining region 2 (LCDR2). In some cases, the antibody or antigen-binding fragment includes a light chain complementarity-determining region 3 (LCDR3). In some embodiments, the antigen-binding domain includes a heavy chain variable region containing three heavy chain complementarity-determining regions (HCDRs) and a light chain variable region containing three light chain complementarity-determining regions (LCDRs).

[0095] In some aspects, this disclosure provides an isolated binding polypeptide comprising HCDR1, wherein HCDR1 comprises the amino acid sequence shown in SEQ ID NO: 1, 27, or 43. An isolated binding polypeptide comprising HCDR2, wherein HCDR2 comprises the amino acid sequence shown in SEQ ID NO: 2, 28, or 44. An isolated binding polypeptide comprising HCDR3, wherein HCDR3 comprises the amino acid sequence shown in SEQ ID NO: 3, 29, or 45. An isolated binding polypeptide comprising a light chain variable region comprising LCDR1, wherein LCDR1 comprises the amino acid sequence shown in SEQ ID NO: 4, 30, or 46. An isolated binding polypeptide comprising LCDR2, wherein LCDR2 comprises the amino acid sequence shown in SEQ ID NO: 5, 31, or 47. An isolated binding polypeptide comprising LCDR3, wherein LCDR3 comprises the amino acid sequence shown in SEQ ID NO: 6, 32, or 48.

[0096] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain complementarity-determining region 1 (HCDR1) containing the amino acid sequence shown in SEQ ID NO: 1, 27, or 43; a heavy chain complementarity-determining region 2 (HCDR2) containing the amino acid sequence shown in SEQ ID NO: 2, 28, or 44; a heavy chain complementarity-determining region 3 (HCDR3) containing the amino acid sequence shown in SEQ ID NO: 3, 29, or 45; a light chain complementarity-determining region 1 (LCDR1) containing the amino acid sequence shown in SEQ ID NO: 4, 30, or 46; a light chain complementarity-determining region 2 (LCDR2) containing the amino acid sequence shown in SEQ ID NO: 5, 31, or 47; and a light chain complementarity-determining region 3 (LCDR3) containing the amino acid sequence shown in SEQ ID NO: 6, 32, or 48. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1). In some cases, the antibody or antigen-binding fragment includes a heavy chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 7, 9, 33, or 49. In some cases, the antibody or antigen-binding fragment includes a light chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 11, 35, or 51. In some cases, the antibody or antigen-binding fragment includes an immunoglobulin heavy chain containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 19, 21, 23, 39, 55, or 70-75. In some cases, the antibody or antigen-binding fragment contains an immunoglobulin light chain containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 25, 41, or 57.

[0097] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 7, 9, 33, or 49; and a light chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 11, 35, or 51. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0098] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 7, 9, 33 or 49; and a light chain variable region containing the amino acid sequence shown in SEQ ID NO: 11, 35 or 51. In some cases, the antibody or the antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1).

[0099] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 19, 21, 23, 39, 55, or 70-75; and an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 25, 41, or 57. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0100] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain containing the amino acid sequence shown in SEQ ID NO: 19, 21, 23, 39, 55 or 70-75; and an immunoglobulin light chain containing the amino acid sequence shown in SEQ ID NO: 25, 41 or 57. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0101] In some aspects, this disclosure provides an isolated binding polypeptide comprising HCDR1 containing the amino acid sequence shown in SEQ ID NO: 1, HCDR2 containing the amino acid sequence shown in SEQ ID NO: 2, HCDR3 containing the amino acid sequence shown in SEQ ID NO: 3, LCDR1 containing the amino acid sequence shown in SEQ ID NO: 4, LCDR2 containing the amino acid sequence shown in SEQ ID NO: 5, and LCDR3 containing the amino acid sequence shown in SEQ ID NO: 6. In some embodiments, the isolated binding polypeptide is an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1). In some embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 7 or 9. In some embodiments, the antibody or its antigen-binding fragment comprises a light chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 11. In some embodiments, the antibody or its antigen-binding fragment comprises an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 19, 21, or 23. In some embodiments, the antibody or its antigen-binding fragment comprises an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 25.

[0102] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 7 or 9; and a light chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 11. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0103] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 11. In some cases, the antibody or the antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1).

[0104] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 9; and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 11. In some cases, the antibody or the antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1).

[0105] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 19, 21, or 23; and an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 25. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0106] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain containing the amino acid sequence shown in SEQ ID NO: 19; and an immunoglobulin light chain containing the amino acid sequence shown in SEQ ID NO: 25. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0107] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain containing the amino acid sequence shown in SEQ ID NO: 21; and an immunoglobulin light chain containing the amino acid sequence shown in SEQ ID NO: 25. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0108] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain containing the amino acid sequence shown in SEQ ID NO: 23; and an immunoglobulin light chain containing the amino acid sequence shown in SEQ ID NO: 25. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0109] In some aspects, this disclosure provides an isolated binding polypeptide comprising HCDR1 containing the amino acid sequence shown in SEQ ID NO: 27, HCDR2 containing the amino acid sequence shown in SEQ ID NO: 28, HCDR3 containing the amino acid sequence shown in SEQ ID NO: 29, LCDR1 containing the amino acid sequence shown in SEQ ID NO: 30, LCDR2 containing the amino acid sequence shown in SEQ ID NO: 31, and LCDR3 containing the amino acid sequence shown in SEQ ID NO: 32. In some embodiments, the isolated binding polypeptide is an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1). In some embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 33. In some embodiments, the antibody or its antigen-binding fragment comprises a light chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 35. In some embodiments, the antibody or its antigen-binding fragment comprises an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 39. In some embodiments, the antibody or its antigen-binding fragment comprises an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 41.

[0110] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 33; and a light chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 35. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0111] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 33; and a light chain variable region containing the amino acid sequence shown in SEQ ID NO: 35. In some cases, the antibody or the antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1).

[0112] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 39; and an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 41. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0113] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain containing the amino acid sequence shown in SEQ ID NO: 39; and an immunoglobulin light chain containing the amino acid sequence shown in SEQ ID NO: 41. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0114] In some aspects, this disclosure provides an isolated binding polypeptide comprising HCDR1 containing the amino acid sequence shown in SEQ ID NO: 43, HCDR2 containing the amino acid sequence shown in SEQ ID NO: 44, HCDR3 containing the amino acid sequence shown in SEQ ID NO: 45, LCDR1 containing the amino acid sequence shown in SEQ ID NO: 46, LCDR2 containing the amino acid sequence shown in SEQ ID NO: 47, and LCDR3 containing the amino acid sequence shown in SEQ ID NO: 48. In some embodiments, the isolated binding polypeptide is an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1). In some embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 49. In some embodiments, the antibody or its antigen-binding fragment comprises a light chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 51. In some embodiments, the antibody or its antigen-binding fragment comprises an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 55. In some embodiments, the antibody or its antigen-binding fragment comprises an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 57.

[0115] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 49; and a light chain variable region having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 51. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0116] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 49; and a light chain variable region containing the amino acid sequence shown in SEQ ID NO: 51. In some cases, the antibody or the antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1).

[0117] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 55; and an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 57. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0118] In some aspects, this disclosure provides an antibody or an antigen-binding fragment thereof comprising an immunoglobulin heavy chain containing the amino acid sequence shown in SEQ ID NO: 55; and an immunoglobulin light chain containing the amino acid sequence shown in SEQ ID NO: 57. In some cases, the antibody or its antigen-binding fragment specifically binds to canine programmed death protein 1 (PD-1).

[0119] Those skilled in the art will recognize permissible variations in the complementarity-determining region (CDR) sequence. For example, in some embodiments, the isolated binding polypeptide includes a complementarity-determining region (HCDR or LCDR) containing an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 99% sequence identity with any of the amino acid sequences shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 27, 28, 29, 30, 31, 32, 43, 44, 45, 46, 47, or 48. In some embodiments, the isolated binding polypeptide includes a complementarity-determining region (HCDR or LCDR) containing an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any of the amino acid sequences shown in SEQ ID NO: 1, 2, 3, 4, 5, or 6. In some embodiments, the isolated binding polypeptide includes a complementarity-determining region (HCDR or LCDR) containing an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any of the amino acid sequences shown in SEQ ID NO: 27, 28, 29, 30, 31, or 32. In some embodiments, the isolated binding peptide comprises a complementarity-determining region (HCDR or LCDR) containing an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any of the amino acid sequences shown in SEQ ID NO: 43, 44, 45, 46, 47, or 48. In some embodiments, the isolated binding peptide is an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1).

[0120] In some embodiments, the isolated binding peptide binds to programmed death protein 1 (PD-1), such as canine PD-1. In some embodiments, the binding peptide comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the antibody or an antigen-binding fragment thereof is an IgG, IgM, IgE, IgA, or IgD molecule. In some embodiments, the antibody or an antigen-binding fragment thereof is derived from an IgG, IgM, IgE, IgA, or IgD molecule. In some embodiments, the antigen-binding fragment is selected from full-length antibodies, Fab, single-chain variable fragments (scFv), single-domain antibodies, sc(Fv)2, dsFv, Fab, Fab', (Fab')2, and biantibodies. In a further embodiment, the antibody is a full-length antibody. In yet another embodiment, the antibody or antigen-binding fragment is a canine or canine-derived antibody or an antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment is a canine antibody or an antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment is a canine antibody. In some embodiments, the antibody or antigen-binding fragment is a canine IgG4 antibody. In some embodiments, the antibody or antigen-binding fragment is an scFv. In some embodiments, the antibody or antigen-binding fragment is a canine or canine-derived scFv. In some embodiments, the antibody or antigen-binding fragment is a canine scFv. In some embodiments, the specific binding of the antibody or its antigen-binding fragment to cPD-1 disrupts the interaction between cPD-1 and its ligand (e.g., canine programmed death ligand 1). In some embodiments, the specific binding of the antibody or its antigen-binding fragment to cPD-1 inhibits the interaction between cPD-1 and its ligand (e.g., canine programmed death ligand 1). In some embodiments, the specific binding of the antibody or its antigen-binding fragment to cPD-1 inhibits signaling pathways activated by the interaction between cPD-1 and its ligand (e.g., canine programmed death ligand 1). In some embodiments, the specific binding of the antibody or its antigen-binding fragment to cPD-1 inhibits the cPD-1 signaling pathway.

[0121] In some embodiments, the binding polypeptide includes a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence of the heavy chain variable region shown in SEQ ID NO: 7, 9, 33, or 49. In some embodiments, the binding polypeptide includes a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 7, 9, 33, or 49. In some embodiments, the binding polypeptide comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 7, 9, 33, or 49.

[0122] In some embodiments, the binding polypeptide includes a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 11, 35, or 51. In some embodiments, the binding polypeptide includes a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 11, 35, or 51. In some embodiments, the binding polypeptide includes a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 11, 35, or 51.

[0123] Also provided is an isolated binding polypeptide comprising a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 7 or 9 and a light chain variable region containing the amino acid sequence shown in SEQ ID NO: 11.

[0124] Also provided is an isolated binding polypeptide comprising a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 33 and a light chain variable region containing the amino acid sequence shown in SEQ ID NO: 35.

[0125] Also provided is an isolated binding polypeptide comprising a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 49 and a light chain variable region containing the amino acid sequence shown in SEQ ID NO: 51.

[0126] In some embodiments, this disclosure includes an antibody that binds to the same epitope on canine PD-1 as any antibody of this disclosure (i.e., an antibody capable of cross-competing with any antibody of this disclosure for binding to canine PD-1). In a preferred embodiment, the reference antibody used for cross-competition studies may be one of the antibodies described herein (e.g., P3C6mut3.1, P3C6mut3.2, P4B1, or A6 in Table 1 and Example 1). For example, Biacore analysis, ELISA assays, or flow cytometry can be used to demonstrate cross-competition with the antibodies of this disclosure. The ability of a test antibody to inhibit, for example, the binding of P3C6mut3.1 or P3C6mut3.2 to cPD-1 demonstrates that the test antibody can compete with P3C6mut3.1 or P3C6mut3.2 for binding to cPD-1 and is therefore considered to bind to the same epitope of PD-1 as P3C6mut3.1 or P3C6mut3.2.

[0127] The antibodies disclosed herein can be prepared using antibodies having one or more or any fragments of the VH and / or VL sequences disclosed herein as starting materials to engineer modified antibodies that can possess altered properties compared to the starting antibody. Antibodies can be engineered by modifying one or more amino acids within one or two variable regions (i.e., VH and / or VL) (e.g., one or more CDR regions and / or one or more frame regions). Alternatively or concurrently, antibodies can be engineered by modifying residues within constant regions, for example, to alter the effector function of the antibody.

[0128] A single-chain variable fragment (scFv) that specifically binds to canine programmed death protein 1 (PD-1) is also provided. In some cases, the scFv contains an antigen-binding domain. In some cases, the specific binding of an antibody or its antigen-binding fragment to cPD-1 disrupts the interaction between cPD-1 and its ligand (e.g., canine programmed death ligand 1).

[0129] As used herein, the term "single-chain variable fragment" or "scFv" refers to a fusion protein of the variable regions of the heavy chain (VH) and light chain (VL) of an immunoglobulin (e.g., mouse, canine, or human) covalently linked to form a VH:VL heterodimer. The heavy chain (VH) and light chain (VL) are directly linked or linked via a peptide-encoded linker that connects the N-terminus of the VH to the C-terminus of the VL, or vice versa. In some embodiments, the antigen-binding domain (e.g., a PD-1 binding domain) comprises an scFv having an N-terminal to C-terminal conformation (i.e., VH-linker-VL). In some embodiments, the antigen-binding domain comprises an scFv having an N-terminal to C-terminal conformation (i.e., VL-linker-VH). Those skilled in the art will be able to select an appropriate conformation for use in this disclosure.

[0130] Linkers are typically enriched with glycine for flexibility and with serine or threonine for solubility. Linkers can connect heavy chain variable regions and light chain variable regions of extracellular antigen-binding domains. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6):1910-1917 (2008) and WO 2014 / 087010, the contents of which are incorporated herein by reference in their entirety. Various linker sequences are known in the art, including but not limited to glycine-serine (GS) linkers, such as (GS) n (GSGGS) n (SEQ ID NO: 65), (GGGS) n (SEQ ID NO: 66) and (GGGGS) n(SEQ ID NO: 67), where n represents an integer of at least 1. Exemplary adapter sequences may comprise amino acid sequences, including but not limited to GGSG (SEQ ID NO: 68), GGSGG (SEQ ID NO: 69), GGSG (SEQ ID NO: 70), GGSGG (SEQ ID NO: 71), GGGSG (SEQ ID NO: 72), GSSSG (SEQ ID NO: 73), GGGGS (SEQ ID NO: 74), GGGGSGGGGGGGSGGG (SEQ ID NO: 75), GGGSSRSSSSGGGGSGGGG (SEQ ID NO: 76), etc. Those skilled in the art will be able to select appropriate adapter sequences for use in this disclosure. In one embodiment, the scFv of this disclosure comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH and VL are linked by a linker sequence having the amino acid sequence GGGSSRSSSSGGGGSGGGG (SEQ ID NO: 76), which may be encoded by the nucleic acid sequence GGCGGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGGCGGTGGTGG (SEQ ID NO: 77), wherein the arginine residue, i.e., R, is present due to the nucleotide sequence including the restriction endonuclease Xba I. If desired, those skilled in the art will recognize restriction sites in the linker and sites flanking the scFv construct that can be used for heavy chain / light chain “exchange” experiments for antibody optimization.

[0131] Despite the removal of the constant region and the introduction of a linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be expressed from nucleic acids containing VH and VL coding sequences, as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Publications Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (see, for example, Zhao et al., Hybridoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 Aug 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomallelli et al., Thromb Haemost 2007 97(6):955-63; Fife et al., J Clin Invst 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40). Agonistic scFvs with stimulatory activity have been described (see, for example, Peter et al., J Bioi Chem 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChimBiophys Acta 2003 1638(3):257-66).

[0132] In some embodiments, the antigen-binding domain of the scFv comprises a heavy chain variable region containing three heavy chain complementarity-determining regions (HCDRs) and a light chain variable region containing three light chain complementarity-determining regions (LCDRs). HCDR1 contains an amino acid sequence (SEQ ID NO: 1, 27, or 43) and / or HCDR2 contains an amino acid sequence (SEQ ID NO: 2, 28, or 44) and / or HCDR3 contains an amino acid sequence (SEQ ID NO: 3, 29, or 45) and / or LCDR1 contains an amino acid sequence (SEQ ID NO: 4, 30, or 46) and / or LCDR2 contains an amino acid sequence (SEQ ID NO: 5, 31, or 47) and / or LCDR3 contains an amino acid sequence (SEQ ID NO: 6, 32, or 48). The heavy chain variable region and the light chain variable region are connected by a linker.

[0133] A single-chain variable fragment (scFv) is also provided, comprising a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 7, 9, 33 or 49; and a light chain variable region containing the amino acid sequence shown in SEQ ID NO: 11, 35 or 51. The heavy chain variable region and the light chain variable region are connected by a linker.

[0134] In another aspect, a single-stranded variable fragment (scFv) is provided, comprising the amino acid sequence shown in SEQ ID NO: 13, 15, 17, 37, or 53. In another aspect, a single-stranded variable fragment (scFv) is provided, consisting of the amino acid sequence shown in SEQ ID NO: 13, 15, 17, 37, or 53.

[0135] Those skilled in the art will recognize the permissible variations of the scFv sequence. For example, in some embodiments, the scFv comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any of the amino acid sequences shown in SEQ ID NO: 13, 15, 17, 37, or 53.

[0136] In another aspect, a full-length antibody is provided, comprising a heavy chain containing the amino acid sequence shown in SEQ ID NO: 19, 21, 23, 39, 55 or 70-75; and a light chain containing the amino acid sequence shown in SEQ ID NO: 25, 41 or 57. In yet another aspect, a full-length antibody is provided, comprising a heavy chain containing the amino acid sequence shown in SEQ ID NO: 19, 21, 23, 39, 55 or 70-75 and a light chain containing the amino acid sequence shown in SEQ ID NO: 25, 41 or 57.

[0137] Those skilled in the art will recognize permissible variations in the full-length antibody sequence. For example, in some embodiments, the antibody comprises a heavy chain having an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any of the amino acid sequences shown in SEQ ID NO: 19, 21, 23, 39, 55, or 70-75; and a light chain having an amino acid sequence ... The amino acid sequence shown in NO:25, 41 or 57 has an amino acid sequence identity of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%.

[0138] In some embodiments, the full-length heavy or light chain of the antibody or antigen-binding fragment thereof disclosed herein further comprises a leader sequence. In some embodiments, the leader sequence comprises the amino acid sequence shown in SEQ ID NO: 60. In some embodiments, the leader sequence is encoded by the nucleotide sequence shown in SEQ ID NO: 59.

[0139] In some embodiments, the full-length heavy chain of the antibody or its antigen-binding fragment of this disclosure further includes a linker and an HA or hemagglutinin tag at the carboxyl terminus of the polypeptide. In some embodiments, the relinker linker and HA tag comprise the amino acid sequence shown in SEQ ID NO: 62. In some embodiments, the relinker linker and HA tag are encoded by the nucleotide sequence shown in SEQ ID NO: 61.

[0140] In some embodiments, the scFv of this disclosure further comprises an IgG fragment and a 6xHIS or histidine-hemagglutinin tag at the carboxyl terminus of the polypeptide. In some embodiments, the scFv IgG fragment-6xHIS-hemagglutinin tag comprises the amino acid sequence shown in SEQ ID NO: 64. In some embodiments, the scFv IgG fragment-6xHIS-hemagglutinin tag is encoded by the nucleic acid sequence shown in SEQ ID NO: 63.

[0141] In some embodiments, the antibody or antigen-binding fragments disclosed herein include any of those disclosed in International Publication No. WO2023108138 A1, which is incorporated herein by reference in its entirety.

[0142] On the other hand, this article provides an antibody that contains canine IgG subclass IgG. A IgG B IgG C or IgG D The Fc region, and canine IgG subclass IgG A IgG B IgG C or IgG D The antibody contains a hinge region, wherein the Fc region and the hinge region belong to different canine IgG subclasses. In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody includes a CH1 region, wherein the CH1 region and the hinge region belong to the same canine IgG subclass.

[0143] In some implementations, the Fc region belongs to the canine IgG subclass IgG. A In some implementations, the Fc region belongs to the canine IgG subclass IgG. B In some implementations, the Fc region belongs to the canine IgG subclass IgG. C In some implementations, the Fc region belongs to the canine IgG subclass IgG. D In some implementations, the Fc region corresponds to canine IgG subclass IgG. A IgG B IgG C or IgG D The amino acid sequence of the natural Fc region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100% identity. Canine IgG subclass IgG is known to those skilled in the art. A IgG B IgG C or IgG D The natural Fc region.

[0144] In some implementations, the hinge region belongs to the canine IgG subclass IgG. A In some implementations, the hinge region belongs to the canine IgG subclass IgG. B In some implementations, the hinge region belongs to the canine IgG subclass IgG. C In some implementations, the hinge region belongs to the canine IgG subclass IgG. D In some implementations, the hinge region is associated with canine IgG subclass IgG. A IgG B IgG C or IgG D The amino acid sequence of the natural hinge region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100% identity. Canine IgG subclass IgG is known to those skilled in the art. A IgG B IgG C or IgG D The natural hinge area.

[0145] In some embodiments, the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having at least 85% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having at least 95% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having at least 96% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having at least 97% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having at least 98% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having at least 99% identity with the amino acid sequence of SEQ ID NO: 66. In some embodiments, the antibody comprises an amino acid sequence having 100% identity with the amino acid sequence of SEQ ID NO: 66.

[0146] In some embodiments, the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having at least 85% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having at least 95% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having at least 96% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having at least 97% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having at least 98% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having at least 99% identity with the amino acid sequence of SEQ ID NO: 67. In some embodiments, the antibody comprises an amino acid sequence having 100% identity with the amino acid sequence of SEQ ID NO: 67.

[0147] In some embodiments, the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having at least 85% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having at least 95% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having at least 96% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having at least 97% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having at least 98% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having at least 99% identity with the amino acid sequence of SEQ ID NO: 68. In some embodiments, the antibody comprises an amino acid sequence having 100% identity with the amino acid sequence of SEQ ID NO: 68.

[0148] In some embodiments, the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having at least 85% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having at least 95% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having at least 96% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having at least 97% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having at least 98% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having at least 99% identity with the amino acid sequence of SEQ ID NO: 69. In some embodiments, the antibody comprises an amino acid sequence having 100% identity with the amino acid sequence of SEQ ID NO: 69.

[0149] In some embodiments, the antibody is a canine antibody or a canine-derived antibody that binds to a canine antigen. In some embodiments, the antibody binds to canine programmed death protein 1 (cPD-1). In some embodiments, the antibody binding to cPD-1 comprises any of the CDR, VH, or VL disclosed herein. In some embodiments, the antibody comprises: an immunoglobulin heavy chain including a heavy chain complementarity-determining region 1 (HCDR1) containing the amino acid sequence shown in SEQ ID NO: 1, 27, or 43; HCDR2 containing the amino acid sequence shown in SEQ ID NO: 2, 28, or 44; and HCDR3 containing the amino acid sequence shown in SEQ ID NO: 3, 29, or 45; an immunoglobulin light chain including a light chain complementarity-determining region 1 (LCDR1) containing the amino acid sequence shown in SEQ ID NO: 4, 30, or 46; LCDR2 containing the amino acid sequence shown in SEQ ID NO: 5, 31, or 47; and LCDR3 containing the amino acid sequence shown in SEQ ID NO: 6, 32, or 48.

[0150] In some embodiments, the antibody comprises an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 19, 21, 23, 39, 55, or 70-75. In some embodiments, the antibody comprises an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 25, 41, or 57.

[0151] In some embodiments, the antibody comprises an immunoglobulin heavy chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 70; and an immunoglobulin light chain having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 25.

[0152] In some embodiments, the antibody contains an amino acid mutation AA at the C-terminus of the hinge region, relative to the natural hinge region. In some embodiments, the antibody lacks the ability to mediate antibody-dependent cell-mediated cytotoxicity (ADCC) or has a reduced ability to mediate ADCC relative to a reference antibody that has a substantially identical sequence except for the absence of the AA mutation at the C-terminus of the hinge region.

[0153] In some embodiments, the antibodies described herein do not induce antidrug antibodies when administered to a subject (e.g., a canine). In some embodiments, no accelerated elimination of the antidrug antibody was observed after administration of the antibodies described herein to a subject.

[0154] Table 1: Sequences used in this disclosure Nucleic acids and expression vectors This disclosure provides an isolated nucleic acid encoding a polypeptide. The nucleic acid of this disclosure may contain a polynucleotide sequence encoding any of the binding polypeptides, scFvs, antibodies, or any fragments thereof disclosed herein.

[0155] One aspect of this disclosure includes isolated nucleic acids or nucleic acids encoding any of the antibodies disclosed herein. Those skilled in the art will recognize permissible variations in nucleic acid sequences.

[0156] In some embodiments, the nucleic acid of this disclosure comprises a first polynucleotide sequence and a second polynucleotide sequence. The first and second polynucleotide sequences can be linked by a linker. For example, in some embodiments, the heavy chain variable region and the light chain variable region of the scFv are linked by a linker. In some embodiments, the nucleic acid comprises a first polynucleotide sequence, a linker, and a second polynucleotide sequence from 5' to 3'. In some embodiments, the nucleic acid comprises a second polynucleotide sequence, a linker, and a first polynucleotide sequence from 5' to 3'.

[0157] Another aspect of this disclosure provides a vector comprising any of the isolated nucleic acids disclosed herein. In some embodiments, the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, and retroviral vectors. In some embodiments, the vector is an expression vector.

[0158] A host cell is also provided, comprising any of the vectors or nucleic acids disclosed herein. The host cell may be of eukaryotic, prokaryotic, mammalian, or bacterial origin. Non-limiting examples that may be used to express the cells disclosed herein include human embryonic kidney (HEK) cell lines (e.g., HEK293), Chinese hamster ovary (CHO) cell lines, young hamster kidney (BHK) cell lines, COS cell lines, Madin Darby canine kidney (MDCK) cell lines, and HeLa cell lines. In some cases, the host cell is a Chinese hamster ovary cell.

[0159] This document also provides a method for producing antibodies (e.g., antibodies that bind to canine PD-1), wherein the method includes culturing host cells. In some embodiments, the method further includes incubating the host cells in a cell culture medium under conditions sufficient to allow expression and secretion of the antibodies described herein.

[0160] In some embodiments, the nucleic acids of this disclosure can be operatively linked to transcriptional control elements, such as promoters and enhancers. Suitable promoter and enhancer elements are known to those skilled in the art.

[0161] In some implementations, the nucleic acid is operatively linked to a promoter. In some implementations, the promoter is a phosphoglycerate kinase-1 (PGK) promoter.

[0162] For expression in bacterial cells, suitable promoters include, but are not limited to, lacI, lacZ, T3, T7, gpt, λP, and trc. For expression in eukaryotic cells, suitable promoters include, but are not limited to, light chain and / or heavy chain immunoglobulin gene promoters and enhancer elements; cytomegalovirus immediate early promoters; herpes simplex virus thymidine kinase promoters; SV40 early and late promoters; promoters present in long terminal repeat sequences of retroviruses; mouse metallothionein-I promoters; and various tissue-specific promoters known in the art. Suitable reversible promoters are known in the art, including reversibly inducible promoters. Such reversible promoters can be isolated and derived from many organisms, such as eukaryotes and prokaryotes. It is well known in the art that reversible promoters derived from a first organism can be modified for use in a second organism, such as a first prokaryote and a second eukaryote, or a first eukaryote and a second prokaryote, etc. Such reversible promoters, and systems based on such reversible promoters but also including other control proteins, include, but are not limited to, alcohol-regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoters, promoters responding to alcohol transactivator protein (A1cR), etc.), tetracycline-regulated promoters (e.g., promoter systems including Tet activator protein, TetON, TetOFF, etc.), steroid-regulated promoters (e.g., rat glucocorticoid receptor promoter system, human estrogen receptor promoter system, retinoid promoter system, thyroid promoter system, ecdysone promoter system, mifepristone promoter system, etc.), metal-regulated promoters (e.g., metallothionein promoter system, etc.), pathogenesis-related regulatory promoters (e.g., salicylic acid-regulated promoters, ethylene-regulated promoters, benzothiadiazole-regulated promoters, etc.), temperature-regulated promoters (e.g., heat shock-inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, etc.), light-regulated promoters, synthesis-inducible promoters, etc.).

[0163] For expression in yeast cells, suitable promoters are constitutive promoters, such as the ADH1 promoter, PGK1 promoter, ENO promoter, PYK1 promoter, etc.; or tunable promoters, such as the GAL1 promoter, GAL10 promoter, ADH2 promoter, PHOS promoter, CUP1 promoter, GALT promoter, MET25 promoter, MET3 promoter, CYC1 promoter, HIS3 promoter, ADH1 promoter, PGK promoter, GAPDH promoter, ADC1 promoter, TRP1 promoter, URA3 promoter, LEU2 promoter, ENO promoter, TP1 promoter, and AOX1 (e.g., for Pichia pastoris). The selection of suitable vectors and promoters is entirely within the scope of ordinary skill in the art. Suitable promoters for prokaryotic host cells include, but are not limited to, the phage T7 RNA polymerase promoter; the trp promoter; the lac operon promoter; heterozygous promoters, such as the lac / tac heterozygous promoter, the tac / trc heterozygous promoter, the trp / lac promoter, the T7 / lac promoter; the trc promoter; the tac promoter, etc.; the araBAD promoter; and in vivo regulatory promoters, such as the ssaG promoter or related promoters (see, for example, U.S. Patent Publication No. 20040131637), the pagC promoter (Pulkkinen and Miller, J. Bacteriol. (1991) 173(1): 86-93; Alpuche-Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89(21): 10079-83), and the nirB promoter (Harborne et al. Mol. Micro. (1992)). 6:2805-2813, etc. (see, for example, Dunstan et al., Infect. Immun. (1999) 67:5133-5141; McKelvie et al., Vaccine (2004) 22:3243-3255; and Chatfield et al., Biotechnol. (1992) 10:888-892); sigma70 promoters, such as common sigma70 promoters (see, for example, GenBank accession numbers AX798980, AX798961 and AX798183); stationary promoters, such as dps promoters, spv promoters, etc.; promoters derived from the pathogenic island SPI-2 (see, for example, WO96 / 17951); actA promoters (see, for example, Shetron-Rama et al., Infect. Immun. (2002)). 70:1087-1096); rpsM promoter (see, for example, Valdivia and Falkow Mol).Microbiol. (1996). 22:367); tet promoter (see, for example, Hillen, W. and Wissmann, A. (1989) in Saenger, W. and Heinemann, U. (ed.), Topics in Molecular and Structural Biology, Protein-Nucleic Acid Interaction. Macmillan, London, UK, Vol. 10, pp. 143-162); SP6 promoter (see, for example, Melton et al., Nucl. Acids Res. (1984) 12:7035); etc. Suitable strong promoters for prokaryotes such as Escherichia coli include, but are not limited to, Trc, Tac, T5, T7 and Pλ. Non-limiting examples of operons used for bacterial host cells include the lactose promoter operon (the LacI repressor changes conformation upon contact with lactose, thus preventing the Lad repressor from binding to the operon), the tryptophan promoter operon (the TrpR repressor has an operon-binding conformation when complexed with tryptophan; in the absence of tryptophan, the TrpR repressor has an operon-non-binding conformation), and the tac promoter operon (see, for example, deBoer et al., Proc. Natl. Acad. Sci. USA (1983) 80:21-25).

[0164] Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strongly constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operatively linked to it. Other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40 (SV40) early promoter, the mouse mammary tumor virus (MMTV) or human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, the MoMuLV promoter, the avian leukosis virus promoter, the Epstein-Barr virus immediate early promoter, the Rous sarcoma virus promoter, the EF-1α promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. Furthermore, this disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also considered part of this disclosure. The use of inducible promoters provides a molecular switch capable of turning on the expression of an operatively linked polynucleotide sequence when such expression is needed, or turning off expression when expression is not needed. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0165] In some implementations, a locus or construct or transgene containing a suitable promoter is irreversibly converted via inducible systems. Suitable systems for inducing irreversible switches are well known in the art; for example, irreversible switches can be induced using Cre-lox-mediated recombination (see, for example, Fuhrmann-Benzakein, et al., Proc. Natl. Acad. Sci. USA (2000) 28:e99, the disclosure of which is incorporated herein by reference). Any suitable combination of recombinases, endonucleases, ligases, recombination sites, etc., known in the art can be used to generate irreversibly convertible promoters. Methods, mechanisms, and requirements for site-specific recombination described elsewhere herein can be used to generate irreversibly convertible promoters and are well known in the art; see, for example, Grindley et al., Annual Review of Biochemistry (2006) 567-605; and Tropp, Molecular Biology (2012) (Jones & Bartlett Publishers, Sudbury, Mass.), the disclosure of which is incorporated herein by reference.

[0166] The nucleic acids disclosed herein can be contained within expression vectors and / or cloning vectors. Expression vectors may include selectable markers, origins of replication, and other features that provide for vector replication and / or maintenance. Suitable expression vectors include, for example, plasmids, viral vectors, etc. A large number of suitable vectors and promoters are known to those skilled in the art; many are commercially available for generating the subject recombinant constructs. The following vectors are provided as examples and should not be construed as limiting in any way: Bacteria: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden). Eukaryotic cells: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

[0167] Expression vectors typically have convenient restriction sites located near the promoter sequence to provide insertion of nucleic acid sequences encoding heterologous proteins. Alternative biomarkers that function in the expression host may also be present.Suitable expression vectors include, but are not limited to: viral vectors (e.g., vaccinia virus-based viral vectors; poliovirus; adenovirus (see, for example, Li et al., Invest. Opthalmol. Vis. Sci. (1994) 35: 2543-2549; Borras et al., GeneTher. (1999) 6: 515-524; Li and Davidson, Proc. Natl. Acad. Sci. USA (1995) 92:7700-7704; Sakamoto et al., H. Gene Ther. (1999) 5: 1088-1097; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655); adeno-associated virus (see, for example, Ali et al., Hum. Gene Ther. (1998) 9: 81-86; Flannery et al., Proc. Natl. Acad. Sci. USA (1997) 94: 6916-6921; Bennett et al., Invest. Opthalmol. Vis. Sci. (1997) 38: 2857-2863; Jomary et al., Gene Ther. (1997) 4: 683-690; Rolling et al., Hum. Gene Ther. (1999) 10: 641-648; Ali et al., Hum. Mol. Genet. (1996) 5: 591-594; Srivastava in WO93 / 09239, Samulski et al., J. Vir. (1989) 63: 3822-3828; Mendelson et al., Virol. (1988) 166: 154-165; and Flotte et al., Proc. Natl. Acad. Sci. USA (1993) 90:10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, for example, Miyoshi et al., Proc. Natl. Acad. Sci. USA (1997) 94: 10319-23; Takahashi et al., J. Virol. (1999) 73:7812-7816); retroviral vectors (e.g., murine leukosis virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); etc.

[0168] Suitable additional expression vectors include, but are not limited to, lentiviral vectors, gamma retroviral vectors, foamy virus vectors, adeno-associated virus vectors, adenovirus vectors, poxvirus vectors, herpesvirus vectors, engineered hybrid viral vectors, transposon-mediated vectors, etc. Viral vector technology is well known in the art and described in, for example, Sambrook et al., 2012, *Molecular Cloning: A Laboratory Manual*, Volumes 1–4, Cold Spring Harbor Press, NY, and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses.

[0169] Typically, a suitable vector contains a replication origin that functions in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more optional markers (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193).

[0170] In some embodiments, an expression vector (e.g., a lentiviral vector) can be used to introduce nucleic acids into host cells. Therefore, the expression vectors (e.g., lentiviral vectors) of this disclosure may contain nucleic acids encoding polypeptides. In some embodiments, the expression vector (e.g., a lentiviral vector) will contain additional elements that will contribute to the functional expression of the polypeptide encoded therein. In some embodiments, the expression vector containing nucleic acids encoding polypeptides further contains a mammalian promoter. In one embodiment, the vector further contains an elongation factor-1-α promoter (EF-1α promoter). Using an EF-1α promoter can improve the expression efficiency of downstream transgenes. Physiological promoters (e.g., EF-1α promoters) are unlikely to induce integration-mediated genotoxicity and can eliminate the ability of retroviral vectors to transform stem cells. Other physiological promoters suitable for vectors (e.g., lentiviral vectors) are known to those skilled in the art and can be incorporated into the vectors of this disclosure. In some embodiments, the vector (e.g., a lentiviral vector) further contains a non-essential cis-acting sequence that can improve titer and gene expression. A non-limiting example of a non-essential cis-acting sequence is a central polypurine region and a central termination sequence (cPPT / CTS), which are important for efficient reverse transcription and nuclear input. Other non-essential cis-acting sequences are known to those skilled in the art and can be incorporated into the vectors of this disclosure (e.g., lentiviral vectors). In some embodiments, the vector further comprises a posttranscriptional regulatory element. Posttranscriptional regulatory elements can improve RNA translation, improve transgene expression, and stabilize RNA transcripts. An example of a posttranscriptional regulatory element is the marmot hepatitis virus posttranscriptional regulatory element (WPRE). Therefore, in some embodiments, the vectors of this disclosure also comprise a WPRE sequence. Various posttranscriptional regulatory elements are known to those skilled in the art and can be incorporated into the vectors of this disclosure (e.g., lentiviral vectors). The vectors of this disclosure may further comprise additional elements such as rev response elements (RREs) for RNA transport, packaging sequences, and 5' and 3' long terminal repeats (LTRs). The term "long terminal repeat" or "LTR" refers to a base-pair domain located at the end of retroviral DNA that contains U3, R, and U5 regions. LTRs typically provide the functions required for retroviral gene expression (e.g., promotion, initiation, and polyadenylation of gene transcripts) and viral replication. In one embodiment, the vector of this disclosure (e.g., a lentiviral vector) includes a 3'U3-deleted LTR. Therefore, the vector of this disclosure (e.g., a lentiviral vector) can contain any combination of the elements described herein to improve the efficiency of transgenic functional expression. For example, in addition to the nucleic acid encoding CAR, the vector of this disclosure (e.g., a lentiviral vector) may also contain a WPRE sequence, a cPPT sequence, an RRE sequence, a 5'LTR, and a 3'U3-deleted LTR'.

[0171] The vector disclosed herein can be a self-inactivating vector. As used herein, the term "self-inactivating vector" refers to a vector in which the 3'LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution). Self-inactivating vectors can prevent viral transcription beyond the first round of viral replication. Therefore, self-inactivating vectors can infect only once and then integrate into the host genome (e.g., a mammalian genome) and cannot be further transmitted. Thus, self-inactivating vectors can significantly reduce the risk of generating replicating viruses.

[0172] In some embodiments, the nucleic acid of this disclosure may be RNA, such as in vitro synthesized RNA. Methods for synthesizing RNA in vitro are known to those skilled in the art; any known method can be used to synthesize RNA comprising a sequence encoding a polypeptide of this disclosure. Methods for introducing RNA into host cells are known in the art. See, for example, Zhao et al., Cancer Res. (2010) 15: 9053. Introducing RNA comprising a nucleotide sequence encoding a polypeptide of this disclosure into host cells can be performed in vitro, ex vivo, or in vivo. For example, host cells (e.g., NK cells, cytotoxic T lymphocytes, etc.) can be electroporated in vitro or ex vivo using RNA comprising a nucleotide sequence encoding a polypeptide of this disclosure.

[0173] To assess the expression of the peptide or its fraction, the expression vector to be introduced into cells may also contain an optional marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from a cell population seeking transfection or infection via a viral vector. In some embodiments, the optional marker may be carried on a separate DNA fragment and used in a co-transfection procedure. Both the optional marker and the reporter gene may be side-linked with appropriate regulatory sequences to enable their expression in host cells. Available optional markers include, but are not limited to, antibiotic resistance genes.

[0174] Reporter genes are used to identify potentially transfected cells and assess the function of regulatory sequences. Typically, a reporter gene is a gene that is absent or not expressed in the recipient organism or tissue, encoding a polypeptide whose expression is indicated by easily detectable properties, such as enzymatic activity. The expression of the reporter gene is assessed at an appropriate time after DNA is introduced into the recipient cells. Suitable reporter genes may include, but are not limited to, genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase, or green fluorescent protein (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82).

[0175] In some embodiments, the nucleic acids of this disclosure are provided for the production of polypeptides as described herein, for example, in host cells. In some embodiments, the nucleic acids of this disclosure provide for the amplification of nucleic acids encoding polypeptides.

[0176] One advantage of the antibodies disclosed in this paper is their increased yield during manufacturing. This increased yield is at least due to the reduced production of half-antibodies and HC dimers generated during the manufacturing process.

[0177] Treatment In one aspect, this disclosure provides a method of treating a disease or condition in a subject of need, comprising administering to the subject an antibody, a binding peptide and scFv, or a bispecific molecule, an immunoconjugate, or a composition comprising any of these, as described herein. The disease or condition includes cancer, sepsis or septic shock, or a chronic infection (e.g., a viral infection). The composition may include a pharmaceutical composition and further includes a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition may be administered to the subject (e.g., a dog or canine).

[0178] In some embodiments, the antibodies, binding peptides and scFv, or bispecific molecules, immunoconjugates, or compositions comprising any of these described herein are used as pharmaceuticals.

[0179] In some embodiments, the antibodies, binding peptides and scFv, or bispecific molecules, immunoconjugates, or compositions comprising any of these described herein are used as medicaments for the treatment of cancer, sepsis or septic shock, or chronic infections.

[0180] In some embodiments, this document describes the use of the antibodies, binding peptides and scFv, or bispecific molecules, immunoconjugates, or compositions comprising any of these for the manufacture of a medicament.

[0181] In some embodiments, this document describes the use of the antibodies, binding peptides and scFv, or bispecific molecules, immunoconjugates, or compositions comprising any of these for the manufacture of a medicament for the treatment of cancer, sepsis or septic shock, or chronic infections (e.g., viral infections).

[0182] Treatment refers to methods sought to improve or enhance an ongoing medical condition. In the context of cancer, treatment includes, but is not limited to, reducing tumor size, slowing tumor growth, increasing progression-free survival, or overall life expectancy. In some embodiments, treatment will affect the remission of the cancer being treated. In some embodiments, treatment includes administration as a preventative or maintenance measure designed to prevent recurrence or progression of previously treated cancer or tumors. Those skilled in the art will understand that not all individuals will respond equally to the administered treatment or will not respond at all; nevertheless, these individuals are considered to be treated.

[0183] In some embodiments, cancer is associated with the programmed death protein 1 (PD-1) signaling pathway. In some embodiments, PD-1 is expressed on the subject's immune cells. In some embodiments, the immune cells are T lymphocytes. In some embodiments, the immune cells are tumor-infiltrating lymphocytes. In some embodiments, ligands of PD-1, such as PD-L1 or PD-L2, are expressed on the subject's cancer cells. In some embodiments, canine programmed death ligand 1 is overexpressed on the subject's cancer cells.

[0184] In some embodiments, the binding peptide specifically binds to programmed death protein 1 (PD-1). In some embodiments, the binding peptide comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is selected from Fab, single-chain variable fragments (scFv), single-domain antibodies, sc(Fv)2, dsFv, Fab, Fab', (Fab')2, and biantibodies. In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody or antigen-binding fragment is a canine antibody or an antigen-binding fragment thereof.

[0185] In some embodiments, the method further includes administering one or more additional therapeutic agents or interventions. Such additional treatments or interventions are not limited and may include any therapeutic agent or small molecule drug that helps treat the subject in need. In some embodiments, as a combination therapy, the additional therapeutic agent or intervention is administered together with an antibody or its antigen-binding fragment or SCFV described herein, or a bispecific molecule or immunoconjugate containing these. Non-limiting examples of additional treatments or interventions include chemotherapy (e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and / or vincristine), radiation therapy, immunotherapy, and other targeted therapies.

[0186] In some embodiments, the cancer or tumor is a solid carcinoma or solid tumor. In some embodiments, the cancer or tumor is a hematologic malignancy or blood cancer. In some embodiments, the cancer or tumor includes tumors of the breast, heart, lungs, small intestine, colon, spleen, kidneys, bladder, head, neck, ovaries, prostate, brain, pancreas, skin, bone, bone marrow, blood, thymus, uterus, testes, and liver. In some embodiments, tumors treatable with the antibodies disclosed herein include adenoma, adenocarcinoma, angiosarcoma, astrocytoma, epithelial carcinoma, germ cell tumor, glioblastoma, glioma, hemangioendothelioma, hemangiosarcoma, hematoma, hepatoblastoma, leukemia, lymphoma, medulloblastoma, melanoma, neuroblastoma, osteosarcoma, retinoblastoma, rhabdomyosarcoma, sarcoma, and / or teratoma. In some implementations, the tumor / cancer is selected from acral lentiginous melanoma, actinic keratosis, adenocarcinoma, adenoid cysticcarcinoma, adenomas, adenosarcoma, adenosquamouscarcinoma, astrocytic tumors, Bartholin glandcarcinoma, basal cell carcinoma, bronchial glandcarcinoma, and capillary carcinoid.Carcinoid, carcinoma, carcinosarcoma, cholangiocarcinoma, chondrosarcoma, cystadenoma, endodermal sinus tumor, endometrial hyperplasia, endometrial stromal sarcoma, endometrioid adenocarcinoma, ependymal sarcoma, Swing's sarcoma, focal nodular hyperplasia, gastronoma, germline tumors, glioblastoma, glucagonoma, hemangioblastoma, hemangioendothelioma, hemangioma, hepatic adenoma Adenoma, hepatic adenomatosis, hepatocellular carcinoma, insulinoma, intraepithelial neoplasia, intraepithelial squamous cell neoplasia, invasive squamous cell carcinoma, large cell carcinoma, liposarcoma, lung carcinoma, lymphoblastic leukemia, lymphocytic leukemia, leiomyosarcoma, melanoma, malignant melanoma, malignant mesothelial tumor, nerve sheath.Tumors, including medulloblastoma, medullary epithelioma, mesothelioma, mucoepidermoid carcinoma, myeloid leukemia, neuroblastoma, neuroepiderthelial adenocarcinoma, nodular melanoma, osteosarcoma, ovarian carcinoma, papillary serous adenocarcinoma, pituitary tumors, plasmacytoma, pseudosarcoma, prostate carcinoma, pulmonary blastoma, and renal cell carcinoma. Retinoblastoma, rhabdomyosarcoma, sarcoma, serous carcinoma, squamous cell carcinoma, small cell carcinoma, soft tissue carcinoma, somatostatin-secreting tumor, squamous carcinoma, squamous cell carcinoma, undifferentiated carcinoma, uveal melanoma, verrucous carcinoma, vaginal / vulva carcinoma, VIPpoma, and Wilm's tumor. In some embodiments, the tumors / cancers treated with one or more antibodies of this disclosure include brain cancer, head and neck cancer, colorectal carcinoma, acute myeloid leukemia, and pre-B-cell acute lymphoblastic leukemia.Acute lymphoblastic leukemia, bladder cancer, astrocytoma (preferably grade II, III, or IV astrocytoma), glioblastoma, glioblastoma multiforme, small cell cancer and non-small cell cancer (preferably non-small cell lung cancer), lung adenocarcinoma, metastatic melanoma, androgen-independent metastatic prostate cancer, androgen-dependent metastatic prostate cancer, prostate adenocarcinoma, and breast cancer (preferably breast ductal cancer and / or breast carcinoma). In some embodiments, the cancer treated with the antibody of this disclosure includes glioblastoma. In some embodiments, the cancer treated with one or more antibodies of this disclosure includes pancreatic cancer. In some embodiments, the cancer treated with one or more antibodies of this disclosure includes ovarian cancer. In some embodiments, the cancer treated with one or more antibodies of this disclosure includes lung cancer. In some embodiments, the cancer treated with one or more antibodies of this disclosure includes prostate cancer. In some embodiments, the cancer treated with one or more antibodies of this disclosure includes colon cancer. In some embodiments, the cancer treated includes glioblastoma, pancreatic cancer, ovarian cancer, colon cancer, prostate cancer, or lung cancer. In some embodiments, the cancer is refractory to other treatments. In some embodiments, the treated cancer is recurrent.

[0187] In some implementations, cancers include melanoma (e.g., metastatic malignant melanoma), prostate cancer (e.g., hormone-refractory prostate adenocarcinoma), head and neck cancer (e.g., squamous cell carcinoma of the head and neck), cervical cancer, thyroid cancer, glioblastoma, glioma, leukemia, lymphoma (e.g., B-cell lymphoma), adrenal gland cancer, AIDS-associated cancer, alveolar soft part sarcoma, astrocytic tumor, bone cancer, brain and spinal cord cancer, and metastatic brain tumors. Tumor, carotid body tumor, chondrosarcoma, chordoma, chromophobe renal cell carcinoma, clear cell carcinoma, cutaneous benign fibrous histiocytoma, desmoplastic small round cell tumor, ependymoma, Ewing's tumor, extraosseous myxoid chondrosarcoma, fibrous dysplasia of the bone, gallbladder or bile duct cancer.Cancer, gestational trophoblastic disease, germ cell tumor, hematological malignancy, hepatocellular carcinoma, islet cell tumor, Kaposi's sarcoma, kidney cancer, lipoma / benign lipomatous tumor, liposarcoma / malignant lipomatous tumor, medulloblastoma, meningioma, Merkel cell carcinoma, multiple endocrine neoplasia, multiple myeloma, myelodysplasia syndrome, neuroblastoma, neuroendocrine tumor, papillary thyroid carcinoma. Carcinoma, parathyroid tumor, pediatric cancer, peripheral nerve sheath tumor, pheochromocytoma, pituitary tumor, prostate cancer, posterior uveal melanoma, rare hematologic disorder, renal metastatic cancer, rhabdoid tumor, rhabdomysarcoma, sarcoma, soft-tissue sarcoma, squamous cell carcinoma, stomach cancer, synovial sarcoma, testicular cancer.Cancer, thymic carcinoma, thymoma, thyroid metastatic cancer, uterine cancer, or any combination thereof.

[0188] In some cases, cancers include cervical cancer, lung cancers, liver cancers, ovarian cancers, skin cancer including melanoma and squamous cell carcinoma, colon cancer, bladder cancer, breast cancer, kidney cancer, esophageal cancer, stomach cancer, pancreatic cancers, head cancer, and neck cancer.

[0189] The compositions disclosed herein can be administered at doses, routes, and times determined in appropriate preclinical and clinical trials and studies. The compositions can be administered multiple times at doses within these ranges. As determined by those skilled in the art, the administration of the compositions can be combined with other methods for treating a desired disease or condition. In some embodiments, the antibody can be administered to the recipient via any route suitable for administering the antibody-containing pharmaceutical composition, such as, for example, subcutaneous, intraperitoneal, intravenous, intramuscular, intratumoral, or intracerebral administration. In some embodiments, the antibody is administered intravenously. In some embodiments, the antibody is administered subcutaneously. In some embodiments, the antibody is administered intratumorally. In some embodiments, the antibody is administered at a suitable dosing schedule, such as weekly, twice weekly, monthly, twice monthly, once every two weeks, once every three weeks, or once monthly. In some embodiments, the antibody is administered once every three weeks. The antibody can be administered at any therapeutically effective amount. In some embodiments, the therapeutically acceptable amount is between about 0.1 mg / kg and about 50 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 1 mg / kg and about 40 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 1 mg / kg and about 20 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 1 mg / kg and about 10 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 5 mg / kg and about 30 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 5 mg / kg and about 20 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 1 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 2 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 3 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 4 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 5 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 6 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 7 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 8 mg / kg. In some embodiments, the therapeutically acceptable amount is between about 9 mg / kg. In some implementations, the therapeutically acceptable amount is between about 10 mg / kg. A therapeutically effective amount includes an amount sufficient to improve one or more symptoms associated with the disease or condition being treated.

[0190] For the purposes of this disclosure, prophylactic, palliative, symptomatic, and / or therapeutic treatments may represent different aspects of this disclosure. The anti-cPD-1 antibodies or their antigen-binding fragments or scFvs disclosed herein can be administered parenterally, such as intravenously, intramuscularly, or subcutaneously. Alternatively, the antibodies of this disclosure can be administered via non-parenteral routes, such as orally or topically. The antibodies of this invention can be administered prophylactically. The antibodies of this disclosure can be administered therapeutically (as needed).

[0191] Pharmaceutical compositions, kits, and methods for preparing the compositions Pharmaceutical compositions comprising any of the binding peptides, scFvs, antibodies, or antigen-binding fragments disclosed herein are also provided. The compositions include pharmaceutical compositions and formulations for administration, such as for treating diseases or conditions. Treatment methods for administering the pharmaceutical compositions to a subject (e.g., a canine animal) are also provided.

[0192] Pharmaceutical compositions and formulations typically include one or more optional pharmaceutically acceptable carriers or excipients. In some embodiments, the composition includes at least one additional therapeutic agent.

[0193] The term "pharmaceutical formulation" refers to a formulation whose form allows for the bioactivity of the active ingredient contained therein and does not contain any additional components that would have unacceptable toxicity to the subject to which the formulation will be administered. "Pharmaceutically acceptable carrier" refers to a component in a pharmaceutical formulation that is non-toxic to the subject other than the active ingredient. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives. In some respects, the choice of carrier depends in part on the specific composition and / or method of administration. Therefore, a variety of suitable formulations exist. For example, a pharmaceutical composition may contain a preservative. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some respects, a mixture of two or more preservatives is used. Preservatives or mixtures thereof are typically present in an amount from about 0.0001% to about 2% by weight of the total composition. Carriers are described, for example, in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. Ed. (1980). Pharmaceutically acceptable carriers are generally non-toxic to the recipient at the doses and concentrations used, and include, but are not limited to: buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyl dimethyl benzyl ammonium chloride; hexamethyl ammonium chloride; benzalkonium chloride; benzyl chloride; phenol, butanol, or benzyl alcohol; alkyl esters of p-hydroxybenzoate, such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); and low molecular weight carriers (less than about 10 residues). Peptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as polyethylene glycol (PEG).

[0194] In some aspects, the composition contains a buffer. Suitable buffers include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffers is used. The buffer or mixture thereof is typically present in an amount from about 0.001% to about 4% by weight of the total composition. Methods for preparing administerable pharmaceutical compositions are known. Exemplary methods are described in more detail, for example, in Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st edition (May 1, 2005).

[0195] The formulation may include an aqueous solution. The formulation or composition may also contain more than one active ingredient that can be used to treat a specific indication, disease, or condition using the composition, preferably those active ingredients having activities complementary to the composition, wherein the respective activities do not adversely affect each other. Such active ingredients are appropriately combined in amounts effective for the intended purpose. Thus, in some embodiments, the pharmaceutical composition further includes other pharmaceutically active agents or drugs, such as chemotherapeutic agents, such as asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vincristine, and / or vinblastine. In some embodiments, the pharmaceutical composition contains an amount of the composition effective in treating or preventing a disease or condition, such as a therapeutically effective or preventively effective amount. In some embodiments, therapeutic or preventive efficacy is monitored by periodically evaluating the treated subject. The desired dose may be delivered by a single bolus injection, multiple bolus injections, or continuous infusion.

[0196] Formulations include those for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration. In some embodiments, the composition is administered parenterally. As used herein, the term "parenterally" includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, the composition is administered to the subject via peripheral systemic delivery, such as intravenous, intraperitoneal, or subcutaneous injection. In some embodiments, the composition is provided as a sterile liquid formulation, such as an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition, which may be buffered to a selected pH in some respects. Liquid formulations are generally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are slightly easier to administer, particularly by injection. On the other hand, viscous compositions can be formulated within a suitable viscosity range to provide a longer contact time with a particular tissue. Liquid or viscous compositions may contain a carrier, which may be a solvent or dispersion medium containing, for example, water, brine, phosphate-buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.

[0197] Sterile injectable solutions can be prepared by incorporating the composition into a solvent, such as by mixing with a suitable carrier, diluent, or excipient (such as sterile water, physiological saline, glucose, dextrose, etc.). Depending on the route of administration and the desired formulation, the composition may contain excipients such as wetting agents, dispersants or emulsifiers (e.g., methylcellulose), pH buffers, gelling or viscosity enhancers, preservatives, flavoring agents, and / or coloring agents. In some respects, standard texts can be consulted for the preparation of suitable formulations.

[0198] Various additives can be added to enhance the stability and sterility of the composition, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Antimicrobial activity can be ensured through various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, and sorbic acid). Absorption of injectable drug forms can be prolonged by using agents that delay absorption, such as aluminum monostearate and gelatin.

[0199] Formulations intended for internal administration are typically sterile. Sterility can be easily achieved, for example, through filtration using sterile membrane filters.

[0200] The contents of any articles, patents, and patent applications mentioned or cited herein, as well as all other documents and electronically available information, are incorporated herein by reference in their entirety, to the extent that each individual publication is expressly and individually indicated to be incorporated by reference. The applicant reserves the right to physically incorporate any and all material and information from any such articles, patents, patent applications, or other physical and electronic documents into this application.

[0201] In some embodiments, the anti-canine PD-1 antibody of this disclosure is contained in a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients, carriers, and diluents. Pharmaceutically acceptable excipients, carriers, and diluents may be included to increase the shelf life, stability, or administerability of the antibody. Such compounds include salts, pH buffers, detergents, anticoagulants, and preservatives. In some embodiments, the antibody of this disclosure is administered in suspension in a sterile solution. In some embodiments, the solution contains about 0.9% NaCl. In some embodiments, the solution contains about 5.0% dextran. In some embodiments, the solution further comprises one or more of the following: buffers, such as acetates, citrates, histidines, succinates, phosphates, bicarbonates, and hydroxymethylaminomethane (Tris); surfactants, such as polysorbate 80 (Tween 80), polysorbate 20 (Tween 20), and poloxamer 188; polyols / disaccharides / polysaccharides, such as glucose, dextrose, mannose, mannitol, sorbitol, sucrose, trehalose, and dextran 40; amino acids, such as glycine or arginine; antioxidants, such as ascorbic acid or methionine; or chelating agents, such as EDTA or EGTA.

[0202] In some embodiments, the antibodies of this disclosure can be lyophilized for transport / storage and reconstituted prior to administration. In some embodiments, the lyophilized antibody formulation includes a filler such as mannitol, sorbitol, sucrose, trehalose, dextran 40, or combinations thereof. The lyophilized formulation may be contained in vials made of glass or other suitable non-reactive materials. The antibody, when formulated, can be buffered at a specific pH (typically less than 7.0), whether or not it has been reconstituted. In some embodiments, the pH may be between 4.5 and 7.0, between 4.5 and 6.5, between 4.5 and 6.0, between 4.5 and 5.5, between 4.5 and 5.0, or between 5.0 and 6.0.

[0203] This document also describes a kit comprising one or more antibodies described herein and one or more additional components selected from the following in a suitable container: instructions for use; diluents, excipients, carriers, and administration devices.

[0204] In some embodiments, this document describes a method for preparing a composition for treating cancer, sepsis or septic shock, or chronic infection (e.g., viral infection), comprising mixing one or more pharmaceutically acceptable excipients, carriers, or diluents with the antibodies of this disclosure. In some embodiments, this document describes a method for preparing a cancer therapeutic agent for storage or transport, comprising lyophilizing one or more antibodies of this disclosure.

[0205] While this disclosure has been described with reference to specific embodiments thereof, those skilled in the art will understand that various modifications and alternatives may be made without departing from the true spirit and scope of this disclosure. It will be apparent to those skilled in the art that other suitable modifications and adaptations may be made to the methods described herein using appropriate equivalents without departing from the scope of the embodiments disclosed herein. Furthermore, numerous modifications may be made to adapt particular circumstances, materials, composition, methods, method steps, or procedures to the objectives, spirit, and scope of this disclosure. All such modifications are intended to fall within the scope of the appended claims. Certain embodiments have now been described in detail and will become clearer with reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting.

[0206] Example This disclosure is further described in detail with reference to the following experimental embodiments. Unless otherwise stated, these embodiments are provided for illustrative purposes only and are not intended to be limiting. Therefore, this disclosure should not be construed as limited to the following embodiments, but should be construed as including any and all variations that become apparent as a result of the teachings provided herein. While preferred embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Many variations, alterations, and substitutions will now occur to those skilled in the art without departing from this disclosure. It should be understood that various alternatives to embodiments of this disclosure may be employed in carrying out this disclosure.

[0207] All publications, patent applications, granted patents and other documents mentioned in this specification are incorporated herein by reference as if each individual publication, patent application, granted patent or other document expressly and individually indicated to be incorporated herein by reference in its entirety. Definitions contained in the text incorporated by reference are excluded to the extent that they conflict with definitions in this disclosure.

[0208] Without further description, it is believed that those skilled in the art can use the foregoing description and the following illustrative examples to prepare and utilize the compounds of this disclosure and to implement the claimed methods. Therefore, the following working examples specifically illustrate some embodiments of this disclosure.

[0209] Example 1: Introduction Programmed cell death protein 1 (PD-1 or CD279) is a co-inhibitory checkpoint molecule primarily expressed on the surface of activated T cells, NK cells, and B cells. PD-1 interacts with its major ligand (PD-L1) expressed on macrophages, dendritic cells, and other stromal cells to inhibit CD4+. + and CD8 + T cell effector functions include proliferation, cytotoxic activity, cytokine secretion, and migration. Therefore, the PD-1:PD-L1 interaction protects the host from an overactive immune response. The development of severe autoimmunity in PD-1-deficient mouse strains highlights this important negative regulatory function of the PD-1:PD-L1 interaction. PD-L1 is also expressed on tumor cells, tumor-associated macrophages, and cancer-associated fibroblasts, and its expression is strongly upregulated by inflammatory cytokines produced by T cells, including IFN-γ and TNF-α. Therefore, activated PD-1... + Tumor-specific T cells contribute to the expression of PD-L1 in the tumor microenvironment, which drives tumor-specific T cell depletion and significantly impairs the anti-tumor immune response.

[0210] Blocking PD-1:PD-L1 interactions with anti-PD-1 or anti-PD-L1 antibodies can enhance anti-tumor immunity and lead to increased tumor-infiltrating lymphocytes (TILs) and impressive clinical responses in a subset of human patients with diverse tumor histologies, including malignant melanoma, non-small cell lung cancer, and renal cell carcinoma. However, durable clinical responses have only been observed in 20–30% of patients treated with anti-PD-1 or anti-PD-L1 antibodies, leading to efforts to understand resistance mechanisms and identify relevant response biomarkers that could streamline patient recruitment for immune checkpoint inhibitor (ICI) monotherapy or to investigate alternative treatment strategies. Tumor mutational burden (TMB), IFN-γ response characteristics, high microsatellite instability / mismatch repair deficiency (MSI-H / MMRD), and PD-L1 expression on tumor cells and tumor-infiltrating immune cells have all shown predictive value for clinical responses to anti-PD-1 therapy across different cancer histologies. Currently, there is active research into strategies to enhance anti-tumor activity by combining anti-PD-1 and anti-PD-L1 mAbs with other ICIs (such as anti-CTLA4, anti-TIM-3, anti-TIGIT, and anti-Lag3 antibodies), or with the administration of cancer vaccines, chimeric antigen receptor (CAR)-T cell therapy, radiotherapy, chemotherapy, and small molecule inhibitors.

[0211] In veterinary medicine, the use of checkpoint inhibitors is still in its early stages, primarily due to the lack of complete canine mAbs with favorable pharmacokinetic / pharmacodynamic properties that can be economically produced on a clinical scale. Furthermore, the total tumor molecular weight (TMB) associated with clinical responses to checkpoint inhibition in some human cancer types is generally lower in canine tumors than in human tumors. Therefore, the use of ICIs as monotherapy remains to be proven, and their combination with radiotherapy, chemotherapy, vaccines, genetically engineered immune cells, and other immunotherapies could enhance their efficacy and provide significant clinical benefit.

[0212] This article describes the development and validation of a canine anti-cPD-1 antibody derived from a canine scFv phage display library. The antibody exhibits favorable in vivo safety, tolerability, and pharmacokinetic properties, and can be produced in high quantities, enabling scalable clinical use. The development of this antibody now allows for the investigation of anti-PD-1 therapies to promote anti-tumor immunity in dogs with immune-responsive cancers. It also provides an important comparative tool for investigating relevant response biomarkers and resistance mechanisms to PD-1 checkpoint inhibition in immunocompetent dogs, which may be valuable for the design of human clinical trials.

[0213] Example 2: Results Isolation of canine PD-1 specific scFv clones The canine anti-cPD-1 scFv was isolated from a previously constructed 40 billion-member canine IgM / IgG / l / k scFv phage display library, constructed from canine B cell mRNA isolated from discarded spleen material from seven healthy dogs that underwent therapeutic splenectomy for benign conditions. The library was constructed using the pComb3X phage vector and the aforementioned protocol, employing a set of oligonucleotide primers designed to capture transcripts encoding all canine immunoglobulin heavy and light chain germline genes listed in the IMGT database. Over 1000 individual RT / PCR reactions (145 reactions per spleen) were performed against VH-g, VH-m, Vk, and Vl, and the amplification products were recombined using strand overlap extension technology to generate four independent libraries. These libraries included VH-g gene segments paired with all Vk and Vl gene segments, and VH-m gene segments paired with all Vk and Vl gene segments. After ligation with pComb3X, *E. coli* was electroporated to generate over 40 billion independent bacterial transformants. To ensure library quality, successful amplification of each of the more than 1,000 heavy and light chain cDNA PCRs was confirmed by agarose gel electrophoresis before library incorporation. Nucleotide sequencing analysis of dozens of individual scFv clones from the unselected primary library revealed complete heavy / light chain scFv insertions in almost 100% of all clones, and showed that the distribution of heavy and light chain immunoglobulin gene families and their genes, as well as the heavy chain CDR3 length, were similar to those found in the analysis of the native canine immunoglobulin library. This canine scFv phage display library has been used in dozens of panning campaigns to isolate therapeutically significant canine antibodies, including anti-canine CTLA-4 antibodies. To select phage display libraries for anti-canine PD-1 (cPD-1) scFv, recombinant cPD-1 was directly coated onto the wells of a microtiter plate and used as the target antigen. As previously described, aliquots of the pooled VH-g / Vk, ​​VH-g / Vl, VH-m / Vk, and VH-m / Vl canine scFv libraries were subjected to four rounds of solid-phase selection (“panning”) targeting immobilized cPD-1. To verify that the selected phages contained cPD-1-specific scFv phage particles, polyclonal scFv phages from each panning round were evaluated by phage ELISA targeting cPD-1. Figure 1 In the third round of panning (P3), a significant enrichment of phage libraries expressing cPD-1 binding to scFv was observed, and this enrichment increased in the fourth round of panning (P4). The binding was specific to cPD-1, as no binding to unrelated antigens (such as human CD19 target antigens) was observed.

[0214] As previously mentioned, the ability of 16 clones from P3 and 16 clones from P4 to bind to cPD-1 was assessed by monoclonal phage ELISA, serving as a preliminary investigation to evaluate positive cPD-1 conjugates. Ten clones from P3 and 15 clones from P4 bound to cPD-1. Figure 2 Nucleotide sequencing of these 25 conjugates identified 14 unique clones. Six contained the l light chain, and eight contained the k light chain. These 14 clones were generated as soluble scFv fragments, and their binding to cPD-1 was assessed in ELISA by detecting the hemagglutinin tag at their carboxyl terminus. Figure 3 (Left). Shows six soluble scFvs binding to cPD-1 as a function of biotinylated cPD-1 captured by plate-bound streptavidin. Following an initial investigation to assess the positivity rate, a high-throughput screening of 176 clones (88 from P3 and 88 from P4) was performed. This screening identified eight additional unique scFv clones (data not shown). Five of these eight additional clones produced soluble scFvs well, and their ability to specifically bind to cPD-1 was confirmed by ELISA. Figure 3 ,right).

[0215] Evaluation of cPD-1 scFv clonal blocking ability Based on the results of cPD-1 binding of soluble scFv, nine cPD-1-binding clones (3-4, 3-8, 3-13, 4-2, 4-9, 4-14, P4B1, P3C6, and P4F3) and two clones showing minimal binding (P4F8 and P4C1) were selected, and their ability to inhibit the interaction between cPD-1 and cPD-L1-Fc was evaluated. Briefly, biotinylated cPD-1 was incubated with cPD-L1-Fc alone or in the presence of cPD-1-specific scFv. The cPD-1:cPD-L1-Fc complex was captured onto a streptavidin-coated plate and then detected using an anti-Fc antibody. Complex formation and detection occurred in the absence of cPD-1-specific scFv blocking the PD-1:PD-L1 interaction. However, if the cPD-1-specific scFv inhibits the binding of cPD-1 to cPD-L1-Fc, the readout signal will be reduced or completely absent in this assay. Figure 4 (Figure A). Except for clones 3-8, 4-2, and 4-9, all clones showed some degree of dose-dependent inhibition of PD-1 binding to PD-L1 (Figure A). Figure 4 (Figure B, data not shown). However, at each cPD-L1 concentration used in the assay, only clone P3C6 completely inhibited the binding of cPD-1 to cPD-L1.

[0216] Selected cPD-1-specific clones bind to cPD-1 on the cell surface. To determine whether selected cPD-1 clones bind to cPD-1 expressed on the cell surface, the human erythroleukemia cell line K562, previously edited to remove FcgRII (CD32; KTd32), was engineered to express cPD-1 using a retroviral vector carrying a puromycin selection cassette (KTd32.cPD-1), and KTd32.cPD-1 cells were selected in puromycin. Four HA-tagged soluble scFvs that inhibit cPD-1:cPD-L1 binding were incubated with KTd32 or KTd32.cPD-1 cells, and binding was determined by flow cytometry. Figure 5 The study included anti-MERS scFv and clones 3-7, which showed no binding to soluble cPD-1, as negative controls. Clone P3C6 was found to bind strongly to KTd32.cPD-1 cells, while all other clones tested showed much weaker binding or no binding (clones 3-8). Based on cell binding and PD-1:PD-L1 inhibitory capacity, clones P3C6 and P4B1 were selected and reformatted to full-length canine IgG. D (Similar to human IgG4) molecule. Due to IgG D Lacking antibody-dependent cell-mediated cytotoxicity (ADCC) and complement fixation, IgG was selected. D As an IgG subtype. These effector functions are not ideal in anti-PD1 checkpoint inhibitors, and IgG D The subtype is consistent with the IgG4 subtype of anti-PD-1 antibodies used in human clinical practice (e.g., pembrolizumab and nivolumab).

[0217] Heavy chain defects lead to low P3C6 yield. Although P4B1 is a full-length IgG D The antibody expressed well in transient transfection of 293T cells (0.65 mg / ml), but the yield of P3C6 was negligible. Chain exchange assays with P4B1 confirmed that this deficiency was related to the heavy chain of P3C6 (data not shown). Heavy chain analysis of P4B1 and P3C6 by IMGT indicated that both may be derived from canine IGHV3-38. The 01 VH gene encodes and has high sequence homology in its framework region, although their CDRs differ, especially their CDR3 lengths. Figure 6 (See Figure A (top image)). The P4B1 and P3C6 light chains are very different because one is a λ isotype (most likely derived from the canine genus IGLV3-27). The other is κ (most likely generated by the canine gene IGKV3-18). 02 encoding) Figure 6 Figure A (below)).

[0218] To test whether the expression characteristics of P4B1 could be conferred on P3C6, we replaced 11 different framework amino acids in P3C6 with 11 different framework amino acids in P4B1 to create P3C6 mut 3. When paired with the original P3C6 κ light chain, yield was improved, but the antibody no longer bound to PD-1 (data not shown). Strategic reversion mutations were made in 7 or 6 of the 11 P4B1 framework residues to those of P3C6 to create P3C6 mut 3.1 and P3C6 mut 3.2, respectively. Pairing with the P3C6κ light chain, both antibodies were produced well (P3C6 mut3.1: 0.38 mg / ml and P3C6 mut3.2: 0.36 mg / ml, MERS 0.44 mg / ml and P4B1 0.6 mg / ml, respectively), and restored PD-1 binding properties similar to the original full-length P3C6 antibody, including binding to cPD-1 expressed on the cell surface as detected by flow cytometry. Figure 6 (Figure B). One difference between the P3C6 mut3.1 and mut3.2 heavy chains is that mut3.1 retains the prominent V23M somatic mutation in P3C6 from germline IGHV3-38, which may contribute to antigen binding or antibody stability. Therefore, P3C6 mut3.1 was chosen for further study.

[0219] SPR analysis P3C6mut3.1 IgG was identified using surface plasmon resonance (SPR). D Affinity and binding kinetics with cPD-1. HIS-tagged cPD-1 was tethered to a CMS chip coated with an anti-HIS antibody, and P3C6mut3.1 was injected into the flow cell at a constant rate. The binding rate constant (k) of P3C6mut3.1 was determined. on ) and dissociation rate constant (k off ) are 1.31 x 10 5 M -1 s -1 and 1.43 x 10 -4 s -1 ( Figure 9 The dissociation constant (K) of P3C6mut3.1 D The binding affinity was 1.1 nM, and the binding half-life was 81 minutes. These binding kinetics are similar to those reported for nivolumab. Therefore, P3C6mut3.1 exhibits a rapid binding rate and a slow dissociation rate, resulting in a low nanomolar affinity in the single digits.

[0220] In vitro functional assessment of P3C6 mut 3.1 on antigen-specific T cell activity To determine whether the P3C6 mutant could reverse the inhibitory effect of PD-1:PD-L1 interaction after antigen-specific T cell activation, canine T cells were isolated from a single healthy donor dog and genetically engineered to express a second-generation chimeric antigen receptor targeting CD20 (CD20 CAR-T cells). These cells were labeled with CTV and co-cultured with irradiated K562 target cells engineered to express canine CD20 but not canine PD-L1 (K562.cCD20), or to express both canine CD20 and canine PD-L1 (K562.cCD20.cPD-L1). Expression of cPD-L1 on target K562.cCD20 cells inhibited canine CAR-T cell proliferation, as shown by the higher MFI (MFI=2879) of CTV-labeled CAR-T cells co-cultured with K562.cCD20.cPD-L1 compared to K562.cCD20 (MFI=1763). Figure 7 (Figure A). However, in the presence of P3C6mut3.1IgG D In the presence of mAb, the inhibitory effect of PD-L1 on CAR-T cell proliferation was reduced (MFI=2344). Furthermore, upon binding to the CD20 antigen, expression of the degranulation marker CD107b in canine CAR-T cells was reduced by expressing PD-L1 on target K562.cCD20.cPD-L1 cells; however, expression of this marker was reduced in P3C6mut3.1 IgG cells. D The presence of threshing almost completely recovers ( Figure 7 (Figure B). In summary, these data indicate that P3C6mut3.1 can ameliorate the inhibitory effect of PD-1:PD-L1 interaction on canine T cells and suggests that it may have therapeutic value in improving anti-tumor T cell-mediated immunity in vivo.

[0221] P3C6mut3.1 Identification of cPD-1 in formalin-fixed, paraffin-embedded canine lymphoid tissue + lymphocytes PD-1 is known to invade CD8 cells in tumors. + PD-1 is expressed in T cells, other tumor-infiltrating immune cells, and tumor cells themselves. However, the exact function of PD-1 in infiltrating immunosuppressive cells (such as tumor-associated macrophages, myeloid cells, and regulatory T cells) and tumor cells themselves is controversial. To determine the ability of the P3C6 clone to detect cPD-1 in formalin-fixed, paraffin-embedded canine tissue, full-length, HA-tagged P3C6mut3.1 IgG was used, as described in Materials and Methods. D Used in immunohistochemical analysis. P3C6mut3.1 was found to have an effect on the paracortical area of ​​lymph nodes (…). Figure 10The membranes of individual lymphocytes in the perisplenic artery lymphoid sheath (PALS) and interfollicular region of the tonsils were strongly stained. No immunomarking was observed in sections incubated with isotype control antibodies or in which the primary antibody was omitted. Other non-lymphoid tissues included in the TMA were negative for P3C6mut3.1 staining.

[0222] Antibody modification and production for in vivo studies in dogs Pilot production: SDS-PAGE analysis of P3C6 mut3.1 showed the presence of half-antibody fragments and heavy chain dimers. Figure 11 ), and a titer of 0.46 mg / ml in a small-scale 100 ml culture. Therefore, the P3C6 mut3.1 sequence was modified as follows: with IgG B Hinge Replacement IgG D Hinge region (ESTCKCISPCPVPESL) and in IgG B Two mutations (ML to AA) are generated in the hinge region to reduce ADCC (RENGRVPRPPDCPKCPAPE) AA The amino acid mutation from ML to AA is highlighted in bold.

[0223] After sequence confirmation, the hinge-modified P3C6 mut3.1 (IgG) was... D / B The sequence was transiently transfected into proprietary CHO-K1 cells by a dedicated CRO and expressed in 100 mL shake flasks. The antibody was purified by protein A chromatography. SDS-PAGE analysis showed that hinge modification resulted in reduced yields of both the half antibody and HC dimer. Figure 11 The antibody titer increased (original sequence: 0.46 mg / ml; modified sequence: 0.75 mg / ml). The molecule (IgG) was confirmed by ELISA. D / B The combination of cPD-1 and cPD-1 (data not shown).

[0224] Scale-up production: The PD-1 antibody for in vivo use is produced in single batches by the same CRO provider using the same proprietary CHO-K1 cells as in pilot production. Modified P3C6 mut3.1 IgG was used. D / B The expression construct was transiently transfected into CHO-K1 cells, and a 20 μL antibody transient production run was performed in shake flasks under appropriate selection pressure. The antibody was purified in one step using protein A chromatography, and the expression / yield (12.53 mg / mL), endotoxin level (< 0.08 EU / mg), and purity (by SEC-HPLC (96.12%), SDS-PAGE (reducing and non-reducing), and LC-MS) of the resulting material were analyzed. This material was used for the in vivo safety and pharmacokinetic studies described in the main text.

[0225] Preliminary Study 1: Preliminary Study 2: Preliminary Study 3: Preliminary Study 4: Preliminary Study 5: In vivo pharmacokinetic assessment Because P3C6 mut3.1 does not cross-react with mouse PD-1 (data not shown), pharmacokinetic and biodistribution studies were not conducted in mice. To determine the non-GLP P3C6 mut3.1 (IgG) in the target species (dogs)... D / B The safety, tolerability, and pharmacokinetics (PK, drug exposure) of P3C6 mut3.1 were investigated in a non-terminal preliminary study in four healthy study beagle dogs. There was no mediator control group. Two adult uncastrated males and two adult unspayed females were randomly assigned to receive 2 mg / kg (one male and one female) or 10 mg / kg (one male and one female) of P3C6 mut3.1 (IgG). D / B (SEC-HPLC purity 96.12%; endotoxin < 0.08 EU / mg), administered as a slow intravenous bolus every 3 weeks for a total of 2 doses (day 0 and day 21). No pre-treatment drugs were given prior to either antibody administration. Organ-related toxicities in dogs were monitored by observation, physical examination, and hematological and biochemical analyses at the time points specified in Materials and Methods. This study was non-terminal and histopathology of tissues was not evaluated. Throughout the 28-day study period, dogs received either 2 mg / kg or 10 mg / kg P3C6mut3.1 (IgG) twice. D / B No adverse clinical, hematological, or biochemical events or significant changes in weight were identified in any of the four dogs treated (data not shown).

[0226] Pharmacokinetic analysis showed that both doses of P3C6mut3.1 (IgG) D / B All of them exhibited a double exponential concentration-time curve. Figure 8(Figure A). Non-compartmental analysis (NCA) was performed to determine individual dog and dose-related PK parameters (Table I). Compared with a 2 mg / kg dose, a 10 mg / kg dose resulted in decreased clearance (CL) and increased volume of distribution (V). ss ) and increase half-life (t 1 / 2 This indicates a trend towards P3C6 mut 3.1 (IgG). D / B Within this dose range, there may be non-linear pharmacokinetic (PK), likely due to target-mediated drug disposal (TMDD), as reported with pembrolizumab in human patients. This is supported by the following: an inflection point exists between 7 and 20 days, with elimination increasing as concentration decreases. Furthermore, dose-normalized PK curves ( Figure 8 Figure B) shows a lack of overlap at later time points, further indicating nonlinear PK. Based on these data, the highest non-serious toxicity dose (HNSTD) tested was 10 mg / kg, and the MTD was undefined. The No Observed Adverse Effect Level (NOAEL) was 10 mg / kg. Although anti-drug antibodies (ADA) were not measured in this study, due to the lack of validated ADA assays, no sharp drop in drug concentration was observed after the first or second dose of P3C6mut3.1, and similar drug concentrations were identified in serum on day 28 (7 days after the second dose) and day 7, suggesting that ADA did not accelerate antibody elimination at the second dose. Therefore, the PK data are consistent with the lack of effect of ADA during this period.

[0227] Example 3: Materials and Methods Cells and cell lines Peripheral blood mononuclear cells (PBMCs) were isolated from the blood of healthy donor dogs (IACUC #807025, University of Pennsylvania) by Ficoll density gradient centrifugation. Prior to use, the cells were washed twice in complete (c) RPMI medium containing 2 mM L-glutamine (Corning / Mediatech, 25-005-CV), 10% heat-inactivated fetal bovine serum (Atlanta Biologicals, S11150), 10 mM HEPES (ThermoFisher Scientific / Gibco, 15630130), and 100 U / ml penicillin and 100 μg / ml streptomycin (ThermoFisher Scientific / Gibco, 15140122). Human cell lines (K562 and 293T cells) were grown in (c)RPMI supplemented with 1 mM sodium pyruvate (Corning / Mediatech, 25-000-CIR) and 30 μg / mL gentamicin (ThermoFisher Scientific / Gibco 15750060).

[0228] Generation of PD-1 and PD-L1 target cell lines Full-length cPD-1 was amplified from cPBMC cDNA by RT-PCR, and the resulting 867 bp amplicon was cloned into the pMX-purinemycin retroviral expression vector (Cell Biolabs Inc., RTV-060). For cPD-L1, an 870 bp full-length sequence was synthesized and cloned into the pMX-purinemycin retroviral expression vector using Genewiz (South Plainfield, New Jersey). Retroviruses were generated and stably transduced into the human erythroleukemia K562 cell line with cPD-1. This cell line had previously been edited using CRISPR / Cas9 to remove FcgRII (KTd32) and reduce nonspecific mAb binding. Transduced cells were selected to produce KTd32.cPD-1 in 2.5 mg / ml puromycin dihydrochloride (Sigma-Aldrich, P9620). Flow cytometry confirmed the expression of cPD-1 on the cell surface. For target cells expressing cPD-L1, K562 cells expressing canine CD20 (K562.cCD20) were generated as previously described, and wild-type K562 cells and K562.cCD20 cells were transduced with cPD-L1 to generate K562.cPD-L1 and K562.cCD20.cPD-L1 cells, respectively. Based on PD-L1 expression, K562.cPD-L1 and K562.cCD20.cPD-L1 cells were batch-sorted by flow cytometry, and clones were expanded in supplemented cRPMI as described above.

[0229] scFv phage ELISA To detect phage-displayed scFv binding by ELISA, microplate wells were coated with cPD-1 protein (recombinant; His-tagged) (SinoBiological, 70109-D08H), and human CD19 (Sino Biological, 11880-H08H), canine CD19 (Sino Biological, 70079-D08H), or canine IL-13Ra2-Fc (Sino Biological, 11350-H03H) were used as control antigens, as described previously in the phage display library panning. In short, polyclonal phages from the initial phage library (P0) concentrated by PEG and monoclonal phages prepared from antigen-enriched libraries obtained after each round of panning (P1 to P4) or from phage clones randomly selected from the output plates of the third (P3) and fourth (P4) rounds of panning were added to the wells coated with recombinant cPD-1. After incubation at 37°C for 1 hour, the plate was washed with PBS containing 0.1% Tween 20, and HRP-conjugated anti-M13 mAb (Sino Biological, 11973-MM05T-H) diluted 1:5000 with MPBS was added. The plate was washed again, and the binding of HRP-conjugated secondary antibody was detected by ABTS. After 30 min, the OD at 405 nm was read using a Molecular Devices SpectraMax 340 spectrophotometer.

[0230] Soluble scFv production In summary, a non-inhibitory TOP10F' chemocompetent *Escherichia coli* strain (ThermoFisher Scientific / Invitrogen, C303003) was infected with a phage clone that was confirmed by phage ELISA to bind to a streptavidin-fixed, biotinylated, avi-tagged cPD-1 soluble protein (Sino Biological, 70109-D27H-B). Expression cultures induced by 0.5 mM IPTG were used, starting with bacterial colonies, as previously described. Periplasmic extracts were extracted from the induced cultures, and His-tagged scFvs were purified by metal affinity chromatography using a Ni-NTA agarose column as previously described.

[0231] Soluble scFv ELISA Streptavidin was coated at 30 mg / mL onto a 96-well ELISA plate and incubated overnight at 4°C. The wells were blocked with 5% milk / PBST. 0.1–30 pmol of biotinylated cPD-1 protein was added to each well and incubated at room temperature for 1 hour. 0.25 mg / mL of soluble scFv from PBST was added to each well and incubated at room temperature for 2 hours. The wells were washed twice, and the bound scFv was detected using 0.5 mg / mL (1:2000 dilution) of AP-conjugated anti-HA antibody (Sigma-Aldrich, A5477). The plate was incubated at room temperature for 1 hour. The plate was washed again and tested with Quanti Blue. TM The bound scFv was detected using an AP colorimetric substrate (InvivoGen, rep-qbs). The plate was read out at OD 650 nm after 1 hour.

[0232] Inhibition assay based on PD-1:PD-L1 ELISA Streptavidin (30 mg / ml) was spotted onto an ELISA plate and incubated overnight at 4°C. The streptavidin was removed, and the wells were blocked with 5% milk / PBS containing 0.05% Tween. Soluble biotinylated cPD-1 (3 pmol or 55 ng) was incubated on ice for 1 h with 1.0, 3.0, or 10 pmol cPD-L1-Fc (Sino Biological, 70109-D02H) alone or in the presence of a selected anti-cPD-1 scFv (70 pmol) or an unrelated scFv (anti-Middle East Respiratory Virus (MERS)), then added to the blocked plate and incubated at room temperature for 2 h. The plate was washed three times with TBS-Tween, and cPD-L1 binding to cPD-1 was detected using an anti-Fc-AP conjugate (1:1000) (Jackson ImmunoResearch, 709-055-098). After washing three times with TBS-Tween, Quanti Blue was added. TM The AP colorimetric substrate (InvivoGen) was used for 1 hour, and then spectrophotometric readings were performed at OD 650 nm.

[0233] Full-length IgG4 mAb generation The VH and VL chains of selected scFv were cloned into separate expression plasmids, which were then engineered to express canine constant light chain κ (InvivoGen, pfuse2-dclk), constant light chain λ (InvivoGen, pfuse2-dcll), or constant IgG4 (IgG). DThe plasmid was transfected into 293T cells, and transformed cells were selected based on antibiotic resistance. Blastocidin was used to select for the λ and κ light chains, and zeocin was used to select for cells containing constant IgG4 (IgG). D ) structural domain plasmids.

[0234] Soluble scFv binds to membrane-expressed PD-1.

[0235] KTd32.cPD-1 and KTd32(WT) cell lines were washed twice in FACS buffer (1% heat-inactivated FBS in 1X PBS containing calcium and magnesium). Cells were blocked for 10 min at room temperature with 0.1 mg / ml canine IgG (Jackson ImmunoResearch, 004-000-003) before labeling the cell surface with 0.05 mg / ml canine scFv or 0.5 mg / ml canine IgG. After washing, APC-labeled anti-HA.11 epitope tag antibody (BioLegend, 901523) and viability dye 7-AAD (BioLegend, 420403) were added, and cells were incubated at room temperature for 30 min. After cell surface labeling, cells were washed twice in FACS buffer and collected on a FACS Canto II flow cytometer (BD Biosciences). Data were analyzed using FlowJo software version X (Treestar, Ashland, OR).

[0236] Functional assessment of anti-PD-1 antibody on antigen-specific T cell activity As previously described, canine CAR T cells were generated using a standard retroviral transduction protocol. Briefly, negatively selected canine T cells were activated with anti-canine CD3 / CD28 magnetic beads in the presence of recombinant human IL-2 (100 IU / mL, Thermo Fisher Scientific / Gibco, CTP0021), IL-7 (10 ng / mL, Thermo Fisher Scientific / Gibco, PHC0071), IL-15 (10 ng / mL, Thermo Fisher Scientific / Gibco, PHC9151), and IL-21 (10 ng / mL, Thermo Fisher Scientific / Gibco, PHC0211). Two days later, cells were transduced on retrotronectin using an MSGV1 retroviral vector (MOI=5) containing a 28z CAR targeting canine CD20, as previously described. Six days later, T cells were activated via their CAR using K562-cCD20 cells. Proliferation and degranulation assays were established six days later.

[0237] Proliferation assay Canine CAR T cells were labeled with 5 mM Cell Tracing Violet (CTV) solution (Thermo Fisher Scientific, C34557) in PBS according to the manufacturer's instructions. Cells were washed in PBS and co-cultured with the aforementioned irradiated (10000 Gy) K562 target cell line at a 1:1 E:T ratio. After 72 hours of incubation, cells were harvested, washed in FACS buffer, and labeled with biotinylated rabbit anti-mouse IgG antibody (Jackson ImmunoResearch, 315-065-003) for CAR detection. Cells were washed twice more in FACS buffer and labeled for 30 min at room temperature with rat anti-canine CD5 antibody (clone: ​​YKIX 322.3), rat anti-canine CD4 (clone: ​​YKIX302.9), rat anti-canine CD8 mAb (clone: ​​YCATE55.9, BioRad, MCA1039GA), and APC-Cy7 conjugated streptavidin (BD Biosciences, 554063). Cells were washed twice more in FACS buffer and fixed in 2% paraformaldehyde (Thermo Fisher Scientific, AAJ19943K2). Cells were collected on a FACS Canto II flow cytometer (BD Biosciences), and data were analyzed using FlowJo software version 10 (Treestar, Ashland, OR).

[0238] threshing test Canine CAR-T cells were harvested, washed, and co-cultured at a 1:1 E:T ratio with irradiated target cells in the presence of anti-CD107b antibody (clone: ​​AC17, BioRad, MCA2558GA) (0.25 mg / mL), which was added at the start of the co-culture. P3C6mut3.1 or anti-MERS antibody was added to the co-culture at a concentration of 20 mg / mL. After 4 hours of incubation, the cell suspension was harvested, washed twice in FACS buffer, and labeled with rat anti-canine CD5 (clone: ​​YKIX 322.3), rat anti-canine CD4 (clone: ​​YKIX 302.9), and rat anti-canine CD8 mAb (clone: ​​YCATE 55.9). After cell surface labeling, the cells were washed twice in FACS buffer and fixed in 1% paraformaldehyde. Cells were collected on a FACS Canto II flow cytometer (BD Biosciences) and the data were analyzed using FlowJo software version 10 (Treestar, Ashland, OR).

[0239] abbreviation ADA: Anti-drug antibody; AE: Adverse events; AUC inf Area under the serum concentration-time curve extrapolated to infinity; AUC last Area under the serum concentration-time curve from 0 to 21 days; CAR: Chimeric antigen receptor; CL: Clearance rate; Cmax: Measured maximum serum concentration; CMS: Carboxymethyl surface; cPBMC: Canine peripheral blood mononuclear cells; CTLA4: Cytotoxic T lymphocyte antigen 4; CTV: Cell tracer violet; DC: Dendritic cells; ELISA: Enzyme-linked immunosorbent assay; FDA: U.S. Food and Drug Administration; GLP: Good Laboratory Practice; HA: Hemagglutinin; HIS: Histidine; HNSTD: Maximum non-serious toxicity dose; IACUC: Institutional Animal Care and Use Committee; ICI: Immune checkpoint inhibitor; NCA Non-compartmental analysis; NOAEL: Level at which no adverse effects were observed; LAG3: Lymphocyte activation gene 3; MERS: Middle East Respiratory Syndrome; MFI: Mean fluorescence intensity; MSI-H / MMRD: High microsatellite instability / mismatch repair deficiency; MTD: Maximum tolerated dose; PALS: Peri-arterial lymphoid sheath; PD-1: Programmed cell death protein 1; PD-L1: Programmed cell death ligand 1; PK: Pharmacokinetics; RO: Receptor occupancy; scFv: Single-chain variable fragment; SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis; SEC-HPLC: Size exclusion high-performance liquid chromatography; t 1 / 2: Terminal log-linear half-life; TIGIT: T cell immune receptor containing immunoglobulin and ITIM domains; TIL: Tumor-infiltrating lymphocytes; TIM-3: Protein-3 containing T cell immunoglobulin and mucin domains; TMB: Tumor mutation burden; TMDD: Target-mediated drug delivery; VH: Variable heavy chain; VL: Variable light chain; V ss : Distributed volume.

Claims

1. An antibody comprising canine IgG subclass IgG A IgG B IgG C or IgG D The Fc region, and canine IgG subclass IgG A IgG B IgG C or IgG D The hinge region, wherein the Fc region and the hinge region belong to different canine IgG subclasses.

2. The antibody according to claim 1, wherein the antibody is a full-length antibody.

3. The antibody according to claim 1 or 2, wherein the antibody comprises a CH1 region, and the CH1 region and the hinge region belong to the same canine IgG subclass.

4. The antibody according to any one of claims 1-3, wherein the Fc region belongs to the canine IgG subclass IgG. D .

5. The antibody according to any one of claims 1-4, wherein the hinge region belongs to the canine IgG subclass IgG. B .

6. The antibody according to any one of claims 1-5, wherein the Fc region corresponds to the canine IgG subclass IgG. A IgG B IgG C or IgG D The amino acid sequence of the natural Fc region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity.

7. The antibody according to any one of claims 1-6, wherein the hinge region corresponds to canine IgG subclass IgG. A IgG B IgG C or IgG D The amino acid sequence of the natural hinge region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity.

8. The antibody according to any one of claims 1-7, wherein and / or the hinge region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98% or 99% identity with the amino acid sequence of SEQ ID NO:

66.

9. The antibody according to any one of claims 1-8, wherein the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence of SEQ ID NO:

67.

10. The antibody according to any one of claims 1-9, wherein the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence of SEQ ID NO:

68.

11. The antibody according to any one of claims 1-10, wherein the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity with the amino acid sequence of SEQ ID NO:

69.

12. The antibody according to any one of claims 1-11, wherein the antibody is a canine antibody or a canine-derived antibody, and optionally, wherein the antibody binds to a canine antigen.

13. The antibody according to any one of claims 1-12, wherein the antibody binds to canine programmed death protein 1 (cPD-1).

14. The antibody according to any one of claims 1-13, wherein the antibody comprises: (a) An immunoglobulin heavy chain comprising a heavy chain complementarity-determining region 1 (HCDR1), wherein HCDR1 comprises the amino acid sequence shown in SEQ ID NO: 1, 27, or 43; HCDR2, wherein HCDR2 comprises the amino acid sequence shown in SEQ ID NO: 2, 28, or 44; and HCDR3, wherein HCDR3 comprises the amino acid sequence shown in SEQ ID NO: 3, 29, or 45; and (b) An immunoglobulin light chain comprising a light chain complementarity-determining region 1 (LCDR1), wherein the LCDR1 comprises the amino acid sequence shown in SEQ ID NO: 4, 30 or 46; an LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 5, 31 or 47; and an LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 6, 32 or 48.

15. The antibody according to any one of claims 1-14, wherein the antibody comprises an immunoglobulin heavy chain, the immunoglobulin heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 19, 21, 23, 39, 55 or 70-75.

16. The antibody according to any one of claims 1-15, wherein the antibody comprises an immunoglobulin light chain, the immunoglobulin light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 25, 41, or 57.

17. The antibody according to any one of claims 1-16, wherein the antibody comprises: (a) An immunoglobulin heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO: 70; and (b) An immunoglobulin light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the amino acid sequence shown in SEQ ID NO:

25.

18. The antibody according to any one of claims 1-17, wherein the antibody contains an amino acid mutation AA at the C-terminus of the natural hinge region relative to the natural hinge region.

19. The antibody of claim 18, wherein the antibody lacks the ability to mediate antibody-dependent cell-mediated cytotoxicity (ADCC) or has a reduced ability to mediate ADCC relative to a reference antibody having substantially the same sequence except for the absence of an AA mutation at the C-terminus of the hinge region.

20. An isolated nucleic acid encoding an antibody according to any one of claims 1-19.

21. A vector comprising the isolated nucleic acid according to claim 20.

22. A host cell comprising the isolated nucleic acid according to claim 20 or the vector according to claim 21.

23. A pharmaceutical composition comprising an antibody according to any one of claims 1-19, and a pharmaceutically acceptable excipient, carrier, or diluent.

24. A kit comprising an antibody according to any one of claims 1-19 and instructions for use.

25. A method of treating a disease or condition in a subject, comprising administering to the subject an antibody according to any one of claims 1-19 or a pharmaceutical composition according to claim 23.

26. The method of claim 25, wherein the disease or condition comprises cancer, sepsis or septic shock, or chronic infection (optionally viral infection).

27. The method according to claim 25 or 26, wherein the object is a canine.

28. A method for preparing a pharmaceutical composition according to claim 23, comprising mixing an antibody according to any one of claims 1-19 with a pharmaceutically acceptable excipient, carrier, or diluent.

29. A method of preparing a composition for treating cancer, sepsis or septic shock, or chronic infection (e.g., viral infection), comprising mixing an antibody according to any one of claims 1-19 with a pharmaceutically acceptable excipient, carrier, or diluent.

30. The method of claim 26 or 29, wherein the cancer includes melanoma (e.g., metastatic malignant melanoma), prostate cancer (e.g., hormone-refractory prostate adenocarcinoma), head and neck cancer (e.g., squamous cell carcinoma of the head and neck), cervical cancer, thyroid cancer, glioblastoma, glioma, leukemia, lymphoma (e.g., B-cell lymphoma), adrenal cancer, AIDS-related cancer, alveolar soft tissue sarcoma, astrocytic tumor, bone cancer, brain and spinal cord cancer, metastatic brain tumor, carotid body tumor, chondrosarcoma, chordoma, chromophobe renal cell carcinoma, clear cell carcinoma, benign fibrous histiocytoma of the skin, connective tissue proliferative small round cell tumor, ependymoma, Ewing's tumor, extraosseous myxoid chondrosarcoma, fibrous dysplasia of bone, fibrous dysplasia of bone, gallbladder or Bile duct cancer, gestational trophoblastic disease, germ cell tumors, hematologic malignancies, hepatocellular carcinoma, islet cell tumor, Kaposi's sarcoma, renal cancer, lipoma / benign lipoma-like tumor, liposarcoma / malignant lipoma-like tumor, medulloblastoma, meningioma, Merkel cell carcinoma, multiple endocrine adenomas, multiple myeloma, myelodysplastic syndrome, neuroblastoma, neuroendocrine tumors, papillary thyroid carcinoma, parathyroid tumors, pediatric cancers, peripheral nerve sheath tumors, pheochromocytoma, pituitary adenoma, prostate cancer, posterior uveal melanoma, rare hematologic disorders, renal metastases, rhabdoid tumors, rhabdomyosarcoma, sarcoma, soft tissue sarcoma, squamous cell carcinoma, gastric cancer, synovial sarcoma, testicular cancer, thymic carcinoma, thymoma, thyroid metastases, uterine cancer, or any combination thereof.

31. A method for producing an antibody according to any one of claims 1-19, comprising culturing a host cell according to claim 22.

Images