Primer pair of SNP marker associated with total number of piglets born on pig chromosome 1 and application thereof

Abstract

This invention relates to a primer pair for a SNP marker associated with total litter size on pig chromosome 1 and its application. The SNP marker is located on pig chromosome 1 at the molecular marker rs327638047 in the international pig genome version 11.1 reference sequence, exhibiting T / G polymorphism. The primer pair sequence is: upstream primer: SEQ ID NO: 2, downstream primer: SEQ ID NO: 3. The SNP marker provided by this invention can be used to screen for high-yielding pigs by identifying this locus; individuals with the GG genotype have a significantly higher average total litter size than those with the TT genotype. The resulting high-yielding pigs have significant economic and social value.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to a pair of SNP marker primers on pig chromosome 1 that are associated with the trait of total litter size in pigs and their applications. Background Technology

[0002] In commercial pig breeding, reproductive traits such as litter size, teat count, and estrus interval have become key focus areas, especially in the breeding of maternal pigs. Litter size, as a crucial reproductive trait, is one of the most important production traits in pigs, directly reflecting the sow's reproductive performance and impacting the economic benefits of the pig farming industry.

[0003] Litter size, as a complex quantitative trait, has low heritability and is influenced by many factors. From pre-ovulation to postpartum, factors such as sow breed, age, parity, semen quality of the boar, mating technique, and the sow's nutritional status during pregnancy all affect litter size to varying degrees. Variation in litter size is controlled by major and minor genes, influenced not only by genetics but also by the environment. Traditional breeding methods, based on phenotypic selection, lack accurate genetic information, leading to slow performance improvement during the selection process. With the development of molecular biology techniques and the discovery of various gene markers, more and more specialized breeding companies and large enterprises are using molecular marker-assisted breeding technology to assist in litter size selection, greatly improving the accuracy of selection and the speed of performance improvement.

[0004] The litter size trait in pigs is controlled by multiple genes, making it extremely difficult to identify the true major genes and mutation sites. Currently, only the estrogen receptor (ESR) gene and the follicle-stimulating hormone beta (FSHβ) gene are recognized as genes affecting litter size and are widely used in pig breeding. Other genes are considered minor genes, having been verified to play their respective roles in fertilization, ovulation, pregnancy, or embryonic development, ultimately influencing litter size. Summary of the Invention

[0005] The purpose of this invention is to provide SNP marker primer pairs related to the pig's litter size trait, addressing the time-consuming and labor-intensive nature and poor breeding results of traditional pig breeding methods.

[0006] Another object of the present invention is to provide an application for detecting primer pairs of the above-mentioned SNP markers.

[0007] Another objective of this invention is to provide a method for screening high-producing Large White pig populations.

[0008] A primer pair for a SNP marker on chromosome 1 of pigs that is associated with the total litter size trait in Large White pigs. The SNP marker is the rs327638047 nucleotide site on chromosome 1 of pigs in the international pig genome version 11.1 reference sequence. This site exhibits T / G polymorphism. The total litter size of sows with the GG genotype at this site is significantly higher than that of sows with the TG or TT genotypes at this site.

[0009] As a preferred embodiment of the present invention, the primer pair sequence is upstream primer: SEQ ID NO: 2, downstream primer: SEQ ID NO: 3.

[0010] The application of the SNP marker primer pair in screening high-producing Large White pig populations.

[0011] The application of the SNP marker primer pair in the preparation of reagents for screening high-yielding Large White pigs.

[0012] The application of the SNP marker primer pair in the breeding of high-yielding Large White pigs.

[0013] A method for screening high-producing Large White pig populations includes detecting the genotype of the rs327638047 nucleotide site on chromosome 1 of the Large White pig international pig genome version 11.1 reference sequence, and preferentially selecting individuals with the GG genotype at the rs327638047 nucleotide site as breeding pigs.

[0014] As a preferred embodiment of the present invention, the method includes the following steps:

[0015] (1) Extract total DNA from Large White pig tissue samples;

[0016] (2) Using the extracted porcine genomic DNA as a template, perform PCR amplification using the primer pair described in claim 1 or 2;

[0017] (3) Sequencing of the amplified product, analysis of the sequencing results, and interpretation of the T / G polymorphism at position 423 of SEQ ID NO: 1.

[0018] Beneficial effects:

[0019] The SNP marker provided by this invention is associated with the litter size trait in pigs, and the molecular marker primer pair developed based on this SNP can be used for SNP detection. Therefore, high-yielding pigs can be screened by identifying this SNP marker, and the resulting high-yielding pigs have significant economic and social value. Attached Figure Description

[0020] Figure 1 A gel image of the rs327638047 locus on pig chromosome 1.

[0021] Figure 2Example of a genotyping diagram for the rs327638047 locus on pig chromosome 1. Detailed Implementation

[0022] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0023] Example 1:

[0024] First, genome-wide association analysis (GWAS) of Guangxi Liyuan Large White pigs identified a significant association between this SNP marker and the total litter size trait. Subsequently, validation was performed in Henan Minwang Large White pigs and Jiangxi Dajia Large White pigs, showing that the marker was significantly associated with litter size in all Large White pig populations. The specific experimental methods are as follows:

[0025] 1. Source of experimental animals

[0026] Large white pigs from Guilin Liyuan Group, Henan Minwang Animal Husbandry Co., Ltd., and Jiangxi Jiada Group Co., Ltd.

[0027] 2. Extraction of porcine genomic DNA

[0028] Ear tissue samples were collected from 4072, 1860, and 2323 Large White pigs from Guilin Liyuan, Henan Minwang, and Jiangxi respectively, for individual DNA extraction.

[0029] Referring to the instructions for the Tissue DNA Extraction Kit from Tiangen Biotech Co., Ltd., the extraction was performed in the following order:

[0030] ① First, add 68 mL of buffer GD and 200 mL of anhydrous ethanol to the wash buffer PW, and mix thoroughly.

[0031] ② Collect approximately 100 mg of tissue sample and place it in a 2 mL EP tube. After completely cutting it into small pieces, add 200 μL of buffer GA and shake until completely suspended.

[0032] ③ Add 20 μL of proteinase K solution, mix well, and place in a 56 ℃ metal bath for digestion overnight until the ear-like tissue dissolves. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0033] ④ Add 200 μL of buffer GB, mix thoroughly by inverting, place in a 70 ℃ metal bath for 10 min, the solution should become clear, and briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0034] ⑤ Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0035] ⑥ Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, place the adsorption column in the collection tube, then centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0036] ⑦ Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 into the collection tube.

[0037] ⑧ Add 600 μL of washing buffer PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and place the adsorption column CB3 into the collection tube.

[0038] ⑨ Repeat step ⑧.

[0039] ⑩ Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry any residual washing liquid in the adsorption material.

[0040] ⑪ Transfer the adsorption column CB3 into a clean centrifuge tube, add 100 μL of elution buffer TE to the middle of the adsorption membrane, incubate at room temperature for 2-5 min, centrifuge at 12,000 rpm for 2 min, collect the solution into the centrifuge tube, add the centrifuged solution back into the adsorption column CB3, incubate at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min, collect the solution into the centrifuge tube.

[0041] After measuring the mass and concentration using a Nanodrop-100 spectrophotometer, the concentration was diluted to 50 ng / μL and stored at -20 ℃ for later use.

[0042] 3. PCR amplification and sequencing of the target fragment

[0043] Using the extracted DNA as a template, PCR amplification was performed according to the designed primers: 1 μL of DNA template, 0.4 μL each of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, 10 μL of PCR Mix reagent, and 7.2 μL of double-distilled water were prepared; the PCR amplification system was set up as follows:

[0044]

[0045] The PCR products were detected by electrophoresis on a 1.2% agarose gel. The amplified target fragment was approximately 789 bp in size. See the electrophoresis image below. Figure 1The remaining amplification products were sequenced, and the sequencing results were compared and analyzed with relevant pig gene fragment sequences in GenBank using DNAman software to determine the genotype at the rs327638047 locus. Statistical analysis was then performed.

[0046] The effect of genotype on phenotype was analyzed using a general linear model in SAS software. The analysis model was as follows:

[0047] Y ijnk =u i + G j +S n + D k + e jnk

[0048] Where: Y ijnk For the total number of piglets produced; G j S represents the genotype fixation effect of the j-th SNP; n Represents the random effects of mating with boars and the permanent environment; D k The fixed effect representing year, season, and parity; e jnk It represents the residual.

[0049] 5 Results

[0050] Table 1 shows the effect of the rs327638047 locus (T / G) on the total litter size trait in Large White pigs. This locus was identified through genome-wide association analysis (GWAS) in the Liyuan Large White pig population. Significant differences in total litter size were observed between the GG genotype and the TG and TT genotypes (P < 0.05), with GG individuals averaging 0.44 more litters than TT individuals. This was subsequently validated in Minwang Large White pigs, where similar significant differences were observed between the GG and TG genotypes, and between the GG and TT genotypes (P < 0.05), with GG individuals averaging 0.96 more live piglets than TT individuals. Further validation in Large White pigs revealed significant differences between the GG and TG and TT genotypes (P < 0.05), with GG individuals averaging 0.61 more live piglets than TT individuals. In conclusion, targeted breeding of GG individuals at the rs327638047 locus in Large White pig populations can help gradually increase the total number of piglets produced.

[0051] Table 1. Association analysis between the rs335892787 locus on chromosome 1 of pigs and total litter size in Large White pigs.

[0052]

[0053] Note: n is the sample size. Different letters in the number above the sample size indicate significant differences (P<0.05).

[0054] Sequence information of SEQ ID NO: 1 is as follows:

[0055] GAACTGACCACCAGTGTGGGCTGCTCTGCTGATGGGATGAGGCAGCAGGGTTCTGGGTCAAGGTAGCCTTCTATTCTCTTCCGTGGGGAGCAGATTCCATTCTGCATTGATAGCATTAGTCAGCTGTGCGTCTCCAGAGCTCTGGCGGGCTGGCTTCCCTGGAAGGGTATGTGTGGGGAGCCGGGGGCAGTCCTGGTTCACCCAGACCAGAGTGGGATGGTTCCTGGGGACAAAAGACTTTGCTAAAACTGGAACAGTCCTGGGTAAACCAAGGTGAACTGTCACACTATCTTTTTCCTTCCCTCCCCCTCCCTCCATCTGGTTTAACTGTCTGGGGCGGGGGTGGGAGGACAGGGTCAAAAGCTCTTCATTTCTGTGCTCTATGCTTGGGACAGGATGCCAGGCAGGCCAGGCCTTGGAAGKCAATTTGCAGGGACAAGACTCCTGGGTGAGACCAGCTCCAGCCCTCCCCACTCTTCCCACATCCAGTAACGAATTACGATTTGGTTTTGGTGCCCTAGCCCCCAGGCTGGGAGCCTGGCCTCCAATGAAGGTGGTCCTAGGGGCTTGTGGATCAACAGGACCAGGAGGCAGAACCCGTGAGCCCATCCAGTCTCTCCCTGTGACCTTGGGCAGCTCTCTTCCCTTCCCTCTCACCCCAGTCTCCATGCTGTGAAATGGTGGGTTGGGTTTAGAGGGTCTATCAAGATCCTTCCAACTCTCAAAACTGCTGTTTGCACCCACACGGAGGAGAACCCCGACTGCTTCCAAGTGAGCCCTGGAAAGTCT (K is T or G).

Claims

1. A pair of SNP marker primers for chromosome 1 of pigs, associated with the total litter size trait in Large White pigs, characterized in that, The SNP marker is the rs327638047 nucleotide site on chromosome 1 of the pig in the international pig genome version 11.1 reference sequence. This site has T / G polymorphism. The total number of piglets born to sows with the GG genotype at this site is significantly higher than the total number of piglets born to sows with the TG or TT genotypes at this site.

2. The SNP-labeled primer pair according to claim 1, characterized in that, The primer pair sequence is: upstream primer: SEQ ID NO: 2, downstream primer: SEQ ID NO:

3.

3. The application of the SNP marker primer pair as described in claim 1 or 2 in screening high-producing Large White pig populations.

4. The use of the SNP marker primer pair as described in claim 1 or 2 in the preparation of reagents for screening high-yielding Large White pigs.

5. The application of the SNP marker primer pair as described in claim 1 or 2 in the breeding of high-yielding Large White pigs.

6. A method for screening high-producing Large White pig populations, characterized in that, This includes detecting the genotype of the rs327638047 nucleotide site on chromosome 1 of the Large White pig international pig genome version 11.1 reference sequence, and prioritizing the selection of GG-type individuals with the rs327638047 nucleotide site as breeding pigs.

7. The method according to claim 6, characterized in that, Includes the following steps: (1) Extract total DNA from Large White pig tissue samples; (2) Using the extracted porcine genomic DNA as a template, perform PCR amplification using the primer pair described in claim 1 or 2; (3) Sequencing of the amplified product, analysis of the sequencing results, and interpretation of the T / G polymorphism at position 423 of SEQ ID NO: 1.

Images