A lambda-red gene editing system of sphingomonas paucimobilis, a recombination engineering strain and application thereof

Abstract

This invention provides a λ-Red gene editing system for *Sphingosine Monoclonalella*, a recombinant engineered strain, and its applications, belonging to the field of gene function technology. The λ-Red gene editing system for *Sphingosine Monoclonalella* comprises a backbone vector containing the following gene elements: a broad-host replicon, an inducible promoter, and a λ-Red fragment; the λ-Red fragment includes... Exo , Beta and Gam Recombinase gene. This invention also provides a gene editing kit comprising a λ-Red gene editing system and a knock-in fragment. Using the gene editing kit, [the following is described:] ... vgb and / or hmp Gene knock-in into the genome of *Sphingosine monocytogenes* yielded a recombinant engineered strain. This recombinant strain increased gellan gum production and eliminated the need for antibiotics in the production process, producing gellan gum that meets food-grade standards.

Description

Technical Field

[0001] This application belongs to the field of gene function technology and relates to a λ-Red gene editing system for Sphingosine Monoclonalella, a recombinant engineered strain and its application. Background Technology

[0002] Gellan gum is a type of bacteria composed of Sphingosine monocytogenes (SMP). Sphingomonas paucimobilis Water-soluble microbial extracellular polysaccharides synthesized through aerobic fermentation possess excellent properties such as good compatibility, strong stability, low gelation concentration, and high transparency, and are widely used in food, pharmaceutical, and chemical industries. Industrially, this polysaccharide is mostly prepared by aerobic fermentation of *Sphingosine Monoclonalis*, but wild-type strains still face problems such as low yield, insufficient fermentation efficiency, and high production costs in actual fermentation processes. One of the main limiting factors is the obstruction of oxygen transfer in the fermentation system. To address this issue, industrial production often employs methods such as increasing stirring speed, increasing aeration rate, or directly introducing pure oxygen to improve oxygen supply conditions. However, these measures often result in increased energy consumption and costs, and excessively high stirring intensity can generate significant shear forces, adversely affecting cell growth and gelation, thus restricting the economic viability and large-scale application of gellan gum fermentation.

[0003] Starting from the metabolic capacity of bacterial strains, improving the efficiency of cellular oxygen uptake, transport, and utilization through genetic engineering is an effective strategy to alleviate dissolved oxygen limitations in aerobic fermentation and increase gellan gum production. However, existing studies mostly involve overexpressing exogenous genes that increase dissolved oxygen via free plasmids. But this approach requires fermentation under antibiotic conditions to maintain the stability of the recombinant plasmid, which clearly does not comply with food-grade fermentation production standards. Furthermore, it carries a high risk of plasmid loss and significant yield reduction when scaled up for fermentation. Summary of the Invention

[0004] In view of this, the present invention provides a λ-Red gene editing system for Sphingosine monocytogenes, which can integrate the target gene into the genome of Sphingosine monocytogenes at a specific site, thereby eliminating the dependence on antibiotics and enabling the products prepared from Sphingosine monocytogenes to meet food-grade requirements.

[0005] This invention provides a λ-Red gene editing system for Sphingosine Monoclonalella, which is a backbone vector containing the following gene elements: a broad-host replicon, an inducible promoter, and a λ-Red fragment; The λ-Red fragment includes Exo , Beta and Gam Recombinase gene.

[0006] Preferably, the backbone vector includes pRSF1010; the pRSF1010 carries a kanamycin resistance gene; The cloning sites of the gene elements in the backbone vector are Sal I and XhoI.

[0007] Preferably, the nucleotide sequence of the broad-host replicon is shown in SEQ ID NO:1; The inducible promoter includes Ptrc promoter; the Ptrc The promoter nucleotide sequence is shown in SEQ ID NO:2; The nucleotide sequence of the λ-Red fragment is shown in SEQ ID NO:3.

[0008] This invention provides a gene editing kit for increasing the production of gellan gum by Sphingomonas sphingosine monocytogenes, comprising the λ-Red gene editing system and a knock-in fragment or a recombinant vector containing the knock-in fragment; The knock-in fragment includes an upstream homologous arm, a promoter, a knock-in gene, a terminator, a resistance gene, and a downstream homologous arm; The knock-in gene includes vgb and / or hmp Gene.

[0009] Preferably, the length of the upstream or downstream homologous arm includes 300~1200bp; The target genes of the upstream and downstream homologous arms include antimicrobial peptide genes. The resistance gene includes a chloramphenicol resistance gene.

[0010] This invention provides an engineered strain of *Sphingosine monocytogenes* constructed using the aforementioned gene editing kit, wherein the genome of the engineered strain of *Sphingosine monocytogenes* integrates... vgb and / or hmp Gene.

[0011] This invention provides a method for constructing the engineered strain of *Sphingosine Monoclonalella*, comprising the following steps: The λ-Red gene editing system and the knock-in fragment, or the knock-in fragment cloned from a recombinant vector containing the knock-in fragment, were transformed into competent *Sphingomonas* cells. After induction culture, and following antibiotic double selection and removal using the λ-Red gene editing system, a genome containing *Sphingomonas* was obtained. vgb and / or hmp Engineered strains of Sphingosine monocytogenes.

[0012] Preferably, the inducing agent for induction culture includes IPTG; the induction concentration of IPTG is 50~120mM; The induction time for IPTG is 2-6 hours; During the transformation, the ratio of viable cell count of *Sphingosine monocytogenes* competent cells, the mass of the knock-in fragment, and the mass of the λ-Red gene editing system was 1 × 10⁻⁶.9 ~5×10 9 CFU: 1000~2000 ng: 500~1500 ng.

[0013] This invention provides the application of the engineered strain of *Sphingosine Monoclonalella* in the production of gellan gum.

[0014] Preferably, in the production of gellan gum, the fermentation medium of the engineered strain of Sphingosine monocytogenes includes 41.00 g / L glucose, 7.00 g / L soybean meal, 5.00 g / L K2HPO4, 5.00 g / L KH2PO4, and 0.80 g / L MgSO4.

[0015] This invention provides a λ-Red gene editing system for *Sphingosine Monoclonalella*, characterized by a backbone vector containing the following gene elements: a broad-host replicon, an inducible promoter, and a λ-Red fragment; wherein the λ-Red fragment includes... Exo , Beta and Gam Recombinase gene. The λ-Red gene editing system is characterized by high recombination editing efficiency, increasing the number of homologous recombination-positive strains several times over, and low screening cost. Using the λ-Red gene editing system, targeted knock-in into the host strain genome can be achieved, unlike free plasmid expression modes, eliminating the risk of plasmid loss. Furthermore, the target gene is stably propagated along with the chromosome, fermentation requires no antibiotics, and the product meets food-grade standards. Therefore, the λ-Red gene editing system provided by this invention is compatible with *Sphingosine monocytogenes*, solving the problems of poor host compatibility and low recombination efficiency, and enabling stable inheritance of engineered *Sphingosine monocytogenes* strains without antibiotic dependence.

[0016] This invention provides an engineered strain of *Sphingosine monocytogenes* constructed using the aforementioned gene editing kit, wherein the genome of the engineered strain of *Sphingosine monocytogenes* integrates... vgb and / or hmp Genes. This invention directly uses... vgb The plasmid was integrated into the genome of *Sphingosine Monoclonalis* strains, eliminating the need for exogenous plasmid introduction, thus reducing the metabolic and survival stress on the strain, and avoiding the risk of plasmid loss after passage. vgb Cases of gene deletion. hmp Integrating genes into the genome of *Sphingosine Monoclonalis* is beneficial for increasing gellan gum production. This invention, through genetic engineering, enhances the oxygen uptake capacity of engineered strains, reducing reliance on exogenous oxygen supplementation processes. It eliminates the need for energy-intensive stirring, pure oxygen, and exogenous oxygen-carrying reagents, significantly reducing energy consumption and auxiliary material costs. Attached Figure Description

[0017] Figure 1 For recombinant plasmid pRSF1010- Ptrc -λRed's construction flowchart; Figure 2 Electrophoresis image of positive clones verified by PCR amplification, where M: 2k DNA Marker; 1: sterile water; 2-14: plasmids to be verified. Figure 3 For plasmid pBBR1- Ptrc -eGFP sequencing alignment results, where M: 2k DNA Marker; 1: sterile water; 2-18: plasmids to be validated.

[0018] Figure 4 To verify the results of electroporation positive clones using plasmid PCR; Figure 5 The results show the relative expression levels of each gene, where A... gam Relative gene expression level; B. beta Relative gene expression level; C. EXO Relative gene expression levels P <0.05; P <0.01; Figure 6 The results show the effect of different induction times on conversion efficiency; Figure 7 The results show the effect of DNA quantity on transformation efficiency. Figure 8 The results show the effect of homologous arm length on conversion efficiency. Figure 9 The genetic stability of the λ-Red system and PCR validation results; Figure 10 To enter a fragment - vgb Sequencing results; Figure 11 For knock-in strains - vgb Sequencing results; Figure 12 To enter a fragment - hmp Sequencing results; Figure 13 For knock-in strains - hmp Sequencing results; Figure 14 The results show the growth curve of the strain and the determination of residual sugar. Figure 15 The results are for the determination of the gel production of the strain. P <0.05; P <0.01; Figure 16The results of the gellan gum extraction rate determination of the strain are as follows: P <0.05; P <0.01; Figure 17 The results are for the viscosity measurement of the fermentation broth, including: B. Viscosity of the fermentation broth after 24 h of culture; C. Viscosity of the fermentation broth after 48 h of culture; D. Viscosity of the fermentation broth after 72 h of culture. P <0.05, P <0.01; Figure 18 The results show the effect of carbon source type on the production of gellan gum, where A is... S. paucimobilis ( vgb ) strain; B is S. paucimobilis ( hmp ) strain; Figure 19 The effect of glucose addition on the production of gellan gum is shown in Figure A, where A is... S. paucimobilis ( vgb ) strain; B is S. paucimobilis ( hmp ) strain; Figure 20 The results show the effect of nitrogen source type on the production of gellan gum, where A is... S. paucimobilis ( vgb ) strain; B is S. paucimobilis ( hmp ) strain; Figure 21 The results show the effect of soybean meal addition on the production of gellan gum, where A is... S. paucimobilis ( vgb ) strain; B is S. paucimobilis ( hmp ) strain; Figure 22 The results show the effect of K2HPO4 addition on the production of gellan gum, where A is... S. paucimobilis ( vgb ) strain; B is S. paucimobilis ( hmp ) strain; Figure 23 The results show the effect of KH2PO4 addition on the production of gellan gum, where A is... S. paucimobilis ( vgb ) strain; B is S. paucimobilis ( hmp ) strain; Figure 24 The results show the effect of MgSO4 addition on the production of gellan gum, where A is... S. paucimobilis( vgb ) strain; B is S. paucimobilis ( hmp ) strain; Figure 25 Sphingosine monocytogenes (SMP) vgb Response surface methodology results on the effect of interactions among various factors on rubber extraction rate; Figure 26 Sphingosine monocytogenes (SMP) hmp Response surface methodology results on the effect of interactions among various factors on rubber extraction rate; Figure 27 The results of scale-up production in the fermenter are shown in Figure A, which shows the trends of strain and residual sugar content at different fermentation stages, and Figure B shows the gum extraction rate at 24h and 48h of fermentation. Detailed Implementation

[0019] This invention provides a λ-Red gene editing system for *Sphingosine Monoclonalella*, comprising a backbone vector containing the following gene elements: a broad-host replicon, an inducible promoter, and a λ-Red fragment; wherein the λ-Red fragment includes... Exo , Beta and Gam Recombinase gene.

[0020] In this invention, the backbone vector preferably comprises pRSF1010, a circular double-stranded shuttle plasmid. The pRSF1010 preferably carries a kanamycin resistance gene, and kanamycin is used for selection of transformants. The gene elements are inserted into the backbone vector in a tandem manner. The preferred cloning sites of the backbone vector are Sal I and XhoI.

[0021]

[0022] In this invention, the inducible promoter preferably includes Ptrc promoter; the Ptrc The promoter nucleotide sequence is preferably SEQ ID NO:2(cgcaacgcaattaatgtaagttagcgcgaattgatctggtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatcggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggcgcac The Ptrc The promoter is an IPTG-inducible promoter. Under the induction of ITPG, the recombinase genes in the λ-Red fragment are recombinantly expressed to obtain the above three recombinases, which play a role in gene editing.

[0023]

[0024] In this invention, the method for constructing the λ-Red gene editing system of *Sphingosine Monoclonalella* preferably includes the following steps: The promoter fragment was cloned from the pRSF1010-eGFP plasmid; The λ-Red fragment was cloned from pKD46; The promoter fragment, λ-Red fragment, and pRSF1010-eGFP plasmid were digested with SalⅠ and XhoⅠ, respectively, and then ligated to obtain the ligation product. The ligation product was transformed into E. coli, and the positive transformants obtained by screening were the λ-Red gene editing system.

[0025] In this invention, the primers used for promoter fragment cloning preferably include RSF-PF and Red-PR. The primers used for cloning the λ-Red fragment preferably include P-Red-F and RSF-PR. The screening is preferably performed on LB agar plates containing 50 μg / mL KAN. The screening also preferably includes colony PCR verification. The primers used for colony PCR detection preferably include pRSF1010- Ptrc -λRed-YZ-F and pRSF1010- Ptrc -λRed-YZ-R.

[0026] This invention provides a gene editing kit for increasing the production of Clenchologous gel by Sphingomonas sphingosine monocytogenes, comprising the λ-Red gene editing system and a knock-in fragment or a recombinant vector containing the knock-in fragment; the knock-in fragment preferably comprises an upstream homologous arm-promoter-knock-in gene-terminator-resistance gene-downstream homologous arm; the knock-in gene preferably comprises vgb and / or hmp Gene.

[0027] In this invention, the length of the upstream or downstream homologous arm is preferably 300-1200 bp, can be 400-800 bp, or can be 800 bp. The target gene of the upstream and downstream homologous arms preferably includes an antimicrobial peptide gene. The antimicrobial peptide gene is a resistance gene of *Sphingomonas sclerosus*, and is a non-essential gene. Knocking the target gene into the middle of the antimicrobial peptide gene breaks the gene, without affecting the normal growth and gellan gum production of *Sphingomonas sclerosus*. Therefore, the antimicrobial peptide position is selected for the knock-in of the target gene. In an embodiment of this invention, the nucleotide sequence of the upstream homologous arm is as shown in SEQ ID NO:5 (atgaccacgctgctggtggcgattctgctcggcatcgtcgaaggcgtcaccgagttcctgccggtctcgtcga ccggccacctggtcctcgccagcgagctgatgggctatgattcgtcccgctgggcgatgttcaacgtcgtcatccagctgggcgcgatcctggcggtggtggtcctctactggcgcaccttctgggcggtgctcgaagggctgatcaagctgaacccggtgtcgatc cgcttcgtgcgcaacctgctgatcgccttcattcccgccgcggtcatcggtctggcgctccacaagcatatcgaggcgctgctcggcgcacccaaggtggtcgcctgggcactgatcgtcggcggcgtcgcgatcctggtgatcgagcgtctggtcaagtcgg). The nucleotide sequence of the upstream homology arm is such as SEQ IDNO: 6 (ccaccatccacggcatcgctgagattccggtgctacgcgtgatcggcatcggcttcgtccagtgcctcgcgatggtgccgggtgtcagccgttcgg gtgccacgatcatgggcgcgctgtcgttgggcgtcgagcggcgcacggcggccgagttcagcttcttcctcgccatcccgacgatgctcggcgccaccgcgctg gagctggtcaagaaccgcgagatgctgacgaccagcggcgtgggctggggcgagatcggcgtcggcttcgtcgtggccttcatcgttgcgctggcggtgatcaa gtggttcgtgggcattgtgagcaaacatggcttcgcgcccttcgcctggtatcgaatcgttgccggcgcgaccgcgctgatttggctttccatgcgttaa).

[0028] In this invention, the promoter is preferably a phaC promoter. The nucleotide sequence of the phaC promoter is as shown in SEQ ID NO:4 (ttcctcgactttcaagggttcttgtgtgcgacacaaaattgtgtcgtccgcgctttctacg As shown in the diagram (ccataaaggcgcggtcgggaatgacgcattgcttggcctgcgctaaggcggggcaaaggagaggaccga), the phaC promoter is used to initiate the expression of the knock-in gene. The terminator preferably includes amplification along with the target gene.

[0029] In this invention, the vgb The nucleotide sequence is as shown in SEQ ID NO:7 (AAGCTTACAGGACG) As shown in the figure. In this embodiment of the invention, the codon-optimized vgb The nucleotide sequence of the gene is as follows: SEQ ID NO:8 (AAGCTTACAGGACGCTGGGGTTAAAAGTATTTGAG) as shown in TTTTGATGTGGATTAAGTTTTAAGAGGCAATAAAGATTATAATAAGTGCTGCTACACCATACTGATGTATGGCAAGACCATCATCATGAACCTGCGCAAGACCCTGATGCTGGATCAGCAGACCATCAACATCATCAAGGCGACCGTCCCGGTCCTGAAGGAGCATGGCGTCACCATCACCACGACCTTCTATAAGAACCTGTTCGCGAAGCATCCGGAGGTCCGCCCGCTGTTCGACATGGGCCGCCAAGAGTCGCTGGAGCAGCCGAAGGCGCTGGCGATGACCGTCCTGGCGGCCGCGCAGAACATCGAGAACCTGCCGGCGATCCTGCCGGCGGTCAAGAAGATCGCGGTCAAGCATTGCCAAGCGGGCGTCGCGGCCGCGCATTATCCGATCGTCGGCCAAGAGCTGCTGGGCGCGATCAAAGAGGTCCTGGGCGACGCGGCGACCGACGACATCCTGGACGCGTGGGGCAAGGCGTATGGCGTCATCGCGGACGTCTTCATCCAAGTCGAGGCGGACCTGTATGCGCAAGCGGTCGAGTGAAGTTTCAGGCCGCTTTCAGGACATAAAAAACGCACCATAAGGTGGTCTTTTTACGTCTGATATTTACACAGCAGTTTGGCTGTTGCCAAAACTTGGGACAAATATTG). The hmp nucleotide sequence of the gene is as set forth in SEQ ID NO:9 (CTGTTCCCAGCCGTTCCC hmp The nucleotide sequence of the gene is as shown in SEQ ID NO:10 (CTGTTCCCGGCGGTCCCGTCGCGCTCGCAAGACGA) CATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATACCTAGG).

[0030] In this invention, the resistance gene preferably includes a chloramphenicol resistance gene, with a nucleotide sequence such as SEQ ID NO:12 (TGATCGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAATAAG). As shown in the figure. The chloramphenicol resistance gene is used to screen whether the knock-in gene has been successfully transformed into the host cell.

[0031] In this invention, the method for constructing the recombinant vector containing the knock-in fragment preferably includes the following steps: Upstream homologous arms and promoters are used to obtain upstream homologous arm-promoter fragments (up-phaC) through seamless cloning technology. The upstream homologous arm-promoter fragment and the knock-in gene fragment are seamlessly cloned to obtain the upstream homologous arm-promoter fragment-target gene-terminator (up-phaC-knock-in gene-ter). The downstream homologous arm and the resistance gene were used to obtain the resistance gene-down homologous arm fragment (CHL-down fragment) through seamless cloning technology. The linearized plasmid, upstream homologous arm-promoter fragment-target gene-terminator, and resistance gene-downstream homologous arm fragment were seamlessly cloned, and the resulting ligation product was transformed into *E. coli*. E. coli Among the Top 10 competent cells, the positive transformants obtained after screening and verification were recombinant vectors containing knock-in fragments.

[0032] In this invention, both the upstream and downstream homologous arms use the genome of *Sphingomonas sphingosine monocytogenes* strain as a template. The upstream homologous arm is amplified using up-F and up-R primer pairs, and the downstream homologous arm is amplified using down-F and down-R primer pairs. The promoter is preferably amplified using the genome of *Sphingomonas sphingosine monocytogenes* strain as a template, with primers phaC-F and phaC-R. The chloramphenicol resistance fragment is amplified using plasmid pBBR1-Ptac-dCas9 as a template and primers CHL-F and CHL-R. The knock-in gene fragments are synthesized by a company and codon optimized. In this embodiment of the invention, to obtain a suitable material for overlap PCR... vgb The segment was designed vgb -F / R primers are used for amplification. vgb Genes, among which vgb -F contains a homologous segment to the phaC promoter. vgb -R contains a sequence homologous to the chloramphenicol fragment. hmp The amplification method for the gene fragment is the same as above. Preferably, the linear vector uses plasmid pK18-eGFP-KAN as a template and pK18-F and pK18-R as primers to amplify the linearized vector fragment. In this embodiment of the invention, the recombinant vector containing the knock-in fragment is denoted as pk18-knockout-. vgb / hmp -CHL.

[0033] In this invention, the method for obtaining the knock-in fragment from a recombinant vector containing the knock-in fragment is preferably to prepare the plasmid pk18-knockout fragment as described above. vgb / hmp Using -CHL as a template and up-F and down-R as primers, the knock-in fragment was amplified by PCR.

[0034] This invention provides an engineered strain of *Sphingosine monocytogenes* constructed using the aforementioned gene editing kit, wherein the genome of the engineered strain of *Sphingosine monocytogenes* integrates... vgb and / or hmp Gene.

[0035] In this invention, the method for constructing the engineered strain of *Sphingosine Monoclonalella* includes the following steps: The λ-Red gene editing system and the knock-in fragment were simultaneously or stepwise transformed into competent cells of *Sphingosine Monoclonalella*. After IPTG induction and culture followed by double antibiotic culture, the positive transformants obtained were verified to be engineered strains of *Sphingosine Monoclonalella*.

[0036] In this invention, when the λ-Red gene editing system and the knock-in fragment are transformed into Sphingomonas competent cells in steps, it is preferable to first transform the λ-Red gene editing system into Sphingomonas competent cells, then induce recombinase expression by IPTG induction culture, and then transform the knock-in fragment. After double-antibiotic culture, positive transformants are obtained. After removing the λ-Red gene editing system, an engineered Sphingomonas strain is obtained.

[0037] The present invention does not impose any particular limitation on the transformation method; any transformation method well known in the art can be used, such as electroconversion. In one embodiment of the present invention, an engineered strain of *Sphingosine Monoclonalella* is constructed using electroconversion.

[0038] In this invention, the inducing agent for induction culture preferably includes IPTG; the induction concentration of IPTG is preferably 50mM~120mM, and can be 80mM~100mM. The induction time of IPTG is 2~6h, can be 3~5h, and can also be 4h.

[0039] In one embodiment of the present invention, the induction time and concentration were optimized during the IPTG induction culture. The results showed that induction for 3-5 hours was beneficial to improving the transformation efficiency compared to 2 hours, especially 4 hours, when the transformation efficiency was the highest. IPTG induction concentrations were set at gradients of 0 mM, 0.2 mM, 1 mM, 10 mM, 50 mM, 100 mM, and 200 mM. The results showed that IPTG concentrations within the range of 0.2 mM-100 mM could induce transformation in the λ-Red system. gam , beta , EXO Gene expression enables gene editing; when the IPTG concentration is 50mM-100mM, the transcription level of the target gene is high, resulting in optimal gene editing transformation efficiency; when the IPTG concentration is 100mM, gam , beta , EXO Gene expression levels reach their peak; when the IPTG concentration reaches 200 mM, it will produce cytotoxicity to Sphingosine monocytogenes, inhibiting bacterial growth and causing a decrease in editing efficiency.

[0040] In this invention, during the transformation, the preferred ratio of the viable count of *Sphingosine monocytogenes* competent cells, the mass of the knock-in fragment, and the mass of the λ-Red gene editing system is 1 × 10⁻⁶. 9 ~5×10 9CFU: 1000~2000 ng: 500~1500 ng.

[0041] In another embodiment of the present invention, the amount of knock-in fragment was optimized during click transformation. With 100 μL of competent cells, 500-2000 ng of knock-in gene fragment was used for optimization. The results showed that compared with 500 ng of knock-in gene, 1000-2000 ng of knock-in gene was beneficial to improve transformation efficiency, and the transformation efficiency was best under the condition of 1500 ng of knock-in gene.

[0042] In another embodiment of the present invention, in order to further improve the transformation efficiency, the homologous arm length of the knock-in gene was optimized. The knock-in gene fragment was constructed using homologous arms of 400 bp and 800 bp, respectively. The results showed that with a homologous arm of 800 bp, the average number of transformants obtained was 1643, and with a homologous arm of 400 bp, the average number of transformants obtained was 1290. Therefore, when knocking in the dissolved oxygen gene fragment, setting the homologous arm length to 800 bp resulted in higher transformation efficiency.

[0043] In this invention, the method for removing the λ-Red gene editing system is preferably achieved by continuous passage culture under antibiotic-free pressure to achieve spontaneous plasmid loss.

[0044] This invention provides a method for constructing the engineered strain of *Sphingosine Monoclonalella*, comprising the following steps: The λ-Red gene editing system and the knock-in fragment, or the knock-in fragment cloned from a recombinant vector containing the knock-in fragment, were transformed into competent *Sphingomonas* cells. After induction culture, and following antibiotic double selection and removal using the λ-Red gene editing system, a genome containing *Sphingomonas* was obtained. vgb and / or hmp Engineered strains of Sphingosine monocytogenes.

[0045] In this invention, the genome of the engineered strain of *Sphingosine monocytogenes* is integrated with... vgb and / or hmp Genes, overexpressed through genetic engineering. vgb and / or hmp By improving the efficiency of oxygen uptake, transport, and utilization by the strain, the gene eliminates antibiotic dependence, enables large-scale fermentation, and increases gellan gum production.

[0046] In one embodiment of the present invention, the genome is integrated with vgb or hmp OD of engineered strains of Sphingosine monocytogenes 600The values ​​were slightly higher than those of the wild-type strain. Regarding gellan gum production and extraction rate, both engineered strains exhibited recombinant expression of dissolved oxygen genes in their genomes, resulting in higher dissolved oxygen levels. After 48 hours of cultivation, the gellan gum production of both strains was significantly higher than that of the wild-type strain. As for the effect on fermentation broth viscosity, the fermentation broth obtained from the engineered strains after 48 hours of cultivation was higher than that from the wild-type strain. At 24 hours of cultivation, the genome integrated with… vg The fermentation broth viscosity of the engineered strain of *Sphingosine Monoclonalella* was significantly higher than that of the wild-type strain, and the dual genome integrated with... hmp This change was not observed in the engineered strain of Sphingosine Monoclonalella of the gene.

[0047] This invention provides the application of the engineered strain of *Sphingosine Monoclonalella* in the production of gellan gum.

[0048] In this invention, during the production of gellan gum, the fermentation medium of the engineered strain of *Sphingosine monocytogenes* preferably comprises 41.00 g / L glucose, 7.00 g / L nitrogen source, 5.00 g / L K₂HPO₄, 5.00 g / L KH₂PO₄, and 0.80 g / L MgSO₄. The nitrogen source includes at least one of the following: soybean meal, corn steep liquor, and soybean flour.

[0049] In this invention, to further optimize the yield of gellan gum, the types and contents of each component in the suitable fermentation medium for the engineered strain were optimized, and response surface methodology was performed on the single-factor optimization results. The results showed that, for the carbon source, the recombinant strain ( vgb ) and recombinant strains ( hmp The optimal carbon source is glucose, which is superior to sucrose, fructose, lactose, and soluble starch in terms of gum production and fermentation broth viscosity. For nitrogen source, recombinant strains ( vgb ) and recombinant strains ( hmpThe optimal nitrogen source was soybean meal. Compared with yeast powder, yeast extract, and yeast peptone, soybean meal, corn steep liquor, and soybean flour all showed significant improvements in gum production rate and fermentation broth viscosity, with soybean meal showing the best effect. Regarding the optimization of inorganic salt addition, when the K₂HPO₄ addition was 1.00-5.00 g / L, the fermentation broth viscosity and gum extraction rate increased with increasing concentration, reaching a peak at 5.00 g / L. The KH₂PO₄ concentration also peaked at 5.00 g / L, showing a slight decrease beyond 5.00 g / L, thus determining the optimal addition amount as 5.00 g / L. The fermentation broth viscosity and gum extraction rate peaked at a MgSO₄ concentration of 0.80 g / L, showing a decreasing trend beyond 0.80 g / L. Response surface methodology analysis showed that a good gum extraction rate was obtained after culturing in the fermentation medium (glucose 41.00 g / L, soybean meal 7.00 g / L, K₂HPO₄ 5.00 g / L, KH₂PO₄ 5.00 g / L, and MgSO₄ 0.80 g / L) for 72 h. When scaled up production in a fermenter, after 48 h of fermentation, the engineered strain (…)… vgb The gellan gum extraction rate was 0.84±0.09%, and the residual sugar content was 12.75 g / L; the engineered strain ( hmp The gellan gum extraction rate was 0.81 ± 0.04%, and the residual sugar content was 13.36 g / L. Compared with before cultivation and optimization, the gellan gum extraction rate increased by 24.00% and 23.60% respectively after 48 h of cultivation.

[0050] The following detailed description, in conjunction with embodiments, illustrates the λ-Red gene editing system, recombinant engineered strain, and applications of Sphingosine Monoclonalella provided by this invention. However, these descriptions should not be construed as limiting the scope of protection of this invention.

[0051] The primers and sequences involved in the embodiments of this invention are shown in Table 1.

[0052] Table 1 Primer names and sequences

[0053] Example 1 Construction of the λ-Red homologous recombination system in Sphingosine monocytogenes 1. Experimental Methods: 1.1 Construction of the λ-Red homologous recombination system plasmid pRSF1010- Ptrc -λRed Use restriction endonucleases Sal I and XhoI. Double digestion of plasmid pRSF1010-eGFP (purchased from Shanghai Linyuan Biotechnology Co., Ltd.) yielded the vector backbone fragment. Using pRSF1010-eGFP as a template, primers RSF-PF / Red-PR were designed for amplification. Ptrc Promoter fragment; primer sequences are shown in Table 1. Using plasmid pKD46 as a template, primers P-Red-F / RSF-PR were designed to amplify the λ-Red recombinase gene ( exo, beta, gam (Fragment); primer sequences are shown in Table 1. For example... Figure 1 As shown, the three fragments were ligated using seamless cloning to form the recombinant plasmid pRSF1010- Ptrc -λRed.

[0054] 1.1.1 Obtaining the Carrier Skeleton Fragment The *E. coli* containing plasmid pRSF1010-eGFP were activated and cultured, and the plasmid was extracted using the OMEGA FastPurePlasmid Mini Kit. For details, please refer to the instruction manual.

[0055] The plasmid pRSF1010-eGFP was digested with Sal I / Xho I using the following enzyme digestion system: 21.5 μl pRSF1010-eGFP, 0.5 μl Sal I, 0.5 μl Xho I, 2.5 μl rCutsmart Buffer, and ddH2O to a final volume of 25 μl. For detailed digestion procedures, please refer to the manufacturer's instructions. After gel electrophoresis, the digested products were excised and recovered using the OMEGA Gel Extraction Kit; please refer to the kit's instructions for specific procedures.

[0056] 1.1.2 Obtaining the promoter fragment When using seamless cloning to ligate fragments, the 5' end of the primers should contain a 10-18 bp sequence at the ligation site of the fragment to be ligated. To obtain the promoter fragment, plasmid pRSF1010-eGFP is used as a template for PCR amplification.

[0057] The PCR reaction mixture was as follows: pRSF1010-eGFP 2 μL, RSF-PF 1 μL, Red-PR 1 μL, 2×XeroxMix 25 μL, and ddH2O to a final volume of 50 μL. The reaction procedure was as per the instructions for the Biomed 2×Xerox Mix high-fidelity enzyme, with an annealing temperature set to 56℃. After verification by agarose gel electrophoresis, the correct bands were excised and recovered using the OMEGA Gel Extraction Kit; the specific procedure was described in the kit's instructions.

[0058] 1.1.3 Obtaining the λ-Red fragment Using plasmid pKD46 as a template, primers were designed to amplify the λ-Red fragment. When designing the primers, a sequence (10-18 bp) connecting to the promoter fragment was added to the 5' end of the upstream primer. A sequence (10-18 bp) connecting to the RSF1010 backbone fragment was added to the 5' end of the downstream primer. The PCR reaction mixture was as follows: pKD46 2 μL, p-Red-F 1 μL, RSF-PR 1 μL, 2×Xerox Mix 25 μL, and ddH2O to a final volume of 50 μL. The reaction procedure was as per the instructions for the 2×Xerox Mix high-fidelity enzyme from the Biomed kit, which set the annealing temperature to 56℃. After verification by agarose gel electrophoresis, the correct bands were excised and recovered using the OMEGA Gel Extraction Kit; the specific procedure was as per the kit's instructions.

[0059] 1.1.4 Plasmid pRSF1010- Ptrc Construction of -λRed Seamless cloning was performed using the following reaction mixture: 1 μL RSF1010 backbone, 2 μL promoter fragment, 1 μL λ-Red fragment, 5 μL 2×Seamless Cloning Mix, and ddH2O to a final volume of 10 μL. To obtain pRSF1010- Ptrc -λRed plasmid, and ligate the above three fragments using a seamless cloning enzyme.

[0060] 1.1.5 Chemical transformation of the ligation product into Escherichia coli (E. coli) E. coli Top 10 (1) Place the Escherichia coli Top10 competent cells stored at -80℃ on ice to thaw, gently stir the bottom of the centrifuge tube to mix, and add the ligation product into the centrifuge tube; (2) Gently tap the bottom of the centrifuge tube to mix, then incubate on ice for 30 min; (3) Heat shock at 42℃ for 1 min 30 s; (4) Quickly remove the centrifuge tubes and place them in an ice bath for 2 minutes; (5) Add 700 µL of preheated LB medium to the centrifuge tube and revive and incubate at 37°C and 160-225 rpm for 1 h; (6) After recovery, centrifuge at 4000 rpm for 1 min, retain about 100 µL of supernatant, rinse and mix well, and then take 100 µL and spread it on an LB solid plate containing 50 μg / mL KAN. (7) Incubate overnight at 37°C with the container upside down.

[0061] 1.1.6 Verification of Connection Results (1) Colony PCR: Single colonies growing on the surface of LB / KAN plates were picked and prepared into bacterial suspensions. The reaction system was as follows: 1 μL of bacterial suspension, pRSF1010- Ptrc -λRed-YZ-F 0.5 μL, pRSF1010- Ptrc 0.5 μL of -λRed-YZ-R and 10 μL of 2×TaqPCR Master Mix were added, with ddH2O added to bring the total volume to 10 μL. The reaction procedure was as follows (refer to the Biomed 2×Taq PCR MasterMix), with the annealing temperature set to 58℃. After verifying the PCR products by agarose gel electrophoresis, the bacterial suspension with the correct band was incubated overnight at 37℃.

[0062] (2) Plasmid PCR: Plasmids were extracted using the OMEGA Plasmid Mini Kit and PCR reaction was performed for further verification.

[0063] (3) Sequencing verification: The extracted plasmid was sent to Genewiz for sequencing using a template. The sequencing primers were pRSF1010- Ptrc -λRed-YZ-F and pRSF1010- Ptrc -λRed-YZ-R sequencing results were analyzed using DNAMAN software.

[0064] 1.2 Construction of recombinant sphingosine monocytogenes (pRSF1010- Ptrc -λRed) 1.2.1 Sphingosine monocytogenes (SMP) S. paucimobilis Preparation of ATCC 31461 competent cells (1) Select a single colony of Sphingosine monocytogenes and inoculate it into YM liquid medium. Incubate at 30°C and 180 rpm for 16 h.

[0065] (2) The next day, 300 μL of bacterial culture was added to an Erlenmeyer flask containing 30 mL of seed culture medium. Under the same culture conditions, the culture was carried out until the logarithmic phase. 600 It is approximately 0.55.

[0066] (3) Collect the bacterial culture into a centrifuge tube in a sterile laminar flow hood, centrifuge at 4℃ and 8000 rpm for 10 min, discard the supernatant and collect the cells; (4) Resuspend the cells three times with pre-cooled electroporation buffer, and finally add 100 μL of electroporation buffer and mix well. Store competent cells at -80℃.

[0067] 1.2.2 Recombinant plasmid pBBR1- Ptrc -eGFP electroporation of at least *Sphingosine monocytogenes* ATCC 31461 According to the electric shock intensity of 1.25 kV / mm and the pulse duration of 4 ms, 1000 ng of plasmid pBBR1- Ptrc -eGFP electroporation to 1×10 9 CFU-positive *Sphingomonas sphingosine monocytogenes* ATCC 31461 competent cells were electroporated. After electroporation, 1 mL of seed culture medium was added to the electroporation vessel and mixed thoroughly by pipetting. The entire bacterial culture was then transferred to a centrifuge tube and cultured at 30°C and 180 rpm for 2 h with shaking. After revival, 100 μL of the bacterial culture was spread onto YM solid medium containing 50 μg / mL KAN and cultured at 30°C for 72 h. The Giardia lamblia positive strain *Sphingomonas sphingosine monocytogenes* (pRSF1010-) was then obtained. Ptrc Verification of -λRed).

[0068] Since sequencing verification has already been performed during plasmid construction, sequencing verification will not be performed in this step.

[0069] 1.3 Determination of expression levels in the λ-Red homologous recombination system The successfully constructed strain *Sphingosine monocytogenes* (pRSF1010-) Ptrc -λRed) was inoculated into YM medium containing 50 μg / mL KAN and cultured at 30°C with shaking for 6 h. An inducer (IPTG) was then added at different concentrations: 0 mM, 0.2 mM, 1 mM, 10 mM, 50 mM, 100 mM, and 200 mM. After adding the inducer, the culture was continued until the stationary phase, and total bacterial RNA was extracted.

[0070] 1.3.1 Extraction of total bacterial RNA Use the bioengineered bacteria total RNA extraction kit; see the instruction manual for the procedure.

[0071] 1.3.2 Reverse transcription reaction Reverse transcription was performed using Novizan's HiScript III RT SuperMix for qPCR (+gDNA wiper). Refer to the instruction manual for detailed procedures.

[0072] 1.3.3 Real-time quantitative PCR Using the 16S rRNA of *Sphingomonas pRSF1010-* as an internal reference gene, different concentrations of inducer were used to induce *Sphingomonas pRSF1010-* PtrcRelative quantification was performed using λRed. The reaction mixture was as follows: 10 μL of 2×Green qPCRMasterMix, 1 μg of template RNA, 0.5 μL of RT-gam-F / RT-beta-F / RT-exo-F, 0.5 μL of RT-gam-R / RT-beta-R / RT-exo-R, and RNase-free ddH2O to a final volume of 20 μL. Primer sequences are shown in Table 1.

[0073] Reaction procedure: Pre-denaturation at 95℃ for 3 min; 95℃ for 10 s, 60℃ for 30 s, repeating these two steps 40 times; melting curve analysis. Each sample was subjected to three technical replicates. The gene expression level of the sample with an inducer concentration of 0 mM was defined as 1, and the expression levels of the other samples were calculated accordingly. (-ΔΔCt) The value represents the relative expression level of samples with different concentrations of inducer. Results are expressed as mean ± standard error (mean ± SEM) of three parallel replicates. Differences between groups were analyzed using a t-test. express P <0.05, express P <0.01.

[0074] 1.4 Investigation into the optimal recombination conditions of the λ-Red system First, construct the knock-in fragment -eGFP to explore recombination conditions. Once the conditions are determined, then perform the knock-in. vgb and hmp Gene.

[0075] 1.4.1 PCR amplification of each recombinant fragment The target gene was knocked into the middle of the antimicrobial peptide gene in the genome of *Sphingomonas sphingosine monocytogenes*. The antimicrobial peptide is a resistance gene in *Sphingomonas sphingosine monocytogenes* and is a non-essential gene. Knocking the target gene into the middle of the antimicrobial peptide gene breaks the gene segment without affecting the normal growth and gellan gum production of *Sphingomonas sphingosine monocytogenes*. Therefore, the antimicrobial peptide gene was selected for knock-in. The antimicrobial peptide gene in the genome is 807 bp. Different homologous arm lengths were set: 400 bp and 800 bp. Taking the 400 bp homologous arm as an example, the knock-in fragment includes amplification of the upstream homologous arm, ... phaC promoter, eGFP The fragments, terminator fragment, chloramphenicol resistance fragment, and downstream homologous arm were ligated using a combination of overlap PCR and seamless cloning.

[0076] To obtain fragments suitable for overlap PCR, primer design requires the 5' ends of both upstream and downstream primers to contain 10-18 bp complementary sequences of the adjacent fragment. Using the genome as a template, upstream and downstream homologous arms are amplified using up-F, up-R, and down-F, down-R primers; using the genome as a template, phaC-F and phaC-R primers are amplified... phaC Promoter fragment; using plasmid pRSF1010-eGFP as a template, the eGFP-ter fragment was amplified using eGFP-F and ter-R primers, respectively; using plasmid pBBR1-Ptac-dCas9 as a template, the chloramphenicol resistance fragment was amplified using CHL-F and CHL-R primers. The primer sequences involved are shown in Table 1.

[0077] The PCR system and procedure were described in the instructions for the Biomed 2×Xerox Mix high-fidelity enzyme, with the annealing temperature set to 56 ℃. The PCR products were verified by agarose gel electrophoresis; correct bands were then excised and recovered using the OMEGAGel Extraction Kit. For detailed procedures, please refer to the kit's instructions.

[0078] 1.4.2 Recombinant Fragment PCR Fusion (1) Connection between upstream homologous arm and promoter The PCR reaction system is as follows: 2 μL of upstream homologous arm, PhaC Add 2 μL of 2×Xerox Mix and 25 μL of ddH2O to a final volume of 50 μL. Refer to the Bomeide 2×Xerox Mix high-fidelity enzyme manual for the reaction procedure, setting the annealing temperature to 56 ℃ and the number of cycles to 10. Add 2 μL each of primers up-F and phaC-R. Refer to the Bomeide 2×Xerox Mix high-fidelity enzyme manual for the reaction procedure, setting the annealing temperature to 56 ℃ and the number of cycles to 35. Verify the PCR product using agarose gel electrophoresis. Use the OMEGA Gel Extraction Kit, correctly excising and recovering the bands from the gel; refer to the kit manual for specific procedures to obtain the up-phaC fragment.

[0079] (2) Downstream homologous arm and chloramphenicol fragment ligation The method is the same as 1.4.2(1), to obtain the CHL-down segment.

[0080] (3) Fragment up-phaC linked to eGFP-ter The same method as 1.4.2(1) was used to obtain the up-phaC-eGFP-ter fragment.

[0081] (4) PCR to obtain the pK18 backbone fragment Using plasmid pK18-eGFP-KAN as a template, the backbone fragment was amplified using pK18-F and pK18-R primers. The PCR system and procedure were described in the instructions for the Biomed 2×Xerox Mix high-fidelity enzyme, with the annealing temperature set to 56 ℃. The PCR products were verified by agarose gel electrophoresis, and the correct bands were excised and recovered using the OMEGA Gel Extraction Kit. The specific procedure was described in the kit's instructions.

[0082] (5) Seamless cloning and construction of plasmid pk18-knockout fragment-eGFP-CHL To obtain the pk18-knockout fragment-eGFP-CHL plasmid, the above three fragments were ligated using a seamless cloning enzyme: 1 μL pK18 backbone, 1 μL up-phaC-eGFP-ter, 1 μL CHL-down, 5 μL 2×Seamless Cloning Mix, and ddH2O was added to bring the total to 10 μL.

[0083] 1.4.3 Chemical conversion of the linking product to E. coli Top 10.

[0084] The experimental method is the same as in 1.1.5.

[0085] 1.4.4 Verification of Connection Results (1) Colony PCR: Single colonies growing on the surface of LB / KAN plates were picked and prepared into a bacterial suspension. The reaction system was as follows: 1 μL bacterial suspension, 0.5 μL pk18-knock-eGFP-CHL-YZ-F, 0.5 μL pk18-knock-eGFP-CHL-YZ-R, 10 μL 2×TaqPCR Master Mix, and ddH2O was added to 20 μL. The reaction procedure was as follows (refer to the Biomed 2×Taq PCR MasterMix), and the annealing temperature was set to 58 ℃. If the PCR product was verified to be correct by agarose gel electrophoresis, the corresponding bacterial suspension was incubated overnight at 37℃.

[0086] (2) Plasmid PCR: Plasmids were extracted using the OMEGA Plasmid Mini Kit and PCR reaction was performed for further verification.

[0087] (3) Sequencing verification: The extracted plasmid was sent to Genewiz for sequencing. The sequencing primers were pk18-knock-in-eGFP-CHL-YZ-F and pk18-knock-in-eGFP-CHL-YZ-R. The sequencing results were analyzed using DNAMAN software.

[0088] 1.4.5 Obtaining the knock-in fragment - eGFP Using plasmid pk18-knockout fragment-eGFP-CHL as a template, and up-F and down-R as primers, the knock-in fragment-eGFP was amplified by PCR. The PCR reaction system was as follows: 2 μL pk18-knockout fragment-eGFP-CHL, 1 μL up-F, 1 μL down-R, 25 μL 2×Xerox Mix, and ddH2O to a final volume of 50 μL. The PCR system and procedure were described in the instructions for the 2×Xerox Mix high-fidelity enzyme from the Biomed kit, where the annealing temperature was set to 56℃. The PCR products were verified by agarose gel electrophoresis. Correct bands were excised and recovered using the OMEGA Gel Extraction Kit; the specific procedure was described in the kit's instructions.

[0089] 1.4.6 Electroporation knock-in of eGFP fragment After optimizing the induction conditions, 100 mmol / L IPTG was used to induce Sphingosine monocytogenes (pRSF1010-) Ptrc -λRed) is optimal. To prepare competent cells of this strain, the knock-in fragment -eGFP is introduced into *Sphingosine monocytogenes* (pRSF1010-). Ptrc In -λRed), specifically, 100 μL of competent cells (1 × 10⁻⁶) are added. 9 Add 1500 ng of the knock-in fragment -eGFP to CFU, gently mix, and transfer to an electroporation cuvette. Following the aforementioned electroporation conditions, after electroporation, add 1 mL of seed culture medium to the cuvette, mix by pipetting, and transfer all bacterial culture from the cuvette to a centrifuge tube. Incubate at 30℃ and 180 rpm for 2 hours with shaking. After incubation, spread an appropriate amount of bacterial culture onto a YM double-antibody plate containing 50 μg / mL KAN and 15 μg / mL CHL, and incubate at 30℃ for 72 hours. Pick single colonies from the plate for colony PCR identification. The PCR reaction system is as follows: 1 μL bacterial suspension, 0.5 μL knock-in -eGFP-YZ-F, 0.5 μL knock-in -eGFP-YZ-R, 10 μL 2×Taq PCR Master Mix, and ddH2O to a final volume of 20 μL. The reaction procedure is as follows (refer to the Bomeide 2×Taq PCR Master Mix), with an annealing temperature of 58℃. If the PCR product is verified to be correct by agarose gel electrophoresis, the corresponding bacterial suspension should be incubated overnight at 37°C.

[0090] (2) Genomic PCR verification. Genomic DNA was extracted using the Bomeid bacterial genome extraction kit. The specific procedure was followed by a PCR reaction for further verification.

[0091] (3) Sequencing verification: The extracted plasmid was sent to Genewiz for sequencing. The sequencing primers were knock-in-eGFP-YZ-F and knock-in-eGFP-YZ-R. The sequencing results were analyzed using DNAMAN software.

[0092] 1.4.7 Exploration of Optimal Recombination Conditions (1) Change the induction time of the inducer (IPTG) After inoculating *Sphingomonas sphingosine monocytogenes* (eGFP) seed culture into YM medium and culturing for 6 h, an inducer was added. This is because the inducer is toxic to bacterial growth, and adding it too early can easily affect cell growth. Induction times were set at 2 h, 3 h, 4 h, and 5 h after the inducer was added. After the induction time, competent cells were prepared, and the knock-in fragment -eGFP was electroporated. The cells were then plated on solid plates containing 50 μg / mL KAN and 15 μg / mL CHL antibiotics. Transformants were counted and recorded to characterize recombination efficiency.

[0093] (2) Effect of inducer concentration on homologous recombination efficiency The concentration of the inducer has a significant impact on recombination efficiency. Sphingosine monocytogenes (eGFP) was induced with 0.2 mM IPTG, 1 mM IPTG, 10 mM IPTG, 50 mM IPTG, and 100 mM IPTG, respectively. The knock-in fragment -eGFP was electroporated and plated on solid plates containing 50 μg / mL KAN and 15 μg / mL CHL antibiotics. The transformants were counted and recorded to characterize the recombination efficiency.

[0094] (3) Change the amount of electroporated DNA After preparing competent cells, 250 ng, 500 ng, 1000 ng, 1500 ng, and 2000 ng of the knock-in fragment-eGFP were electroporated into 100 μL of IPTG-induced Sphingosine Monoclonal antibodies (pRSF1010-). Ptrc -λRed) competent cells (1×10 9 Transformants were plated on solid agar plates containing 50 μg / mL KAN and 15 μg / mL CHL antibiotics (CFU), and the transformants were counted and recorded to characterize the recombination efficiency.

[0095] (4) Change the length of the same arm When designing the knock-in fragment -eGFP, 400 bp homologous arms and 800 bp homologous arms were added to both sides of the eGFP gene, respectively. The effects of different homologous arm lengths on homologous recombination efficiency were compared. Transformants were counted and recorded to characterize recombination efficiency.

[0096] 1.5 Determining the genetic stability of the λ-Red homologous recombination system Sphingosine monocytogenes strain containing the λ-Red homologous recombination system (pRSF1010-) Ptrc The genetic stability of the λ-Red homologous recombination system was assessed using a continuous passaging experiment. The experimental method followed that of Shin et al. Human method (Shin et al., 2017). The strain *Sphingosine monocytogenes* (pRSF1010-) was used. Ptrc -λRed) were continuously passaged in YM liquid medium containing KAN and in liquid medium without antibiotics.

[0097] 2. Experimental Results: 2.1 λ-Red homologous recombination system plasmid pRSF1010- Ptrc Construction of -λRed (1) The RSF1010 backbone, promoter fragment, and λ-Red fragment ligation product were converted to... E. coli Top 10 competent cells were collected the following day, and colonies were picked from LB agar plates containing 50 μg / mL KAN. Colony PCR verification was performed, followed by shaking and plasmid extraction. pRSF1010- Ptrc PCR was performed using primers -λRed-YZ-F / R, with a target fragment size of 1074 bp. The PCR products were then subjected to agarose gel electrophoresis, and the results are as follows: Figure 2 As shown: Lane 1 is a sterile water negative control, lanes 2-14 are PCR products, and the band sizes obtained in lanes 11-14 are consistent with expectations.

[0098] (2) Select two plasmids with correct bands, using pRSF1010- Ptrc -λRed-YZ-F and pRSF1010- Ptrc -λRed-YZ-R was used as the sequencing primer for single-item sequencing. The sequencing results were compared using DNAMAN software, and the results are as follows: Figure 3 As shown, the recombinant plasmid pRSF1010- Ptrc -λRed was successfully built.

[0099] 2. Experimental strain: *Sphingosine monocytogenes* (pRSF1010- Ptrc Construction of -λRed) Using the plasmid extracted in 1.2.2 as a template, pRSF1010- Ptrc -λRed-YZ-F and pRSF1010- PtrcUsing primers -λRed-YZ-R, partial RSF1010 backbone, partial λ-Red fragment, and the entire promoter fragment were amplified. The PCR products were verified by electrophoresis. The results are as follows: Figure 4 As shown.

[0100] 3. Determination of expression levels of functional proteins in the λ-Red homologous recombination system The recombinant strain *Sphingosine monocytogenes* (pRSF1010-) was detected by RT-qPCR. Ptrc -λRed)) When adding different concentrations of inducer (IPTG) gam, beta, exo The relative expression levels of the three genes were determined at inducer concentrations of 0 mM, 0.2 mM, 1 mM, 10 mM, 50 mM, 100 mM, and 200 mM, respectively. Results are expressed as mean ± standard error (mean ± SEM) of three parallel replicates. Differences between groups were analyzed using a t-test. express P <0.05, express P <0.01.

[0101] The results are as follows Figure 5 As shown, gam, beta, exo The fluorescence data of the three genes showed a similar pattern: from 0.2 to 100 mM IPTG, the quantitative fluorescence value gradually increased with increasing inducer concentration; at 200 mM IPTG, the quantitative fluorescence value was lower than that at 100 mM IPTG, consistent with the results of the unit fluorescence intensity determination in Chapter 2. Therefore, 100 mM IPTG was selected to induce the functional genes of the λ-Red recombination system. gam, beta, exo The expression of ).

[0102] 4. Exploration of optimal recombination conditions in the λ-Red system (1) Determine the induction time and concentration of the inducing agent (IPTG). Transformants on solid plates containing 50 μg / mL KAN and 15 μg / mL CHL antibiotics were counted and recorded to prepare a sample. Figure 6 The bar chart. (From...) Figure 6It was found that the recombination efficiency was highest at an induction time of 4 h, with an average of 852 transformants. The number of transformants was less than at 5 h. This may be because as the induction time increases, gellan gum continues to be secreted, which surrounds the bacterial cells and hinders electroporation. Therefore, the optimal induction time for the inducer (IPTG) is 4 h. Optimization was achieved by setting IPTG induction concentration gradients of 0 mM, 0.2 mM, 1 mM, 10 mM, 50 mM, 100 mM, and 200 mM. The results showed that IPTG concentrations within the range of 0.2 mM to 100 mM could induce recombination in the λ-Red system. gam , beta , EXO Gene expression enables gene editing; when the IPTG concentration is 50mM~100mM, the target gene transcription level is high, and the gene editing transformation efficiency is optimal; when the IPTG concentration is 100mM... gam , beta , EXO Gene expression levels reach their peak; when the IPTG concentration reaches 200mM, it will produce cytotoxicity to Sphingosine monocytogenes, inhibiting bacterial growth and causing a decrease in editing efficiency.

[0103] (2) Determine the amount of DNA converted by electroporation The results are as follows Figure 7 The highest number of transformants and recombination efficiency were observed when the DNA amount was 1500 ng, with an average of 1034 transformants at this point. Therefore, the optimal amount of DNA for electroporation transformation was determined to be 1500 ng.

[0104] (3) Determine the length of the same source arm To improve the transformation efficiency of the λ-Red recombination system, 400 bp and 800 bp homologous arms were designed, and the two knock-in fragments were electrotransformed into *Sphingosine monocytogenes*. The number of transformants on the double-antibody plates was counted, and the results are as follows: Figure 8 As shown, with an 800 bp homologous arm, the average number of transformants obtained was 1643, and with a 400 bp homologous arm, the average number of transformants obtained was 1290. Therefore, when designing dissolved oxygen gene knock-in fragments in the future, setting the homologous arm length to 800 bp may result in higher recombination efficiency.

[0105] 5. Determination of the genetic stability of the λ-Red homologous recombination system The experiment compared wild-type and strain Sphingosine monocytogenes (pRSF1010-) Ptrc The genetic stability of the λ-Red system was assessed through continuous subculturing experiments. The experimental strain was continuously subcultured in YM liquid medium containing KAN, with an antibiotic-free YM medium serving as a control. Results are as follows: Figure 9As shown, the λ-Red homologous recombination system is genetically stable in *Sphingosine monocytogenes*, and the results indicate that the system can be stably passaged for 50 generations under a pressure of 50 μg / mL KAN.

[0106] Example 2 Improving gellan gum production using the λ-Red homologous recombination system 1. Experimental Methods Using the λ-Red recombination system constructed in Example 1, construct vgb Knock-in plants and hmp Knock in strains.

[0107] 1.1 Construction of the knock-in strain *Sphingosine Monoclonalella* (SMC) vgb ) 1.1.1 Obtaining vgb gene fragments vgb The gene fragment (SEQ ID NO:8) was synthesized and codon-optimized by Genewiz, and the optimized fragment was integrated into the vector pUC-GW-Kan- vgb Above. In order to obtain materials that can be used for overlap PCR. vgb This experiment was designed to... vgb -F / R primers, where vgb -F contains a homologous segment to the phaC promoter. vgb -R contains a homologous sequence to the chloramphenicol fragment, and the reaction system is as follows: pUC-GW-Kan- vgb 2 μL vgb -F 1 μL, vgb - Add 1 μL of R and 25 μL of 2×Xerox Mix, then add ddH2O to a final volume of 50 μL. Refer to the 2×Xerox Mix high-fidelity enzyme instructions from the Biomed manufacturer for the PCR system and procedure, where the annealing temperature is set to 56℃. Verify the PCR products by agarose gel electrophoresis, ensuring correct bands are extracted and recovered using the OMEGA Gel Extraction Kit; refer to the kit's instructions for specific procedures.

[0108] 2.1.2 PCR fusion of recombinant fragments The fragment ligation method is the same as in 1.4.2, resulting in plasmid pk18 - knock-in fragment - vgb -CHL 2.1.3 Chemical transformation of the linking product to E. coli Top 10 The experimental method is the same as in 1.1.5.

[0109] 2.1.4 Verification of Connection Results (1) Colony PCR: Single colonies growing on the surface of LB / KAN plates were picked and prepared into bacterial suspensions. The reaction system was as follows: 1 μL of bacterial suspension, pk18- vgb -CHL-YZ-F 0.5 μL, pk18- vgb 0.5 μL of -CHL-YZ-R, 10 μL of 2×Taq PCR MasterMix, and ddH2O to a final volume of 20 μL. The reaction procedure is as follows (refer to the Biomed 2×Taq PCR Master Mix), with the annealing temperature set to 58℃. Once the PCR products are verified to be correct by agarose gel electrophoresis, incubate the corresponding bacterial suspension overnight at 37℃.

[0110] (2) Plasmid PCR: Plasmids were extracted using the OMEGA Plasmid Mini Kit and PCR reaction was performed for further verification.

[0111] (3) Sequencing verification: The extracted plasmid was sent to Genewiz for sequencing using a template. The sequencing primers were pk18- vgb -CHL- YZ-F and pk18- vgb The CHL-YZ-R sequencing results were analyzed using DNAMAN software.

[0112] 2.1.5 Obtaining the Input Fragment - vgb Using plasmid pk18-knockout fragment- vgb Using CHL as a template and up-F and down-R as primers, the knock-in fragment was amplified by PCR. vgb The PCR reaction system is as follows: pk18-knockout fragment- vgb 2 μL of -CHL, 1 μL of up-F, 1 μL of down-R, and 25 μL of 2×Xerox Mix were added, with ddH2O added to bring the total volume to 50 μL. The PCR system and procedure were described in the Biomed 2×Xerox Mix high-fidelity enzyme instruction manual, which specifies an annealing temperature of 56 ℃. The PCR products were verified by agarose gel electrophoresis. Correct bands were excised and recovered using the OMEGA Gel Extraction Kit; the specific procedure was described in the kit's instruction manual.

[0113] 2.1.6 Electrical input segment - vgb Sphingosine monocytogenes (pRSF1010-) was induced with 100 mmol / L IPTG. Ptrc -λRed) Recombinase expression, preparation of competent cells, followed by electroporation to convert the knock-in fragment - vgbSphingosine monocytogenes was introduced, and the experimental method was the same as in 1.2.2. It was spread on a solid plate medium containing 50 μg / mL KAN and 15 μg / mL LCHL antibiotics and placed in a constant temperature incubator at 30 ℃ for 3 days. Transformants were picked from the solid plate and colony PCR was performed for verification.

[0114] (1) PCR verification. The reaction system is as follows: 1 μL of bacterial suspension, knock-in... vgb -YZ-F 0.5 μL, knock-in- vgb Add 0.5 μL of YZ-R and 10 μL of 2×Taq PCR Master Mix, then add ddH2O to a final volume of 20 μL. Follow the reaction procedure outlined in the Bomeide 2×Taq PCR Master Mix guide, setting the annealing temperature to 58 ℃. Once the PCR products are verified to be correct by agarose gel electrophoresis, incubate the corresponding bacterial suspension overnight at 37 ℃.

[0115] (2) Genomic PCR verification. Genomic DNA was extracted using the Bomeid bacterial genome extraction kit. The specific procedure was followed by a PCR reaction for further verification.

[0116] (3) Sequencing verification: The extracted genome was sent to Genewiz for sequencing using Genewiz as a template. Sequencing primers were knock-in primers. vgb -YZ-F and type- vgb -YZ-R sequencing results were analyzed using DNAMAN software.

[0117] 2.2 Construction of knock-in strain *Sphingosine Monoclonalella* (SMC) hmp ) 2.2.1 Obtaining hmp gene fragments hmp The gene fragment (SEQ ID NO:10) was synthesized and codon-optimized by Genewiz, and then integrated into the vector pUC-GW-Kan-. hmp Above. In order to obtain materials that can be used for overlap PCR. hmp This experiment was designed to... hmp -F / R primers, where hmp -F contains and phaC Homologous segments of the promoter, hmp -R contains a homologous sequence to the chloramphenicol fragment, and the reaction system is as follows: pUC-GW- Kan-hmp 2 μL hmp -F 1 μL, hmp-1 μL of R, 25 μL of 2×Xerox Mix, and ddH2O to a final volume of 50 μL. Refer to the 2×Xerox Mix high-fidelity enzyme instructions from the Biomed manufacturer for the PCR system and procedure, where the annealing temperature is set to 56 ℃. Verify the PCR products by agarose gel electrophoresis, ensuring correct bands are extracted and recovered using the OMEGA Gel Extraction Kit; refer to the kit's instructions for specific procedures.

[0118] 2.2.2 Recombinant Fragment PCR Fusion The fragment ligation method is the same as in 1.4.2, resulting in plasmid pk18 - knock-in fragment - hmp -CHL.

[0119] 2.2.3 Chemical transformation of the linking product to E. coli DH5α The experimental method was the same as the result verification in 1.1.5. (1) Colony PCR: Single colonies growing on the surface of LB / KAN plates were picked and prepared into a bacterial suspension. The reaction system was as follows: 1 μL of bacterial suspension, pk18-knock-in hmp -CHL-YZ-F 0.5 μL, pk18 -knock- hmp 0.5 μL of -CHL-YZ-R, 10 μL of 2×TaqPCR Master Mix, and ddH2O to a final volume of 20 μL. The reaction procedure is as follows (refer to the Biomed 2×Taq PCR MasterMix), with the annealing temperature set to 58 ℃. After verifying the PCR products are correct by agarose gel electrophoresis, incubate the corresponding bacterial suspension overnight at 37℃.

[0120] (2) Plasmid PCR: Plasmids were extracted using the OMEGA Plasmid Mini Kit and PCR reaction was performed for further verification.

[0121] (3) Sequencing verification: The extracted plasmid was sent to Genewiz for sequencing using a template. The sequencing primers were pk18-knock-in. hmp -CHL-YZ-F and pk18- key- hmp The CHL-YZ-R sequencing results were analyzed using DNAMAN software.

[0122] 2.2.5 Obtaining the Input Fragment - hmp Using plasmid pk18-knockout fragment- hmp Using CHL as a template and up-F and down-R as primers, the knock-in fragment was amplified by PCR. hmp The PCR reaction system is as follows: pk18-knockout fragment- hmp2 μL of -CHL, 1 μL of up-F, 1 μL of down-R, and 25 μL of 2×Xerox Mix were added, with ddH2O added to bring the total volume to 50 μL. The PCR system and procedure were described in the Biomed 2×Xerox Mix high-fidelity enzyme instruction manual, which specifies an annealing temperature of 56 ℃. The PCR products were verified by agarose gel electrophoresis. Correct bands were excised and recovered using the OMEGA Gel Extraction Kit; the specific procedure was described in the kit's instruction manual.

[0123] 2.2.6 Electrical input segment - hmp Sphingosine monocytogenes (pRSF1010-) was induced with 100 mmol / L IPTG. Ptrc -λRed) was used to express the recombinase, and competent cells were prepared. Then, the knock-in fragment was expressed using electroporation. hmp Sphingosine monocytogenes was introduced, and the experimental method was the same as in 1.2.2. The bacteria were spread on solid plates containing 50 μg / mL KAN and 15 μg / mL CHL and placed in a constant temperature incubator at 30 ℃ for 3 days. Transformants were then picked from the solid plates for colony PCR verification.

[0124] (1) PCR verification. The reaction system is as follows: 1 μL of bacterial suspension, knock-in... hmp -YZ-F 0.5 μL, knock-in- hmp Add 0.5 μL of YZ-R and 10 μL of 2×Taq PCR Master Mix, then bring the total volume to 20 μL with ddH2O. The reaction procedure is as follows (refer to the Bomeide 2×Taq PCR Master Mix), with the annealing temperature set to 58 ℃. Once the PCR product is verified to be correct by agarose gel electrophoresis, incubate the corresponding bacterial suspension overnight at 30 ℃.

[0125] (2) Genomic PCR verification. Genomic DNA was extracted using the Bomeid bacterial genome extraction kit. The specific procedure was followed by a PCR reaction for further verification.

[0126] (3) Sequencing verification: The extracted plasmid was sent to Genewiz for sequencing using a template. Sequencing primers were knock-in primers. hmp -YZ-F and type- hmp -YZ-R sequencing results were analyzed using DNAMAN software.

[0127] 2.3 Determination of growth curve and residual sugar content of the knock-in strain during shake-flask fermentation The strain of Sphingosine monocytogenes (Septomonas sphingosine monocytogenes) vgb ) and Sphingosine monocytogenes ( hmp Wild-type Sphingosine monocytogenes (SMP) and the control group were streaked on double-antibiotic solid plates. After single colonies grew, they were inoculated into seed culture medium. The seed culture was inoculated into fermentation medium containing 50 μg / mL KAN and 15 μg / mL CHL at a 1% inoculum volume to a final volume of 100 mL. The medium was incubated at 30℃ with shaking at 180 rpm / min until the stationary phase. Samples were taken every 3 hours, and aseptic techniques were used during sample collection to avoid affecting subsequent experiments. The OD600 value was measured using a microplate reader, and the residual sugar content was measured using an S-10 biosensor analyzer. The data were recorded, and growth curves and residual sugar content curves were plotted.

[0128] 2.4 Determination of gellan gum yield and extraction rate 2.4.1 Determining Gellan Gum Production: (1) Control group wild-type and recombinant strain Sphingosine monocytogenes (SMP) vgb ) and Sphingosine monocytogenes ( hmp The seed culture was obtained by culturing at 30℃ for 24 h, and fermentation was carried out at 10% inoculum at 30℃ and 180 rpm for 72 h with shaking.

[0129] (2) Take 10 g of each fermentation liquid from different fermentation times (24 h, 48 h, 72 h) and place them in centrifuge bottles respectively; (3) Add 90 mL of deionized water to each sample and treat it in a boiling water bath for 15 minutes; (4) Centrifuge at 8000 rpm for 45 minutes to separate the supernatant; (5) Add 300 mL of isopropanol to the supernatant and let it stand overnight at 4°C; (6) Collect the precipitated gellan gum by centrifugation and dry it at 70°C to constant weight; (7) Weigh the dried gellan gum sample and record the mass data.

[0130] All the above operations were performed in parallel under the same conditions to ensure the comparability of experimental data.

[0131] 2.4.2 Determination of gellan gum extraction rate (1) Take 50.0 g of fermentation broth into an Erlenmeyer flask and add 150 ml of 95% ethanol to the Erlenmeyer flask; (2) Place the above fermentation broth at 4 ℃ overnight; (3) Collect the fermentation broth into a centrifuge bottle, centrifuge at 8000 rpm for 45 min, and collect the precipitate; (4) Add 95% ethanol, centrifuge again, and repeat 3 times.

[0132] (5) After drying until the mass remains unchanged, weigh it.

[0133] The formula for calculating the rubber extraction rate is as follows: Extraction rate = (Mass of crude gellan gum / Mass of fermentation broth) × 100% 2.5 Determining the viscosity of the fermentation broth The viscometer of Shanghai Precision Instruments Co., Ltd. was used to determine the viscosities of wild-type strains and *Sphingosine monocytogenes* strains cultured for 24 h, 48 h, and 72 h, respectively. vgb ) and Sphingosine monocytogenes ( hmp The viscosity of the fermentation broth.

[0134] (1) Adjust the instrument to a horizontal position so that the instrument pointer is at zero.

[0135] (2) Select the appropriate rotor and speed according to the instrument instruction manual.

[0136] (3) Place the fermentation broth to be measured in a beaker, ensuring that the fermentation broth covers the rotor probe.

[0137] (4) Start the viscometer and wait for the pointer to stabilize before taking a reading. The reading is converted according to the conversion table to obtain the viscosity of the fermentation broth.

[0138] 2. Experimental Results: 2.1 Knock-in strain *Sphingosine monocytogenes* (SMP) vgb Construction of ) (1) Enter the fragment - vgb The acquisition After the rubber is cut and recycled, the knock-in fragment is obtained. vgb , will type in the fragment - vgb The sequencing was performed, and the sequencing results were as follows: Figure 9 As shown. The sequencing results are correct and will be used for subsequent experiments.

[0139] (2) Knock-in strain After the genome is extracted, it is sent for sequencing. The sequencing results are as follows: Figure 10 As shown, the sequencing results are correct, and the knock-in strain is correct. vgb Successfully built.

[0140] 2. Knock-in strain *Sphingosine monocytogenes* (SMP) hmp Construction of ) (1) Enter the fragment - hmp Using plasmid pk18-knockout fragment- hmp Using CHL as a template, PCR amplification was performed. After verification by agarose gel electrophoresis of the PCR product, the correct bands were excised and recovered to obtain the knock-in fragment. hmp , will type in the fragment - hmp The sequencing was performed, and the sequencing results were as follows: Figure 11 As shown. The sequencing results are correct and will be used for subsequent experiments.

[0141] (2) Knock-in strain After the genome is extracted, it is sent for sequencing. The sequencing results are as follows: Figure 12 As shown, the sequencing results are correct, and the knock-in strain is correct. hmp Successfully built.

[0142] 3. Determination of growth curve and residual sugar content of the knock-in strain during shake-flask fermentation. This experiment analyzed the fermentation characteristics of the wild-type strain and the constructed recombinant strain, including the determination of three aspects: shake-flask fermentation growth curve, residual sugar content, and gum production. The wild-type strain was used as a control, and the growth of the recombinant strain in the fermentation broth was measured. The growth curves are shown below. Figure 13 In the early stages of culture, the recombinant strain was basically identical to the wild type; in the later stages of culture, *Sphingosine monocytogenes* (…) vgb ), Sphingosine monocytogenes ( hmp The OD600 value of the recombinant strain is slightly higher than that of the wild-type strain, possibly because the recombinant strain produces more gum than the wild-type strain, resulting in a higher OD value when the OD value is measured.

[0143] 6. Determination of gellan gum yield and extraction rate (1) Gel production See results Figure 14 By crudely extracting gellan gum and determining the yield of the crude extract, the recombinant strain *Sphingosine monocytogenes* (SMM) was found to have a yield of [amount missing] at 24 hours. vgb The yield was higher than that of the wild type, but the increase was not significant; Sphingosine monocytogenes (SMM) hmp The yield of *Sphingosine monocytogenes* was slightly higher than that of the wild type. At 48 h of culture, the yield of *Sphingosine monocytogenes* (…) was… vgb The yield of *Sphingosine monocytogenes* was 1.60 g / L higher than that of the wild type, a significant increase. hmp The yield of *Sphingosine monocytogenes* was 1.13 g / L higher than that of the wild type, a significant increase. At 72 h of culture, *Sphingosine monocytogenes* (…) produced… vgb The yield of *Sphingosine monocytogenes* was 1.00 g / L higher than that of the wild type. hmp The gellan gum yield was 0.37 g / L higher than that of the wild type. This may be because after 48 h of culture, a large amount of gellan gum was produced, which increased the viscosity of the fermentation broth and decreased the dissolved oxygen content, thus affecting the gellan gum yield. In contrast, the recombinant strain had a recombinant dissolved oxygen gene in its genome, resulting in high dissolved oxygen content and a significantly increased gellan gum yield compared to the wild type.

[0144] (2) Gellan gum extraction rate The extraction rates of wild-type strains and recombinant strains of Sphingosine monocytogenes were calculated using the extraction rate formula. vgb ) and Sphingosine monocytogenes ( hmp The extraction rate of gellan gum produced by fermentation, such as Figure 15 As shown.

[0145] 7. Determination of the viscosity of the fermentation broth Test results are shown Figure 16 During the fermentation culture of *Sphingosine monocytogenes*, the viscosity of gellan gum continuously increased with the secretion of gellan gum. Viscometers were used to measure the viscosity of wild-type strains and recombinant strains of *Sphingosine monocytogenes*. vgb ) and Sphingosine monocytogenes ( hmp The viscosity of the fermentation broth was as follows: Figure 17 As shown, after 24 hours of culture, the viscosity of the wild-type strain was 650 mPa·s, and that of *Sphingosine monocytogenes* (…). vgb The viscosity of ) is 836 mPa·s, and the viscosity of Sphingosine monocytogenes (SCM) is 836 mPa·s. hmp The viscosity of the fermentation broth was 716 mPa·s; after 48 hours, it was 3986 mPa·s, 4526 mPa·s, and 4343 mPa·s, respectively; and after 72 hours, it was 7000 mPa·s, 8030 mPa·s, and 7790 mPa·s, respectively. We found that the viscosity of the fermentation broth continuously increased with increasing culture time, and that *Sphingosine monocytogenes* (SMM) showed a significant increase in viscosity. vgb ) and Sphingosine monocytogenes ( hmp The viscosity of the *Sphingosine monocytogenes* strain was greater than that of the wild type, indicating that the knock-in of the dissolved oxygen gene increased the viscosity of the fermentation broth. vgb The viscosity of ) is lower than that of Sphingosine Monoclonal (SMC). hmp It needs to be big.

[0146] Example 3 Optimization of fermentation medium for high-yield gellan gum strains 1. Experimental Methods: 1.1 Single-factor experiment (1) Optimization of carbon source type and addition amount When preparing the fermentation medium, all other medium components remained unchanged. The sole carbon source consisted of sucrose, fructose, glucose, lactose, and soluble starch, added at a concentration of 30 g / L. Fermentation was carried out at 30°C for 48 h. The viscosity of gellan gum and the gum extraction rate were measured and recorded. The optimal carbon source was determined.

[0147] Glucose was added as the sole carbon source at concentrations of 20.00, 30.00, 40.00, 50.00, and 60.00 g / L, respectively, while other culture medium components remained unchanged. Fermentation was carried out at 30℃ for 48 h. The viscosity of gellan gum and the gel extraction rate were measured and the data were recorded. The optimal amount of glucose added was determined.

[0148] (2) Optimization of nitrogen source type and addition amount When preparing the fermentation medium, other medium components were added at the optimized amounts described above. The sole nitrogen source was corn steep liquor, soybean meal, soybean flour, yeast extract, yeast peptone, and added at a rate of 6.0 g / L. The viscosity of the fermentation broth and the gum extraction rate were measured and recorded to determine the appropriate nitrogen source.

[0149] Soybean meal was added at concentrations of 5.00 g / L, 6.00 g / L, 7.00 g / L, 8.00 g / L, and 9.00 g / L, respectively, with other culture medium components added at the optimized amounts. Fermentation was carried out at 30°C for 48 h to determine the appropriate amount of soybean meal to be added.

[0150] (3) Optimization of K2HPO4 addition amount The inorganic salt K₂HPO₄ was added at concentrations of 1.00 g / L, 2.00 g / L, 3.00 g / L, 4.00 g / L, 5.00 g / L, and 6.00 g / L, respectively. The viscosity of the fermentation broth and the gum extraction rate were measured and the data were recorded. The optimal amount of K₂HPO₄ added was then determined.

[0151] (4) Optimization of KH2PO4 addition amount The inorganic salt KH2PO4 was added at concentrations of 1.00 g / L, 2.00 g / L, 3.00 g / L, 4.00 g / L, and 5.00 g / L, respectively, while other culture medium components were added at the optimized amounts described above. The optimal amount of KH2PO4 was then selected.

[0152] (5) Optimization of MgSO4 addition amount 0, 0.20 g / L, 0.40 g / L, 0.60 g / L, 0.80 g / L, and 1.00 g / L of MgSO4 were added as the sole inorganic salt, respectively. Other culture medium components were added at the optimized amounts described above. The viscosity of the fermentation broth and the gum extraction rate were measured to screen out the optimal amount of MgSO4.

[0153] 1.2 Response surface methodology for optimizing fermentation medium Based on the results of the above culture medium optimization experiments, three factors with relatively significant effects (glucose, soybean meal, and K2HPO4) were selected for response surface methodology (RSM) analysis. Using Design-Expert 13 software, with the gum extraction rate of the fermentation broth as the response value, the interaction of these three factors on *Sphingosine monocytogenes* (SMP) was investigated. vgb ) and Sphingosine monocytogenes ( hmp The effect of synthesized gellan gum.

[0154] Table 2 Experimental Design

[0155] 1.3 Fermentation tank scale-up experiment Based on single-factor and response surface methodology experiments, 5 L of culture medium was prepared using optimized culture medium components and sterilized. *Sphingosine monocytogenes* (SMP) was inoculated at a 10% (v / v) inoculum. vgb ) and Sphingosine monocytogenes ( hmp The culture medium was inoculated into the optimized culture medium and fermented at 30℃ and 300-500 r / min. The aeration rate during fermentation was 1 vvm, and the fermentation time was 48 h. During this period, samples were taken every 8 h to measure the OD of the fermentation broth. 600 The residual sugar content was measured, and the gellan gum extraction rate was determined by sampling at 24 h and 48 h.

[0156] 2. Experimental Results: 2.1 Carbon source optimization Test results are shown Figure 18 The optimal carbon source was determined by analyzing viscosity and gum extraction rate. Viscosity analysis showed that glucose had the highest viscosity. The recombinant strain *Sphingosine Monoclonalella* (…) vgb The viscosity of the fermentation broth using glucose as the sole carbon source was 8053 mPa·s, significantly higher than that using other carbon sources. *Sphingosine monocytogenes* (… hmp The viscosity of the fermentation broth was 7676 mPa·s, although lower than that of *Sphingosine monocytogenes* (SMP). vgb However, it is still the highest among the five carbon sources; gum extraction rate analysis: Sphingosine monocytogenes ( vgb The gum extraction rate using glucose as the sole carbon source was 0.74%, which was higher than that of the other five carbon sources. (Sphingosine monocytogenes) hmp The same applies to the recombinant strain *Sphingosine monocytogenes* (SMM). vgb ) and Sphingosine monocytogenes ( hmp The optimal carbon source is glucose.

[0157] The results are as follows Figure 19 Sphingosine monocytogenes (SMM) vgb ) and Sphingosine monocytogenes ( hmp The fermentation characteristics are similar: at 20-40 g / L, the viscosity of the fermentation broth and the gum extraction rate increase with increasing glucose concentration; they reach their peak at 40 g / L. vgb The viscosity and gum extraction rate of the strain were 9850 mPa·s and 0.82%, respectively. hmp The effective concentrations of the strains were 8500 mPa·s and 0.72%, respectively; at concentrations of 40-60 g / L, viscosity and gum extraction rate decreased slightly. The optimal glucose addition was 40 g / L.

[0158] 2. Nitrogen source optimization like Figure 20As shown. When soybean meal is used as a nitrogen source, *Sphingosine monocytogenes* (SMP) vgb The highest viscosity of the fermentation broth was 7840 mPa·s; Sphingosine monocytogenes (SPM) hmp The fermentation broth viscosity of *Sphingosine monocytogenes* was also the highest, at 7426 mPa·s. vgb ) and Sphingosine monocytogenes ( hmp The gum extraction rates of the strains were 0.72% and 0.62%, respectively, which were higher than those of the other five nitrogen sources. Therefore, the optimal nitrogen source was soybean meal.

[0159] Different concentrations of soybean meal (5.00-9.00 g / L) were added to the culture medium. Figure 21 It can be seen that when the soybean meal addition amount is 7.00 g / L, *Sphingosine monocytogenes* (SMP) vgb The highest viscosity of the fermentation broth was 8880 mPa·s; Sphingosine monocytogenes (SPM) hmp The fermentation broth viscosity of *Sphingosine monocytogenes* was also the highest, at 8393 mPa·s. vgb ) and Sphingosine monocytogenes ( hmp The gum extraction rates of the two strains were 0.76% and 0.68%, respectively; therefore, the optimal amount of nitrogen source soybean meal added for the two recombinant strains was 7.00 g / L.

[0160] 3. Inorganic salt optimization Test results are shown Figure 22 When the K2HPO4 addition amount is 1.00-5.00 g / L, the viscosity of the fermentation broth and the gum extraction rate increase with the increase of concentration; the peak value is reached at 5.00 g / L, with viscosity and gum extraction rate of 9150 mPa·s and 0.73% and 8730 mPa·s and 0.65%, respectively; therefore, the optimized culture medium is added with 5.00 g / L of K2HPO4.

[0161] The effects of KH2PO4 concentration on the recombinant strain *Sphingosine monocytogenes* (KH2PO4) were studied. vgb ) and Sphingosine monocytogenes ( hmp The effect of gellan gum synthesis on the results is shown in the figure. Figure 23 It reaches its peak at 5.00 g / L; it decreases slightly after exceeding 5.00 g / L, and the optimal addition amount is determined to be 5.00 g / L.

[0162] The effect of MgSO4 concentration on gellan gum synthesis by recombinant bacterial strains was investigated. Results are shown below. Figure 24The results showed that the peak concentration was reached at 0.80 g / L, with values ​​of 7533 mPa·s and 0.65%, and 7133 mPa·s and 0.60%, respectively. The concentration decreased after exceeding 0.80 g / L, and the optimal addition amount was determined to be 0.80 g / L. However, when MgSO4 was used as the only inorganic salt, the viscosity and gum extraction rate were lower than those when K2HPO4 and KH2PO4 were used.

[0163] 4. Response surface methodology for optimizing fermentation medium Based on the data from the above experiments, the recombinant strain *Sphingosine monocytogenes* (SMM) was selected as the target strain. vgb ) and Sphingosine monocytogenes ( hmp Response surface methodology was used to analyze three factors that significantly affect the production of gellan gum. Experiments were conducted using the parameters provided by the software, and the results were recorded. Figure 25 and Figure 26 The six graphs obtained all showed that the response surface curvature was relatively large and the contour lines were relatively dense, indicating that the interaction among the three factors was relatively significant.

[0164] Rubber extraction rate = 0.8620 + 0.0200 × A + 0.0813 × B - 0.0163 × C + 0.0900 × AB - 0.0050 × AC - 0.0275×BC-0.3373×A 2 -0.1948×B 2 -0.1698×C 2 Through Design-Expert 13 optimization, the recombinant strain *Sphingosine Monoclonalella* was obtained. vgb ) and Sphingosine monocytogenes ( hmp The optimal fermentation medium for *Sphingosine Monoclonalella* strain (…). vgb ): Glucose 40.291 g / L, soybean meal 7.213 g / L, K2HPO4 4.832 g / L, theoretical gum extraction rate 0.87%; strain: Sphingosine monocytogenes ( hmp The optimal formula was: glucose 41.63 g / L, soybean meal 7.26 g / L, K2HPO4 4.95 g / L, with a theoretical gum extraction rate of 0.81%. For ease of operation, the optimal formula was adjusted to: glucose 41.00 g / L, soybean meal 7.00 g / L, K2HPO4 5.00 g / L, KH2PO4 5.00 g / L, MgSO4 0.80 g / L, and cultured for 72 h. To verify the accuracy of the response surface methodology prediction, three repeated shake-flask fermentation experiments were conducted under the optimal formula conditions. The strain *Sphingosine Monoclonalella* (SMC) was determined to be... vgb The average gum extraction rate was (0.84±0.05)%, and the strain was *Sphingosine monocytogenes* (…). hmpThe value was (0.78±0.05)%, which is close to the theoretical value, indicating that the model has a high degree of fit and verifying the feasibility of the model.

[0165] 5. Scale-up production in fermentation tanks To verify the recombinant strain *Sphingosine monocytogenes* (… vgb ) and Sphingosine monocytogenes ( hmp The effects of optimizing the culture medium and its gum-producing properties were investigated. The fermentation medium composition was: glucose 41.00 g / L, soybean meal 7.00 g / L, K₂HPO₄ 5.00 g / L, KH₂PO₄ 5.00 g / L, and MgSO₄ 0.80 g / L. The above medium components were accurately weighed and prepared into a liquid medium for aerobic fermentation. Figure 27 As shown, after 48 hours of fermentation, the strain *Sphingosine monocytogenes* (…) vgb The gellan gum extraction rate was 0.84±0.09%, and the residual sugar content was 12.75 g / L; *Sphingosine monocytogenes* (… hmp The gellan gum extraction rate was 0.81±0.04%, and the residual sugar content was 13.36 g / L. Compared with before cultivation and optimization, the gellan gum extraction rate increased by 24.00% and 23.60% respectively after 48 h of cultivation.

[0166] Comparative Example 1 Comparison with traditional methods for increasing gellan gum production The existing technology 1 (Giavasis I, Harvey LM, McNeil B. The effect of agitation and aeration on the synthesis and molecular weight of gellan in batch cultures of Sphingomonas paucimobilis. Enzyme and Microbial Technology, 2006, 38(1–2): 101–108. DOI: 10.1016 / j.enzmictec.2005.05.003.) prepares gellan gum using the following method: fermentation with wild-type Sphingomonas paucimobilis, increasing dissolved oxygen during fermentation by increasing stirring speed and aeration, thereby increasing gellan gum yield, without any gene editing of the strain.

[0167] Existing technology 1 uses wild type Sphingomonas paucimobilisBatch fermentation was conducted using ATCC 31461 to systematically investigate the effects of stirring speed and aeration rate on gellan gum synthesis. The results showed that increasing aeration rate and enhancing stirring promoted cell growth, but excessively high stirring speeds did not favor gellan gum accumulation. The highest gellan gum concentrations (12.3 g / L and 12.4 g / L) were achieved under stirring at 500 rpm and aeration rates of 1–2 vvm. In contrast, while 1000 rpm enhanced cell growth, it shifted metabolism towards biomass formation rather than polysaccharide synthesis. Problems exist: 1. It can only alleviate the insufficient dissolved oxygen in the early stage of fermentation in the short term. In the middle and late stages of fermentation, a large amount of extracellular cryogel accumulates, the viscosity of the fermentation broth increases, the gas-liquid mass transfer resistance surges, and the dissolved oxygen is still significantly limited. 2. Significantly increasing the intensity of stirring and aeration will increase equipment energy consumption, and pure oxygen and exogenous oxygen-carrying reagents will raise the production cost of raw materials. The overall increase in production is limited and cannot solve the core bottleneck of hypoxia from the endogenous level of the strain.

[0168] Advantages of this invention: By using a dedicated λ-Red homologous recombination system, it can separately... vgb , hmp Two hemoglobin genes are integrated into the strain chromosome at specific sites, which enhances the ability of bacteria to capture and utilize oxygen from the endogenous source. Under the same stirring and aeration conditions, a higher level of dissolved oxygen can be maintained during fermentation without the need for high energy consumption and high auxiliary material input. The increase in gellan gum production is much higher than that of pure process improvement schemes, making it suitable for large-scale continuous fermentation production.

[0169] Comparative Example 2 Overexpression of Sphingosine Monoclonalella using plasmid introduction vgb Comparison of gene-enhanced strain gel production programs Prior art 2 (Wu XC, Chen YM, Li YD, et al Constitutive expression of Vitreoscilla haemoglobin in Sphingomonas elodea to improve gellan gum production. Journal of Applied Microbiology, 2011, 110(2): 422–430. DOI:10.1111 / j.1365-2672.2010.04896.x.) A recombinant plasmid pCPP30-VHb was constructed for expressing vitreoscilla haemoglobin in Sphingomonas elodea. This plasmid uses pCPP30 as a vector to express constitutive expression of vitreoscilla haemoglobin in Sphingomonas elodea to improve gellan gum production. bla Startup driver, C-end with 6×His tag vgbThe operon is inserted. Specifically, the researchers used pBla-VHb-122 as a template for PCR amplification. vgb The fragment, after being double-digested with HindIII and BamHI, was ligated to the corresponding site of pCPP30 to obtain pCPP30-VHb, which was then first transformed into... E. coli The cells were preserved and amplified in DH5α. Subsequently, pCPP30-VHb and the empty vector pCPP30 were introduced into *Sphingosine Monoclonalis* using triparental conjugation transfer. Donor bacteria, recipient bacteria, and helper bacteria carrying the helper plasmid pRK2013 were mixed in a 3:8:3 ratio and conjugated on LB agar plates at 37°C for 7 h. Transconjugators were then screened using selective medium containing 25 μg / mL streptomycin and 6 μg / mL tetracycline. The obtained VHb-expressing strain showed a characteristic absorption peak at 419 nm using CO2 differential spectroscopy, indicating that the exogenous VHb possessed biochemical activity. Compared with the parental strain, the VHb-expressing strain exhibited enhanced cell growth, and the gellan gum yield increased by approximately 20% after 48 h of fermentation.

[0170] Problems exist: Free plasmid expression vgb It suffers from drawbacks such as loss during passage and the need to add antibiotics for screening, making it difficult to stably obtain engineered bacteria.

[0171] Compared with the prior art 2, the advantages of the present invention are as follows: it constructs a highly efficient λ-Red editing system adapted to Sphingosine monocytogenes, which greatly improves the efficiency of genome-specific integration; and the gene is stably integrated into the chromosome without the risk of plasmid loss, fermentation does not require antibiotics, meets food-grade production standards, and eliminates the inhibition of gellan gum synthesis by dissolved oxygen from the root.

[0172] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A λ-Red gene editing system for *Sphingosine monocytogenes*, characterized in that, For backbone vectors containing the following gene elements: broad-host replicon, inducible promoter, and λ-Red fragment; The λ-Red fragment includes Exo , Beta and Gam Recombinase gene.

2. The λ-Red gene editing system according to claim 1, characterized in that, The backbone vector includes pRSF1010; the pRSF1010 carries a kanamycin resistance gene; The gene element is cloned at the cloning site of the backbone vector. Sal I and Xho I.

3. The λ-Red gene editing system according to claim 1, characterized in that, The nucleotide sequence of the broad-host replicon is shown in SEQ ID NO:1; The inducible promoter includes Ptrc promoter; the Ptrc The promoter nucleotide sequence is shown in SEQ ID NO:2; The nucleotide sequence of the λ-Red fragment is shown in SEQ ID NO:

3.

4. A gene editing kit for increasing the production of gellan gum by Sphingomonas sphingosine monocytogenes, characterized in that, Includes the λ-Red gene editing system and knock-in fragment or recombinant vector containing knock-in fragment as described in any one of claims 1 to 3; The knock-in fragment includes an upstream homologous arm, a promoter, a knock-in gene, a terminator, a resistance gene, and a downstream homologous arm; The knock-in gene includes vgb and / or hmp Gene.

5. The gene editing kit according to claim 4, characterized in that, The length of the upstream or downstream homologous arm includes 300~1200bp; The target genes of the upstream and downstream homologous arms include antimicrobial peptide genes. The resistance gene includes a chloramphenicol resistance gene.

6. An engineered strain of *Sphingosine Monoclonalella* constructed based on the gene editing kit of claim 4 or 5, characterized in that, The genome of the engineered strain of *Sphingosine monocytogenes* integrates... vgb and / or hmp Gene.

7. The method for constructing the engineered strain of *Sphingosine Monoclonalella* according to claim 6, characterized in that, Includes the following steps: The λ-Red gene editing system and the knock-in fragment, or the knock-in fragment cloned from a recombinant vector containing the knock-in fragment, are transformed into at least *Sphingomonas* competent cells. After induction culture, and followed by antibiotic double selection and removal using the λ-Red gene editing system, a genome containing the λ-Red gene editing system is obtained. vgb and / or hmp Engineered strains of Sphingosine monocytogenes.

8. The construction method according to claim 7, characterized in that, The inducing agent used for induction culture includes IPTG; the induction concentration of IPTG is 50~120 mM; The induction time for IPTG is 2-6 hours; During the transformation, the ratio of viable cell count of *Sphingosine monocytogenes* competent cells, the mass of the knock-in fragment, and the mass of the λ-Red gene editing system was 1 × 10⁻⁶. 9 ~5×10 9 CFU: 1000~2000 ng: 500~1500 ng.

9. The use of the engineered strain of Sphingosine Monoclonalella as described in claim 6 in the production of gellan gum.

10. The application according to claim 9, characterized in that, In the production of gellan gum, the fermentation medium of the engineered strain of Sphingosine monocytogenes includes 41.00 g / L glucose, 7.00 g / L soybean meal, 5.00 g / L K2HPO4, 5.00 g / L KH2PO4, and 0.80 g / L MgSO4.

Images