A primer set, a kit and a method for detecting a geoa gene of geosmin-producing cyanobacteria

Abstract

The application discloses a primer group, a kit and a method for detecting a geoA gene of blue algae producing geosmin, belongs to the technical field of water pollution and water body peculiar smell substance detection, and the sequence of a forward primer Geo-F for detecting the geoA gene of blue algae producing geosmin is shown as SEQ ID No. 1, the sequence of a reverse primer Geo-R1 is shown as SEQ ID No. 2, and the sequence of a probe primer Geo-P2 is shown as SEQ ID No. 3. The primer group can effectively amplify the geoA gene of geosmin, has high specificity and sensitivity, has no cross reaction with blue algae not producing geosmin, can be combined with lateral flow immunochromatography and used for on-site rapid detection of geosmin, and has important significance for early warning of excessive geosmin content in water bodies.

Description

Technical Field

[0001] This invention relates to the field of water pollution and water odor detection technology, specifically to a primer set, reagent kit, and method for detecting the geoA gene of soil-producing cyanobacteria. Background Technology

[0002] In recent years, the rapid development of my country's economy and industry has led to the discharge of large amounts of nutrients such as nitrogen and phosphorus into water bodies, causing increasingly prominent eutrophication problems and promoting the proliferation of algae. During their metabolism, algae produce odorous substances, such as geosmin (GSM), which has a strong earthy smell and an extremely low odor threshold of only 10 ng / L. According to the "Standards for Drinking Water Quality" GB5749-2022, even at extremely low concentrations, this substance can severely affect the sensory properties of drinking water, becoming one of the most frequently complained-about water quality issues among tap water consumers. To date, GSM has been isolated from the metabolites of various specific algal strains, including Oscillatoria, Gastrodinium, Gastrodinium, Gastrodinium flocculationii, and Anabaena. (It is worth noting that GSM synthesis ability is not an inherent characteristic of any particular algal species, but is determined by the enzymatic reaction encoded by the geoA gene. Different strains of the same algal species may exhibit completely different GSM-producing phenotypes due to the presence or expression of the geoA gene.) Outbreaks of these algae not only disrupt the ecological balance of aquatic bodies but also pose a direct threat to drinking water safety. Therefore, establishing efficient detection technologies for geosminogenic algae is of significant practical importance.

[0003] In the field of aquatic ecology and drinking water safety, when the concentration of algae in the water is below 10... 4 When the concentration of geosmin is low (e.g., cells / mL), it is difficult to detect directly using conventional methods such as microscopic observation or naked-eye identification, posing a significant challenge to the early monitoring of geosmin-producing algae. It is noteworthy that certain algal species synthesize geosmin through secondary metabolic pathways during their growth and reproduction, and the geoA gene is the core functional gene for geosmin synthesis, highly conserved in geosmin-producing algae. Abnormal proliferation of these geosmin-producing algae is often an early biological indicator of eutrophication in water bodies. Their presence not only leads to a decline in the sensory quality of drinking water due to geosmin release but may also be accompanied by algal blooms, further causing ecological problems such as reduced dissolved oxygen and aquatic organism mortality, posing a serious threat to drinking water source protection and water environment management.

[0004] Currently, the detection of geosminogenic algae and geosmin mainly relies on two technical approaches, but both have significant shortcomings and are difficult to meet the needs of rapid on-site monitoring:

[0005] The first category is detection techniques based on the geosmin compounds themselves, represented by the "Test Method for Odor Substances Geosmin and 2-Methylisoborneol in Drinking Water" (GB / T5750.8-2023). This method uses headspace solid-phase microextraction-gas chromatography-mass spectrometry (GC-MS), which can accurately quantify geosmin, but the detection process takes several hours and requires large, sophisticated equipment such as GC-MS instruments. Such equipment is bulky, expensive to purchase and maintain, and requires specially trained technicians to operate. It can only be used in laboratory environments and cannot meet the needs of rapid on-site detection in drinking water sources and water treatment plants, making it difficult to achieve early warning of geosmin pollution.

[0006] The second category is molecular biology detection technologies based on soil-producing cyanobacteria, including polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP). While PCR can target cyanobacteria by amplifying the geoA gene and possesses a certain degree of specificity and sensitivity, it has significant limitations: firstly, the detection process is cumbersome, requiring multiple steps such as nucleic acid extraction, reaction system preparation, thermal cycling amplification, and gel electrophoresis detection, resulting in a long overall time consumption; secondly, PCR technology is highly dependent on laboratory-specific equipment such as PCR instruments and gel imaging systems, making it difficult to operate outside of a laboratory environment and thus hard to apply to on-site monitoring of water sources at the grassroots level. LAMP technology, while eliminating the need for thermal cycling equipment and enabling amplification under isothermal conditions, suffers from complex primer design requiring the simultaneous design of 4-6 primers, susceptibility to false positives due to non-specific amplification, and reliance on turbidimeters or fluorescence detectors for product detection. Furthermore, its long amplification time also fails to meet the detection requirements of being "rapid, accurate, and applicable on-site."

[0007] In recent years, recombinase-mediated isothermal amplification (RAA) technology has shown significant advantages as a novel isothermal amplification technique: it can achieve efficient DNA amplification at a constant low temperature of around 39°C, obtaining sufficient amplification products within tens of minutes, and does not require complex thermal cycling equipment, theoretically possessing the potential for on-site detection; at the same time, lateral flow test strips, as a visual detection method, have the characteristics of simple operation, rapid detection, low cost, and no need for professional instrument-assisted interpretation, and have been widely used in the field of biological detection. The combination of the two can form a detection closed loop of "rapid amplification and visual interpretation".

[0008] However, current technologies lack a solution that combines "RAA isothermal amplification technology" with "lateral flow test strip visualization detection" and designs a specific detection system targeting the core functional geoA gene of soil-producing cyanobacteria. Research indicates that existing RAA-related technologies are mostly applied to pathogen detection, not specifically targeting soil-producing cyanobacteria, and lack optimization of processing procedures and RAA amplification systems for the cellular characteristics of cyanobacteria. This means that current technologies cannot meet the practical needs of drinking water sources for "low-concentration detection, rapid detection, and on-site applicability" of soil-producing cyanobacteria, and thus fail to meet the early warning requirements in water quality safety management.

[0009] In summary, there is an urgent need for a detection solution that can overcome the current technological bottlenecks. This solution should have the ability to detect low concentrations, rapid detection characteristics, on-site applicability, and high specificity, targeting only geosmogrin-producing cyanobacteria containing the functional geoA gene. This would enable real-time monitoring of geosmogrin-producing cyanobacteria in water bodies, providing reliable technical support for drinking water source protection and water treatment process optimization, thereby preventing algal blooms and establishing an effective early warning system for geosmogrin pollution. Summary of the Invention

[0010] The purpose of this invention is to provide a geoA gene primer set, matching reagent kit, and detection method for geosminogenic algae that is highly specific, sensitive, and can be rapidly detected on-site. This invention aims to solve the problems of existing detection technologies being time-consuming, reliant on large instruments, complex to operate, and having poor on-site applicability. It enables rapid, sensitive, and specific detection of geosminogenic algae in water bodies, providing support for early warning of geosmin pollution in drinking water sources.

[0011] To address the aforementioned technical problems, the present invention aims to provide a primer set, reagent kit, and method for detecting soil-producing cyanobacteria based on RAA.

[0012] Firstly, in response to the targeted detection needs of soil-producing cyanobacteria, this invention provides a primer set for detecting the geoA gene of soil-producing cyanobacteria. This primer set is designed based on the conserved region of the geoA gene of soil-producing cyanobacteria through multiple sequence alignment. Fifty highly similar geoA gene sequences are obtained from the NCBI database for comparison to determine the conserved amplification region. It can specifically identify and amplify the geoA gene of soil-producing cyanobacteria, effectively avoiding cross-reaction with non-soil-producing cyanobacteria.

[0013] Specifically, the primer set includes geoA gene detection primers and geoA gene detection probe geo-P2. The geoA gene detection primers consist of a forward primer geo-F and a reverse primer geo-R1. The 5' end of the reverse primer geo-R1 is modified with fluorescein isothiocyanate (FITC). This modification enables the amplification product to bind to the anti-FITC antibody in the control area of ​​the subsequent lateral flow chromatography test strip, achieving dual verification of quality control and detection. The 5' end of the geoA gene detection probe geo-P2 is modified with biotin. This modification allows the double-stranded amplification product formed by the probe and the reverse primer to be captured and colored by the nucleic acid test strip through the interaction of biotin-anti-biotin antibody. The 3' end of the probe geo-P2 is modified with a phosphate group (PHO). This modification effectively inhibits non-specific DNA strand elongation and reduces false positive signals during the amplification process.

[0014] Regarding the specific sequences and design principles of primers and probes, the nucleotide sequence of the forward primer geo-F is shown in SEQ ID No. 1: 5'-CTATAAGCGCAGTCAGGATCTAATT-3';

[0015] The nucleotide sequence of the reverse primer geo-R1 is shown in SEQ ID No. 2: 5'-GTATTCAATGGGGTTAGCAATGCGA-3'.

[0016] Both primers were designed strictly according to the following principles: First, the nucleotide length was controlled within the range of 20-30 bp. Specifically, the forward primer was 25 bp and the reverse primer was 25 bp. Primers that were too short were prone to insufficient specificity and cross-reaction with non-target sequences, while primers that were too long would reduce amplification efficiency and prolong reaction time. At the same time, the annealing temperature difference between the forward and reverse primers did not exceed 5°C to ensure that the target sequence could be bound synchronously under the same isothermal amplification conditions, thus ensuring the consistency of amplification reaction conditions.

[0017] Secondly, the geoA gene was amplified using a combination of forward and reverse primers, yielding an amplification product of 200–500 bp in length. Agarose gel electrophoresis confirmed that this amplification product length met the high-efficiency amplification requirements of RAA technology while also exhibiting species specificity for soil-producing algae. For example, it could only amplify the geoA gene of soil-producing algae such as *Anabaena sp. FACHB-1391* and *Aphanizomenon gracile strain AG*, but could not amplify the nucleic acid of non-soil-producing algae such as *Nostoc commune* FACHB-261 and *Pseudanabaena cinerea* FACHB-1277. For example, the sequence of the amplified geoA gene fragment is as follows:

[0018] CTATAAGCGCAGTCAGGATCTAATTGGGGCAAAGGAGTATCTTGACCGACTACCGGCATTTATGCCAATTTATCCCCAAGATCACCTTCCCCTTCCCACGAACCCAGTAGAGCGCGGTTTAGCTGACTTGTGG TCTCGTACTGCCTTTACTAAGTCCGTAGAATGGCGGCAAAGATTCTTTGAAAGTACCAAAAATCTTTTAGATGAATCAATGTGGGAACTAGCAAATATTAATCAAAATCGCATTGCTAACCCCATTGAATAC.

[0019] The amplified product is 265 bp in length.

[0020] The nucleotide sequence of the geoA gene detection probe geo-P2 is shown in SEQ ID No. 3:

[0021] 5'-TTCCCCTTCCCACGAACCCAGTAGAGCGCGHTTTAGCTGACTTGTG-3'; where H is tetrahydrofuran, the probe length is 48 nt, which is within the preferred range of 45-50 nt. A probe length of 45-50 nt can ensure the binding specificity to the target sequence and provide sufficient cleavage site space for the nfo enzyme. At the same time, this probe strictly binds to the target segment between the forward primer geo-F and the reverse primer geo-R1 in the geoA gene, ensuring that it can only bind to the amplification regions of the forward and reverse primers, further improving the detection specificity.

[0022] In some feasible implementations, the probes described above also satisfy the following key conditions:

[0023] First, the design direction is forward, consistent with the nucleotide extension direction of the forward primer. This design allows the probe to bind to the target sequence synchronously with the primer during RAA amplification, avoiding binding competition caused by directional differences.

[0024] Secondly, the sequence contains a tetrahydrofuran (H) modified cleavage site. This cleavage site can be recognized and cleaved by the nfo enzyme when the probe binds to the geoA gene template, initiating the DNA chain elongation reaction. Its mechanism of action is that the nfo enzyme specifically recognizes and cleaves double-stranded nucleic acid containing the tetrahydrofuran site. After cleavage, a free hydroxyl group forms at the 3' end of the probe, providing an elongation starting point for DNA polymerase, thereby achieving specific amplification of the target sequence.

[0025] Secondly, based on the primer set mentioned above, the present invention further provides a kit for detecting soil-producing algae. This kit, with the primer set as its core, integrates all the reagents required for recombinase-mediated isothermal amplification (RAA) reaction, and can be used directly for on-site detection without the need for additional complex reagent preparation.

[0026] Specifically, the essential reagents for RAA amplification include RAA basal buffer, nfo enzyme, MgAc2 solution, and negative control. The RAA basal buffer contains 10-20 mM Tris-HCl, 50-100 mM KCl, and 10-20 mM (NH4)2SO4. The 10-20 mM Tris-HCl maintains the system pH stable at 7.5-8.5, which is the optimal pH range for the RAA reaction. The 50-100 mM KCl and 10-20 mM (NH4)2SO4 regulate the ionic strength of the system, providing a suitable catalytic environment for the recombinase and DNA polymerase. Experiments show that when the concentration of Tris-HCl is 15 mM, the KCl concentration is 75 mM, and the (NH4)2SO4 concentration is 15 mM, the DNA polymerase activity is increased by 15%-20% compared to other concentration combinations.

[0027] In some feasible methods, the concentration of the MgAc2 solution is 260-300 mM, preferably 280 mM, this concentration is due to the presence of Mg... 2+ It is a key initiation factor for the RAA reaction and can activate DNA polymerase activity. Too low a concentration will lead to slow reaction initiation and low amplification efficiency, while too high a concentration will inhibit enzyme activity. At 280mM, efficient amplification can be achieved within 15-20 minutes.

[0028] In addition, the RAA basic buffer also includes recombinase, single-strand binding protein, DNA polymerase and dNTPs. The recombinase can bind primers and search for target sequences on the DNA strand. The single-strand binding protein can stabilize the unwound single-stranded DNA and prevent it from renaturing. The DNA polymerase is responsible for extending the primers to form double-stranded amplification products. The dNTPs provide raw materials for amplification. The four work together to achieve rapid amplification at isothermal temperature.

[0029] The negative control is sterile double-distilled water or genomic DNA from non-soil-producing algae (such as genomic DNA from Nostoccommune FACHB-261), used to eliminate false positives caused by contamination during the experiment and ensure the reliability of the test results.

[0030] In some feasible embodiments, to achieve visual detection of the amplification products, the kit further includes a lateral flow chromatography test strip, which is composed of a sample pad, a conjugate pad, a detection zone, a control zone, and an absorbent pad connected in sequence. In this invention, the conjugate pad is coated with a fluorescein isothiocyanate (FITC) antibody-colloidal gold complex. When the amplification product diffuses from the sample pad to the conjugate pad, the FITC modification of the reverse primer in the product can bind to the FITC antibody on the conjugate pad, forming a "FITC-antibody-colloidal gold" complex. The detection zone is coated with an anti-biotin antibody, which can specifically bind to the biotin modification of the probe in the amplification product, causing the "FITC-antibody-colloidal gold-amplification product-anti-biotin antibody" complex to be enriched and colored in the detection zone. The control zone is coated with an anti-fluorescein isothiocyanate antibody, which can capture the "FITC antibody-colloidal gold" complex that has not bound to the amplification product, ensuring the effectiveness of the test strip itself. The above structural design allows for intuitive judgment of results through dual strips (quality control area and detection area), single strip (quality control area only), or no strip (no quality control area), without the need for professional instruments.

[0031] Thirdly, the present invention also provides a detection method based on the above-mentioned primer set and kit. This method is based on sample pretreatment, RAA amplification, and product detection. It is simple to operate and time-saving. The specific steps are as follows:

[0032] S1: To obtain and preprocess water samples for DNA template, drinking water sources such as reservoirs and lakes are preferred. Thermal lysis is used for preprocessing. Thermal lysis requires no complex nucleic acid extraction kits, is simple to operate, and is quick, making it suitable for field applications. The specific operation is as follows:

[0033] First, a 0.2-0.22μm filter membrane is used, preferably a 0.22μm mixed cellulose ester filter membrane. The pore size of this filter membrane can effectively trap cyanobacterial cells. The diameter of cyanobacterial cells is usually 3-10μm, which cannot pass through the 0.22μm filter membrane. Small molecule impurities in the water can be initially separated through the filter membrane, thereby enriching the water sample.

[0034] The filter membrane enriched with cyanobacteria is placed in sterile water, specifically sterile double-distilled water, to avoid introducing exogenous DNA contamination.

[0035] The centrifuge tubes containing the filter membrane and sterile water were then heated at 95-105℃ for 5-8 minutes, preferably 100℃, for 6 minutes. Heating at 100℃ for 6 minutes effectively lyses the cyanobacterial cell wall and cell membrane, releasing intracellular DNA, while avoiding DNA degradation caused by excessively high temperatures or prolonged heating. Experiments have verified that after heating at 100℃ for 6 minutes, the DNA integrity is good and can meet the requirements for RAA amplification.

[0036] Finally, the solution was filtered through a 0.4-0.45 μm filter membrane, preferably a 0.45 μm mixed cellulose ester filter membrane. This filtration removed impurities such as lysed cell debris, preventing these impurities from inhibiting the activity of the subsequent RAA amplification enzyme. The filtrate was collected as a DNA template. This DNA template can be stored at -70°C for more than 3 months, facilitating subsequent retesting.

[0037] S2: Using the DNA template obtained in step S1 as a template, RAA amplification is performed using the primer set to obtain the amplification product. The total volume of the RAA amplification reaction system is 50 μL. 50 μL is the optimal volume that balances amplification efficiency and reagent usage. If the volume is too large, the reaction time will be prolonged, and if the volume is too small, errors are likely to occur.

[0038] Specifically, the total volume of the RAA amplification reaction system was 50 μL, and the volumes and concentrations of each component were as follows:

[0039] RAA basic buffer 28-32 μL, preferably 29.4 μL, this volume can ensure that the enzyme and raw material concentrations in the buffer are appropriate;

[0040] Adding 2-3 μL of MgAc2 solution, preferably 2.5 μL, combined with a MgAc2 concentration of 280 mM, can reduce the amount of Mg in the reaction system. 2+ The final concentration reached 14 mM, which is the optimal concentration for enzyme activity.

[0041] 2-4 μL of DNA template, preferably 2 μL. Too much template may introduce more inhibitors, while too little template may lead to insufficient amplification products. Experimental results show that 2 μL of template can reduce the impact of inhibitors while ensuring amplification efficiency.

[0042] The final concentrations of the forward primer, reverse primer, and probe are all 0.1-1.0 μM. In practical applications, the final concentrations of the forward primer are approximately 0.42 μM, the reverse primer is approximately 0.6 μM, and the probe is approximately 0.12 μM, all within this concentration range. This final concentration ensures that the primers and probes bind to the template efficiently.

[0043] The preferred amounts of each component in the RAA amplification reaction system are: 2 μL DNA template, 2.1 μL forward primer, 3 μL reverse primer, 0.6 μL geoA gene detection probe, 29.4 μL basal buffer, 2.5 μL MgAc2 solution, and the remaining volume is brought to 50 μL with sterile double-distilled water. The ratio of forward primer, reverse primer, and probe ensures sufficient binding of the primers and probe to the target sequence while avoiding primer dimer formation. The final concentration of the forward primer, reverse primer, and geoA gene detection probe is 0.1-1.0 μM, preferably 0.4-0.6 μM. This concentration range balances amplification efficiency and specificity; too low a concentration results in low probability of primer binding to the target sequence and fewer amplification products, while too high a concentration easily leads to non-specific binding.

[0044] Furthermore, the reaction conditions for RAA amplification in this invention are a constant temperature reaction at 37-41℃ for 15-20 min, preferably at 39℃ for 16 min. 39℃ is the optimal temperature for the RAA reaction, which allows the recombinase, DNA polymerase, and nfoase to work synergistically to achieve the best activity. 16 min ensures that the amplification product reaches a detectable level.

[0045] 39℃ is the optimal reaction temperature for recombinase and DNA polymerase in the RAA system, which can achieve the highest amplification efficiency. A reaction time of 16 minutes is sufficient to make the amplification products detectable. Experimental tests have shown that after reacting at 39℃ for 16 minutes, the amount of amplification products is sufficient to be detected by the lateral flow test strip, without the need to extend the reaction time.

[0046] During amplification, the recombinase first mediates the specific binding of the primers to the template DNA, enabling the forward and reverse primers to bind to specific sites on the geoA gene template. Single-strand binding protein (SSB) binds to the unwound single-stranded DNA to maintain its single-stranded state. Subsequently, the nfo enzyme recognizes and cleaves the tetrahydrofuran site on the probe. DNA polymerase then extends the strand starting from the cleaved probe, ultimately forming a double-stranded amplification product containing FITC and biotin. This specific amplification process is only initiated when the geoA gene of geosmogonia is present in the sample.

[0047] S3: Visual detection of RAA amplification products was performed using lateral flow test strips. The specific steps were as follows: First, dilution was performed by taking 2 μL of amplification product and diluting it 50 times with sterile double-distilled water (dilution of 50 times can avoid false negatives caused by excessive concentration of amplification product; Experiment 1 verified that the signal-to-noise ratio of the test strip was highest when diluted 50 times); then, sample loading was performed by inserting the sample pad end of the lateral flow chromatography test strip into the diluted amplification product, ensuring that the liquid level did not exceed the immersion mark of the sample pad to avoid excessive wetting of the test strip due to excessive liquid level, which would affect band formation; finally, interpretation was performed by placing the strip at room temperature for 1-5 minutes and recording the results within 10 minutes.

[0048] The interpretation criteria are as follows: a positive result is indicated by the appearance of red bands in both the control area and the test area, indicating the presence of soil-producing algae in the sample; a negative result is indicated by the appearance of red bands only in the control area, indicating the absence of soil-producing algae in the sample; and a negative result is indicated by the absence of red bands in the control area, indicating an invalid test that needs to be repeated. This interpretation criterion has been verified by testing 35 reservoir samples and is completely consistent with the PCR results.

[0049] Beneficial effects:

[0050] (1) This invention significantly overcomes the bottleneck of existing detection technology for soil-producing cyanobacteria by optimizing the primer set, reagent kit, and detection method, and has many outstanding advantages. In terms of specificity, the primer set is designed based on the conserved region of the geoA gene. The forward primer, reverse primer, and probe sequences have no homology with the nucleic acids of non-soil-producing cyanobacteria. Moreover, the reverse primer is modified with fluorescein isothiocyanate, and the probe is modified with biotin-phosphorylation-tetrahydrofuran triple modification to synergistically block non-specific amplification. In practical applications, it can effectively amplify soil-producing cyanobacteria such as Anabaena, Oscillatoria, and Trichophyton, and has no amplification signal for non-soil-producing cyanobacteria. It has good specificity, completely solves the false positive problem caused by cross-reaction in existing technologies, and ensures accurate detection results.

[0051] (2) In terms of sensitivity, the detection method provided by this invention can detect 1-2 geosmogrin-producing cyanobacteria cells / reaction or 30-50 copies of the geoA gene / reaction, specifically 3.56 × 10⁻⁶. 2 One plasmid containing the geoA gene / reaction, 5.63 × 10⁻⁶ -1 The detection limit of ng-generating cyanobacterial DNA / reaction is far higher than that of existing headspace solid-phase microextraction-gas chromatography-mass spectrometry, enabling detection of cyanobacterial concentrations below 10 ng in water. 4 Effective detection can be achieved at a level of cells / mL (invisible to the naked eye), which can issue an early warning before geosmin-producing cyanobacteria proliferate in large quantities and geosmin accumulates significantly, thus buying sufficient time for pollution control of drinking water sources and preventing a decline in the sensory quality of drinking water due to excessive geosmin.

[0052] (3) The kit of the present invention integrates all components of sample pretreatment, amplification and detection, without the need for additional complex equipment: sample pretreatment can be completed with only a constant temperature mixer, RAA amplification can be carried out in a constant temperature mixer or water bath, without the need for thermal cycling equipment such as PCR instruments, and the products can be visualized and interpreted through test strips, without the need for large precision instruments. The entire detection process can be completed within 30-50 minutes and can be operated at an ambient temperature of 5-35℃. The results can be interpreted without the need for professional technicians, and it is fully applicable to on-site scenarios such as drinking water sources and waterworks, breaking the limitation of existing technologies that can only be detected in the laboratory, and realizing real-time on-site monitoring of soil-producing cyanobacteria.

[0053] (4) The detection method of the present invention has simple steps. The sample pretreatment only requires three steps: filtration, heating and re-filtration. RAA amplification and product detection do not require complicated reagent preparation and instrument debugging. The reagents in the kit are all pre-packaged and can be used directly, which reduces the operation threshold. At the same time, the cost of RAA reagents and side-flow chromatography test strips is much lower than that of gas chromatography-mass spectrometry consumables and PCR kits. The cost of a single detection is only 1 / 20 of that of solid phase microextraction, gas chromatography, mass spectrometry and other methods and 1 / 5 of that of PCR method. It is easy to promote and apply on a large scale in grassroots units such as water plants and environmental monitoring stations, and provide economical and reliable technical support for drinking water source protection and water treatment process optimization.

[0054] In summary, this invention achieves the goals of "high specificity, high sensitivity, on-site availability, and low cost" in the detection of soil-producing cyanobacteria through precise primer design, integrated reagent kit construction, and simplified detection process. It can effectively support early warning of eutrophication and ensure drinking water safety, and has significant practical value.

[0055] The present invention will be explained in detail below with reference to the accompanying drawings and specific embodiments. Attached Figure Description

[0056] Figure 1 Flowchart of a method for recombinase-mediated isothermal amplification combined with nuclease cleavage and lateral flow chromatography detection of soil-producing osmidrosis algae;

[0057] Figure 2 This is a schematic diagram of the structure of the single-target disposable nucleic acid test strip (JY0201) of the present invention;

[0058] Figure 3 The results of the test strips used in this invention to perform RAA amplification on positive algae and negative controls using primer sets GSM-1, GSM-2, GSM-3, and GSM-4 of geosmin;

[0059] Figure 4 Comparison of GSM-2RAA amplification results of geosmin primer sets with different concentrations of reverse primers in this invention;

[0060] Figure 5 The optimal detection system for geosmin-specific RAA-LFS in this invention was used to detect RAA-LFS in various cyanobacteria; negative control (sterile double-distilled water);

[0061] Figure 6 This demonstrates the sensitivity of the geosmin RAA test strip detection system based on gradient dilution of positive template and plasmid in this invention.

[0062] Figure 7 The results of RAA-LFS and PCR detection of the geoA gene in 35 reservoir samples in this invention are shown. Detailed Implementation

[0063] To facilitate understanding of the present invention, a more comprehensive description of the present invention will be given below with reference to the accompanying drawings, which illustrate several embodiments of the present invention. However, the present invention can be implemented in different forms and is not limited to the embodiments described in the text. Rather, these embodiments are provided to make the disclosure of the present invention more thorough and comprehensive.

[0064] Unless otherwise stated, the terminology used in this invention generally has the meanings commonly understood by those skilled in the art. Various processes and methods not described in detail in the embodiments are conventional methods known in the art.

[0065] Unless otherwise specified, the experimental methods described in the following examples are conventional. Unless otherwise specified, the experimental materials, consumables, and reagents used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0066] I. Preparation of Experimental Materials

[0067] 1.1 Algal species and water samples

[0068] The algal strains involved in this invention are all preserved in the Freshwater Algal Culture Collection of the Chinese Academy of Sciences, specifically including:

[0069] *Aphanizomenon gracile strain AG*, *Anabaenacylindrica* FACHB-170, *Anabaena minutissima* FACHB-250, *Nostoccommune* FACHB-261, *Oscillatoria sp.* FACHB-1120, *Pseudanabaenacinerea* FACHB-1277, *Planktothricoides raciborskii* FACHB-1360, *Aerosakkonema funiforme* FACHB-1362, *Aerosakkonema funiforme* FACHB-1363, *Planktothricoides raciborskii* FACHB-1372, *Anabaena sp.* FACHB-1384, *Anabaena* These are 13 species, including sp. FACHB-1391 and Anabaena sp. FACHB-1501.

[0070] Water samples were collected from a drinking water source reservoir in Ningbo City. After sampling, the samples were immediately placed on ice for preservation and transported back to the laboratory within 4 hours, where they were temporarily stored in a 4°C refrigerator to ensure the freshness of the samples.

[0071] 1.2 Reagents and Consumables

[0072] RAA amplification reagent: RNA isothermal rapid amplification kit (test strip type)-III from Anpu Future (Changzhou) Biotechnology Co., Ltd., catalog number WLRN8211KIT, containing RAA basic buffer and enzyme mixture (recombinase, single-stranded binding protein, DNA polymerase).

[0073] Primers and probes: synthesized by General Biosystems (Anhui) Co., Ltd., with HPLC-grade purity. Specific sequences and modifications are described in subsequent examples.

[0074] nfo enzyme (endonuclease IV): used to cleave the tetrahydrofuran site of the probe;

[0075] Chemical reagents: CTAB (hexadecyltrimethylammonium bromide), chloroform, isopropanol, 75% ethanol, ampicillin, LB broth medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0), all of analytical grade;

[0076] Plasmid extraction reagent: Bacterial plasmid miniprep kit, used for recombinant plasmid extraction;

[0077] Filter membrane: A mixed cellulose ester filter membrane with pore sizes of 0.22μm and 0.45μm, used for algae enrichment and impurity filtration;

[0078] Centrifuge tubes: 1.5mL and 0.2mL sterile centrifuge tubes;

[0079] Lateral flow chromatography test strip: Tiosbio® Nucleic Acid Lateral Flow Chromatography Test Strip (Beijing Baoying Tonghui Biotechnology Co., Ltd.), model includes single-target disposable nucleic acid test strip (JY0201).

[0080] 1.3 Instruments and Equipment

[0081] Thermomixer: used for RAA amplification reaction (39℃ isothermal) and algal thermal lysis (100℃ heating);

[0082] High-speed centrifuge: used for centrifugation (12000 rpm) and plasmid extraction during CTAB DNA extraction;

[0083] Ultra-micro spectrophotometer: used to determine plasmid DNA concentration and purity (OD260 / OD280 ratio);

[0084] Gel imaging system: used for observing the results of agarose gel electrophoresis of PCR products and plasmids;

[0085] Pipettes: Capacity range 0.5-10μL, 10-100μL, 100-1000μL, used for precise transfer of reagents and samples;

[0086] High-pressure steam sterilizer: used for sterilization of laboratory consumables (centrifuge tubes, filter membranes, etc.);

[0087] Clean bench: Used for aseptic operations (such as plasmid extraction, bacterial inoculation) to avoid contamination;

[0088] Water bath: Used for preheating CTAB extraction buffer (65°C).

[0089] 1.4 Sample Preparation Method

[0090] 1.4.1 DNA extraction from laboratory-cultured algae (CTAB method)

[0091] This method is used to obtain high-purity algal genomic DNA to support primer screening and plasmid construction. The specific steps are as follows:

[0092] (1) Take the culture medium of algae cultured in the laboratory, filter it through a 0.22μm filter membrane under negative pressure to enrich algal cells, and scrape the algae on the filter membrane into a sterile mortar;

[0093] (2) Preheat 2×CTAB extraction buffer (containing 2%CTAB, 100mM Tris-HCl, 20mM EDTA, 1.4M NaCl, pH 8.0) in a 65℃ water bath for 30 minutes.

[0094] (3) Add a small amount of liquid nitrogen to the mortar and grind the algae into powder quickly. During the process, continuously replenish the liquid nitrogen to prevent the algae cells from degrading.

[0095] (4) Transfer the ground algae powder to a 1.5 mL sterile centrifuge tube, add 1000 μL of preheated 2×CTAB buffer, and gently invert the centrifuge tube 3-5 times to mix the algae powder and buffer thoroughly.

[0096] (5) Place the centrifuge tubes in a 65°C water bath and keep them warm for 30 minutes. Gently invert the tubes once every 10 minutes to ensure complete lysis.

[0097] (6) After the centrifuge tube has cooled to room temperature (about 2 minutes), add an equal volume of chloroform, tighten the cap, and shake vigorously for 2-3 minutes to fully emulsify the chloroform with the aqueous phase;

[0098] (7) Place the centrifuge tube into a high-speed centrifuge and centrifuge at 12,000 rpm for 10 minutes. At the same time, take a new 1.5 mL sterile centrifuge tube and add 600 μL of isopropanol.

[0099] (8) After centrifugation, slowly aspirate the upper aqueous phase with a pipette (avoid aspirating the intermediate protein layer), transfer it to a centrifuge tube containing isopropanol, and gently invert it up and down for 30 seconds until white DNA flocculent material appears in the tube;

[0100] (9) Centrifuge at 12000 rpm for 1 minute, immediately pour out the liquid in the tube, invert the centrifuge tube on a clean paper towel, and drain the remaining liquid;

[0101] (10) After 60 seconds, stand the centrifuge tube upright, add 700 μL of 75% ethanol, gently rotate the tube to allow the DNA precipitate to float in the ethanol, and soak for 5 minutes.

[0102] (11) Centrifuge at 12000 rpm for 1 minute, discard the ethanol, add 800 μL of 75% ethanol again, and repeat the soaking and centrifugation steps once.

[0103] (12) Centrifuge at 12000 rpm for 30 seconds, completely discard the ethanol, invert the centrifuge tube on a paper towel, and place at room temperature for 15-20 minutes to allow the DNA to dry completely;

[0104] (13) Add 100 μL of sterile double-distilled water to the centrifuge tube, gently tap the bottom of the tube to fully dissolve the DNA, store at 4°C for later use, or store at -20°C for long-term use.

[0105] 1.4.2 DNA extraction from reservoir samples (thermal lysis method)

[0106] This method is used for rapid pretreatment of water samples in the field, without the need for complex purification, and is suitable for on-site testing. The specific steps are as follows:

[0107] (1) Take 10 mL of water sample from the reservoir and slowly inject it into a filter device containing a 0.22 μm filter membrane using a syringe. Use negative pressure filtration to enrich algae. After filtration, use sterile tweezers to place the filter membrane into a 1.5 mL sterile centrifuge tube.

[0108] (2) Add 1 mL of sterile double-distilled water to the centrifuge tube, tighten the cap, place it in a constant temperature mixer preheated to 100°C, heat for 6 minutes to lyse the algal cell wall and release DNA.

[0109] (3) After heating, wait for the centrifuge tube to cool to room temperature, use a syringe to draw up the lysate in the tube and inject it into a filter device equipped with a 0.45μm filter membrane to filter out unlysed cell debris and filter membrane fibers.

[0110] (4) Transfer the filtered liquid into a new 1.5mL sterile centrifuge tube, which is the DNA template. It can be used immediately for RAA amplification or stored in a -70℃ ultra-low temperature freezer for more than 3 months.

[0111] Example 1: Design and screening of geoA gene-specific primer set and probes from soil-producing cyanobacteria

[0112] This embodiment aims to design and screen RAA primer sets and probes that can specifically amplify the geoA gene of soil-producing cyanobacteria, determine the optimal combination with no false positives and high specificity, and lay the foundation for subsequent detection systems.

[0113] Using the geoA gene as the target gene, a core functional gene in the geosmin synthesis pathway with extremely high conservation in geosmin-producing cyanobacteria, 50 highly similar geoA gene sequences were obtained from the NCBI database. After multiple sequence alignment to determine the conserved amplification region, and analysis of the target gene sequence characteristics, species-specific amplification primers were designed using Primer Premier 5.0 software. Primer design strictly adhered to the following principles:

[0114] The amplification primer length is controlled within the range of 20-30 bp, and the annealing temperature difference between the forward and reverse primers does not exceed 5℃ to ensure that the target sequence can be bound synchronously under the same isothermal conditions.

[0115] The length of the amplification product is controlled within the range of 200-500bp, balancing RAA amplification efficiency and species specificity;

[0116] The primer amplification region was compared using NCBI's BLAST function to exclude homology with the nucleic acid sequence of non-soil-producing cyanobacteria, thus preliminarily verifying the specificity.

[0117] The primer amplification region sequences were compared using the BLAST function of the National Center for Biotechnology Information (NCBI) to preliminarily identify the primer amplification specificity. The identified primers were synthesized by General Biosystems (Anhui) Co., Ltd., with a purity level of HPLC. The specific primer sequences are shown in Table 1 below:

[0118] Table 1: Primers for basic amplification of geosmin-specific RAA

[0119]

[0120] For the regions amplified by specific primers, species-specific probe sequences were designed using Primer Premier 5.0 software.

[0121] The probe sequence is located in the middle region of the amplification primers and is modified with tetrahydrofuran. The probe design follows these principles:

[0122] (1) The length is controlled within the range of 45-50 nt to ensure the binding specificity with the target sequence;

[0123] (2) The sequence is located within the amplification region of the forward and reverse primers;

[0124] (3) Biotin is modified at the 5' end for capture in the detection zone of subsequent lateral flow test strips;

[0125] (4) The 3' end is modified with a phosphate group to inhibit the elongation of nonspecific DNA strands;

[0126] (5) The sequence contains a tetrahydrofuran-modified cleavage site for specific recognition and cleavage by the nfo enzyme;

[0127] (6) The design direction is consistent with the forward primer to avoid competition with the primer when binding to the target sequence.

[0128] The specific primer sequences, probes, and amplification reverse primer labels are shown in Table 2.

[0129] In this embodiment, a total of 4 primer-probe combinations were designed, denoted as GSM-1, GSM-2, GSM-3, and GSM-4, respectively. The specific sequences and modification methods are shown in Table 2 below:

[0130] Table 2: Primer sets for RAA-nfo amplification of the geoA gene in four groups

[0131]

[0132] The primers and probes mentioned above were synthesized by General Biosystems (Anhui) Co., Ltd., with a purity level of HPLC grade, to ensure the specificity of amplification and detection.

[0133] In this embodiment, the RNA isothermal rapid amplification kit (strip type)-III (WLRN8211KIT) from Anpu Future (Changzhou) Biotechnology Co., Ltd. was used. Positive algal DNA was used as a template to perform RAA amplification of each primer set for geosmin. (See attached reference.) Figure 1 The screening experiment is performed as follows:

[0134] (1) Preparation of positive template: Anabaena sp. FACHB-1391, a soil-producing cyanobacterium, was used as the positive algae species. Its genomic DNA was extracted by CTAB method. The DNA concentration and purity were determined by ultra-micro spectrophotometer. The concentration was adjusted to 100 ng / μL to ensure that the OD260 / OD280 ratio was between 1.8 and 2.0.

[0135] (2) Negative control setup: Sterile double-distilled water was used as a blank negative control, and genomic DNA of the non-soil-producing cyanobacterium Nostoc commune FACHB-261 was used as a non-target negative control.

[0136] (3) Preparation of RAA amplification system: Each primer-probe combination was repeated 3 times, and the total volume of the amplification system was 50 μL. The amounts of each component were as follows:

[0137]

[0138] Add the above components sequentially to 0.2 mL sterile centrifuge tubes, gently pipette to mix, avoiding the formation of air bubbles; add 2.5 μL of 280 mM MgAc2 solution to each centrifuge tube, immediately tighten the cap, gently invert to mix 3 times, and briefly centrifuge (3000 rpm, 10 seconds) to collect the liquid to the bottom of the tube.

[0139] (4) RAA amplification reaction: Place the centrifuge tube in a constant temperature mixer, set the temperature to 39℃, and react at a constant temperature for 16 minutes;

[0140] (5) Lateral flow test strip detection: After the amplification reaction is complete, take 2 μL of amplification product, add 98 μL of sterile double-distilled water (i.e., dilute 50 times), and mix gently; take out the single-target disposable nucleic acid test strip, attach... Figure 2 This is a schematic diagram of the structure of the single-target disposable nucleic acid test strip JY0201. The test strip includes a sample pad, a conjugation pad, a T-line in the detection area, a C-line in the quality control area, and an absorbent pad. Insert the sample pad end of the test strip vertically into the diluted amplification product, ensuring the liquid level does not exceed the immersion mark on the sample pad. After the liquid has completely saturated the reading area of ​​the test strip, place the test strip flat on a clean lab bench and let it sit at room temperature for 1 minute. Observe and record the color development results within 10 minutes.

[0141] (6) Result interpretation criteria: If both the control area C line and the test area T line show red bands, it is judged as positive; if only the control area C line shows red bands, it is judged as negative; if no red bands appear in the control area C line, regardless of whether the test area shows color, it is judged as invalid and the experiment needs to be repeated.

[0142] Appendix Figure 3 The image shows the detection results of test strips using geosmin primer sets GSM-1, GSM-2, GSM-3, and GSM-4 to amplify RAA in positive algae and negative controls. The above screening results are attached. Figure 3 As shown, specifically:

[0143] The positive template detection results of groups GSM-1, GSM-3, and GSM-4 were all positive, but the negative controls all showed T-line coloration in the detection area, indicating false positives. This could not rule out contamination interference during the experiment and did not meet the screening requirements. The positive template detection result of group GSM-2 was positive, with clear coloration of both the C-line in the quality control area and the T-line in the detection area. The negative control only showed coloration of the C-line in the quality control area, with no false positives. Sequencing verification of the amplification product from group GSM-2 confirmed that the amplified fragment was a specific sequence of the geoA gene, with a fragment length of 265 bp, consistent with the design expectation of 200-500 bp. Therefore, GSM-2 was determined to be the optimal primer-probe combination, namely, the forward primer geo-F sequence is 5'-CTATAAGCGCAGTCAGGATCTAATT-3', the reverse primer geo-R1 sequence is 5'-GTATTCAATGGGGTTAGCAATGCGA-3', and the probe geo-P2 sequence is:

[0144] 5'-TTCCCCTTCCCACGAACCCAGTAGAGCGCGHTTTAGCTGACTTGTG-3', where H is tetrahydrofuran.

[0145] Example 2: Preparation of alignment disk containing recombinant plasmid with geoA gene

[0146] In this embodiment, a standardized plasmid template was prepared as the quantitative basis for subsequent sensitivity experiments and as a positive control for the kit, ensuring that the experimental results are reproducible.

[0147] 2.1 Construction and culture of recombinant plasmids are shown below:

[0148] (1) Using the genomic DNA of Anabaenasp.FACHB-1391 as a template, the geoA gene fragment was obtained by amplification using the GSM-2 primers (geo-F and geo-R1) selected in Example 1.

[0149] (2) The amplified geoA gene fragment was ligated to the vector to construct a recombinant plasmid containing the geoA gene; the recombinant plasmid was transformed into competent Escherichia coli cells. The specific operation steps were as follows: 50 μL of competent Escherichia coli cells were taken, 10 μL of recombinant plasmid ligation product was added, and the cells were placed on ice for 30 minutes; heat shock was performed at 42℃ for 90 seconds, followed by immediate ice incubation for 2 minutes; 500 μL of antibiotic-free LB broth medium was added, and the cells were cultured on a shaker at 37℃ and 200 rpm for 1 hour.

[0150] (3) Spread 100 μL of culture onto an LB solid plate containing ampicillin (final concentration 100 μg / mL) and incubate upside down at 37°C for 16 hours; pick 3 single colonies and inoculate them into 5 mL of LB broth containing ampicillin, and incubate overnight at 37°C and 200 rpm. Verify positive colonies by bacterial PCR (primers are geo-F and geo-R1 of GSM-2 group). Positive colonies are used for subsequent plasmid extraction.

[0151] 2.2 Extraction and Concentration Determination of Recombinant Plasmids

[0152] Pick PCR-positive colonies and inoculate them into 50 mL of LB broth containing ampicillin. Incubate overnight at 37°C and 200 rpm for about 16 hours.

[0153] Take 30 mL of bacterial culture and extract recombinant plasmids using a bacterial plasmid miniprep kit. Follow the kit instructions: Add RNase A-containing resuspension to the bacterial culture to fully resuspend the bacterial pellet; add lysis buffer, gently invert the centrifuge tube 5 times, and incubate at room temperature for 2 minutes; add neutralization buffer, immediately invert to mix, and centrifuge at 12000 rpm for 10 minutes; take the supernatant and add it to the adsorption column, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid; add washing buffer I, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid; add washing buffer II, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid; place the adsorption column into a new centrifuge tube, add 50 μL of elution buffer, incubate at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the eluent, which is the recombinant plasmid solution;

[0154] The concentration of the recombinant plasmid solution and the OD260 / OD280 ratio were determined using an ultra-micro spectrophotometer. The determination was repeated three times, and the average value was taken. The results showed that the concentration of the recombinant plasmid was 64.4 ng / μL, and the OD260 / OD280 ratio was 1.92, which met the experimental requirements. An OD260 / OD280 ratio of 1.8-2.0 indicates that the plasmid purity is high and there is no obvious protein or RNA contamination.

[0155] 2.3 Plasmid copy number calculation and gradient dilution

[0156] Copy number calculation: According to the formula: Plasmid copy number (copies / μL) = (plasmid concentration × 6.02 × 10⁻⁶) / (plasmid concentration × 6.02 × 10⁻⁶) 23 ) / (total plasmid length × 660), calculate the copy number of the recombinant plasmid;

[0157] Calculate the copy number and dilute to 1.92 × 10⁻⁶. 10 Copy / μL, store at -20℃ for later use.

[0158] Serial dilution: Take 10 μL of the recombinant plasmid stock solution (concentration 1.92 × 10⁻⁶). 10The concentration was 1.92 × 10⁻⁶ copies / μL, diluted to 100 μL with sterile double-distilled water to obtain a concentration of 1.92 × 10⁻⁶. 9 A dilution of 1 copy / μL was prepared; and so on, 10-fold serial dilutions were performed to obtain concentrations of 1.92 × 10⁻⁶. 8 Copies / μL, 1.92 × 10 7 Copies / μL, 1.92 × 10 6 Copies / μL, 1.92 × 10 5 Copies / μL, 1.92 × 10 4 Copies / μL, 1.92 × 10 3 Copies / μL, 1.92 × 10 2 Copies / μL, 1.92 × 10 1 Copies / μL, 1.92 × 10 0 A plasmid dilution of 1 copy / μL is used to construct a complete plasmid alignment disk;

[0159] Storage: Aliquot the plasmid dilutions of each concentration into 0.2mL sterile centrifuge tubes, 10μL per tube, and store at -20℃ for later use. Avoid repeated freeze-thaw cycles to prevent plasmid stability.

[0160] Example 3: Optimization of the RAA amplification system using GSM-2 primer set

[0161] This embodiment optimizes the addition volume of the GSM-2 primer set (mainly reflected in the reverse primer concentration) to explore the effect of different primer addition amounts on detection sensitivity and specificity, determine the optimal addition volume, and avoid primer dimers or false positives caused by excessive primers, or decreased sensitivity caused by insufficient primers. The test strip detection product is a double-stranded amplification product of the probe after nfo enzyme digestion and the reverse primer (FITC modified). Therefore, theoretically, under the condition that other reaction conditions remain unchanged, increasing the amount of reverse primers can help improve the sensitivity of RAA nucleic acid test strip detection. However, excessive addition of reverse primers can also increase the probability of reverse primer-probe primer dimer formation, leading to false positives.

[0162] In this embodiment, recombinant plasmid DNA constructed from positive algal genes was used as the template for RAA amplification, and the geosmin-specific detection primer set GSM-2 was used for RAA-nfo amplification. GSM-2 includes a forward primer geo-F, a probe geo-P2, and a reverse primer geo-R1. The 5′ end of geo-F is unlabeled, the 5′ end of geo-P2 is modified with biotin, the 3′ end is phosphorylated and a tetrahydrofuran cleavage site is set inside the probe, and the 5′ end of geo-R1 is modified with FITC.

[0163] This embodiment maintains the same amount of forward primer geo-F and probe geo-P2, while only varying the amount of reverse primer geo-R1, and optimizes the amount of reverse primer by gradient. Each group used 2 μL of plasmid DNA constructed from positive algal genes as a template, and a negative control group was set up, using an equal volume of sterile double-distilled water instead of template.

[0164] Experimental operation steps

[0165] (1) Preparation of RAA amplification system: The total volume of the RAA reaction system is 50 μL. The amounts of the components used in each gradient reaction system are shown in the table below:

[0166]

[0167] The final concentrations of geo-R1 were 0.60 μM, 0.70 μM, and 0.80 μM, respectively. The amounts of geo-F and geo-P2 added remained constant in all three systems, with final concentrations of 0.42 μM and 0.12 μM, respectively. The total volumes of the primer sets were 5.7 μL, 6.2 μL, and 6.7 μL, respectively, corresponding to the primer set addition volume gradient set in the original experiment.

[0168] When preparing the solution, first add all components except MgAc2 to a 0.2 mL sterile centrifuge tube and gently mix them by pipetting. After adding the MgAc2 solution, gently invert the centrifuge tube three times and centrifuge briefly (3000 rpm, 10 seconds) to collect the liquid to the bottom of the tube, avoiding the generation of air bubbles.

[0169] (2) RAA amplification reaction: Place the centrifuge tube in a constant temperature mixer, set the temperature to 39℃, and react at a constant temperature for 16 minutes;

[0170] (3) Lateral flow test strip detection: After the amplification reaction is completed, take 2 μL of amplification product, dilute it 50 times with sterile double-distilled water, and then perform test strip detection. Observe and record the color development results.

[0171] Test results as follows Figure 4 (Comparison of amplification results for GSM-2RAA primer sets with different concentrations of reverse primers added) is shown in the figure:

[0172] Gradient 1 (5.7 μL): The blank negative control showed a negative result, with only the C line showing color; plasmid 10 7 10-fold serial dilution (concentration: 10) 3 copy / μL), plasmid 10 8 10-fold serial dilution (concentration: 10) 2 (copy / μL) and plasmid 10 9 10-fold serial dilution (concentration: 10) 1All samples (copy / μL) tested positive, and both the C-line and T-line showed color simultaneously, with the T-line showing clear color.

[0173] Gradient 2 (6.2 μL): The blank negative control test result was negative; plasmid 10 7 10-fold serial dilution (concentration: 10) 3 (copy / μL) and plasmid 10 8 10-fold serial dilution (concentration: 10) 2 All samples (copy / μL) tested positive, and plasmid 10 9 10-fold serial dilution (concentration: 10) 1 The test result for (copy / μL) was negative, with only the C line showing color, indicating decreased sensitivity.

[0174] Gradient 3 (6.7 μL): The blank negative control test result was negative; plasmid 10 7 10-fold serial dilution (concentration: 10) 3 The test result (copy / μL) was positive, and the plasmid was 10 copies / μL. 8 10-fold serial dilution (concentration: 10) 2 copy / μL), plasmid 10 9 10-fold serial dilution (concentration: 10) 1 All tests (copy / μL) were negative, indicating a significant decrease in sensitivity.

[0175] Based on the test results, the optimal addition volume of the GSM-2 primer set was determined to be 5.7 μL. At this volume, effective detection of low-concentration plasmid templates can be achieved while ensuring no false positives and no primer dimers.

[0176] Example 4: Specificity verification of the GSM-2 primer set RAA-LFS system

[0177] This embodiment verifies the specific recognition ability of the GSM-2 primer set RAA-LFS system for geosmo ...

[0178] Experimental materials

[0179] Cyanobacteria samples: All 13 cyanobacteria were obtained from the Freshwater Algae Culture Bank of the Chinese Academy of Sciences. The specific species and geoserotonin-producing characteristics are as follows:

[0180] Soil-producing algae: *Aphanizomenon gracile strain* AG, *Anabaenasp. FACHB-1391*, *Anabaena sp. FACHB-1501*;

[0181] Non-aerozoic algae: *Anabaena cylindrica* FACHB-170, *Anabaena minutissima* FACHB-250, *Nostoc commune* FACHB-261, *Oscillatoriasp.* FACHB-1120, *Pseudanabaena cinerea* FACHB-1277, *Planktothricoides raciborskii* FACHB-1360, *Aerosakkonema funiforme* FACHB-1362, *Aerosakkonema funiforme* FACHB-1363, *Planktothricoides raciborskii* FACHB-1372, *Anabaena sp.* FACHB-1384.

[0182] Blank negative control: sterile double-distilled water;

[0183] Detection system: The optimal system determined in Example 3, namely, primer set Mix addition volume 5.7 μL, RAA amplification conditions 39℃ isothermal reaction for 16 minutes.

[0184] The experimental procedure is as follows:

[0185] DNA template preparation: DNA was extracted from all 13 cyanobacteria using the thermal lysis method. The specific operation was carried out as described above: 10 mL of laboratory culture medium from each cyanobacterium was taken and enriched through a 0.22 μm filter membrane; 1 mL of sterile double-distilled water was added and heated at 100 °C for 6 minutes; the mixture was filtered through a 0.45 μm filter membrane; the filtrate was collected as the DNA template.

[0186] RAA amplification reaction: Prepare 50 μL of reaction solution according to the optimal system, set up 3 replicates for each cyanobacterial strain, and set up a blank negative control at the same time; place the reaction tube in a constant temperature mixer and react at 39℃ for 16 minutes.

[0187] Lateral flow test strip detection: Take 2 μL of amplification product, dilute it 50 times with sterile double-distilled water, and perform the detection according to the steps described in Example 1. Record the color development results for each cyanobacterium.

[0188] The above test results are as follows Figure 5 (The optimal detection system for geosmin-specific RAA-LFS for various cyanobacteria is shown in the following graphs. The blank negative control is sterile double-distilled water.)

[0189] Only strain AG, Anabaena sp. FACHB-1391, and Anabaena sp. FACHB-1501 showed positive results, meaning both the control area (C line) and the test area (T line) clearly showed colored bands, with no false negatives. All others were negative, meaning only the control area (C line) showed a blue band, and the test area (T line) showed no color development, with no false positives.

[0190] Blank negative control: Only the C line in the quality control area shows color, while the T line in the detection area shows no color.

[0191] The above results indicate that the GSM-2 primer set RAA-LFS system has strict specificity, can accurately distinguish between soil-producing and non-soil-producing cyanobacteria, and has no cross-reactivity, meeting the specificity requirements in practical detection.

[0192] Example 5: Sensitivity analysis of the GSM-2 primer set RAA-LFS system

[0193] In this embodiment, soil-producing cyanobacteria cells and recombinant plasmids containing the geoA gene were used as templates. Through gradient dilution experiments, the lowest detection limit of the GSM-2 primer set RAA-LFS system was determined, and the detection capability of the system for low concentrations of soil-producing cyanobacteria was verified, providing data support for early warning of drinking water sources.

[0194] Experimental materials:

[0195] Cell template: Logarithmic phase culture of Anabaena sp. FACHB-1391 was counted using a hemocytometer (observed under an optical microscope, with the average of three fields of view counted), and then serially diluted with sterile LB medium to obtain cell suspensions with concentrations of 1130 cells / reaction, 113 cells / reaction, 11.3 cells / reaction, and 1.13 cells / reaction.

[0196] Plasmid template: The recombinant plasmid alignment disk prepared in Example 2, with a concentration of 1.92 × 10⁻⁶. 3 Copies / μL, 1.92 × 10 2 Copies / μL, 1.92 × 10 1 Copies / μL, 1.92 × 10 0 Four concentration gradients per copy / μL;

[0197] Detection system: The optimal system determined in Example 3, namely primer set Mix 5.7 μL, reacted at 39℃ for 16 minutes.

[0198] The above test results are as follows Figure 6 (The sensitivity diagram of the geosmin RAA test strip detection system based on gradient dilution of positive template and plasmid is shown below:)

[0199] Cell templates: Templates at concentrations of 1130 cells / reaction, 113 cells / reaction, and 11.3 cells / reaction all showed positive results in three replicates, with clear T-line development; templates at a concentration of 1.13 cells / reaction also showed positive results in three replicates, with weak but still clearly identifiable T-line development, indicating that this concentration was effective for detection; therefore, the limit of detection for soil-producing cyanobacteria was determined to be 1.13 cells / reaction.

[0200] Plasmid template: concentration 1.92 × 10⁻⁶ 3 Copies / μL, 1.92 × 10 2 Copies / μL, 1.92 × 10 1 The template concentration was 1.92 × 10⁶ copies / μL, and all three replicates were positive; 0 With 2 μL of template, all three replicates were negative; calculated based on 2 μL of template, the result was 1.92 × 10⁻⁶. 1 The copy number in the reaction system corresponding to the copy / μL template was 38.4. Based on the detection results, the limit of detection for the geoA gene was determined to be 38.4 copies / reaction.

[0201] The above results indicate that the GSM-2 primer set RAA-LFS system has high sensitivity and can detect extremely low concentrations of geostinocyanobacteria, even at concentrations below 10 in water bodies. 4 Effective detection can be achieved at a concentration of cells / mL (invisible to the naked eye), meeting the need for early warning of geosmodium pollution in drinking water sources.

[0202] Example 6: Validation of the GSM-2 primer set RAA-LFS system on actual reservoir water samples

[0203] This embodiment uses 35 water samples from Ningbo drinking water source reservoirs as the testing objects. By comparing with conventional PCR methods, it verifies the accuracy and reliability of the GSM-2 primer set RAA-LFS system in practical application and evaluates the applicability of the system in drinking water source monitoring.

[0204] Experimental materials:

[0205] Water samples from reservoirs: 35 samples were collected from three different drinking water source reservoirs in Ningbo City. After sampling, the samples were preserved in an ice bath and transported back to the laboratory within 4 hours. DNA was extracted using the above-mentioned thermal lysis method.

[0206] PCR control method: The geoA gene-specific PCR primers reported by John et al. (2018) were used. The upstream primer sequence was 5'-GCCCTTTTCGACGATTTCAA-3', and the downstream primer sequence was 5'-GGAAGCACTATTACGCAATTCAAA-3'. The PCR reaction system (50 μL) consisted of: 5 μL of 10×PCR buffer, 4 μL of dNTPs (10 mM), 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), 0.5 μL of Taq enzyme (5 U / μL), 3 μL of DNA template, and 35.5 μL of sterile double-distilled water.

[0207] Amplification conditions: 95℃ pre-denaturation for 1 minute, 40 cycles (95℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds), 72℃ extension for 5 minutes; the amplified products were detected by 1.5% agarose gel electrophoresis, and the presence of a specific band of 265bp was considered positive, while the absence of a band was considered negative.

[0208] Detection system: GSM-2 primer set RAA-LFS optimal system (same as Example 3).

[0209] The experimental procedure is as follows:

[0210] RAA-LFS detection: Take 2 μL of thermally lysed DNA template from each water sample, prepare 50 μL of reaction solution according to the optimal system, and react at 39℃ for 16 minutes; take 2 μL of amplification product, dilute it 50 times, and test it with test strips, and record the positive / negative results for each water sample;

[0211] PCR detection: Take 3 μL of thermally lysed DNA template from each water sample and amplify it according to the PCR system and conditions described above; after amplification, take 10 μL of the product for 1.5% agarose gel electrophoresis, observe the bands using a gel imaging system, and record the results;

[0212] Results Comparison: The detection results of RAA-LFS and PCR methods were statistically analyzed, and the consistency between the results of the two methods was calculated.

[0213] The above test results are as follows Figure 7 (Figure showing the RAA-LFS and PCR detection results of the geoA gene in 35 reservoir samples) and Table 4 below:

[0214] Table 4: RAA-LFS and PCR detection results of the geoA gene in 35 reservoir samples

[0215]

[0216] Note: "+" indicates a positive result, meaning the sample contains cyanobacteria that produce cyanobacteria; "-" indicates a negative result, meaning the sample does not contain cyanobacteria that produce cyanobacteria.

[0217] The results showed that among the 35 reservoir water samples, the RAA-LFS system detected 12 positive samples and 23 negative samples. The number of positive and negative samples detected by the conventional PCR method was completely consistent with that of the RAA-LFS method, and the results of the two methods were 100% consistent. Meanwhile, the concentration of geosmin in the positive water samples was determined according to the "Test Method for Odor Substances Geosmin and 2-Methylisoborneol in Drinking Water" (GB / T32470-2016). The results showed that the geosmin concentration in the positive water samples was ≥3 ng / L, directly corresponding to the RAA-LFS detection results. This further proves that the system can be accurately applied to the detection of geosmin-producing cyanobacteria in actual reservoir water samples, providing reliable technical support for the management of drinking water source quality.

[0218] Comparative Example 1: Comparison of the RAA-LFS method of this invention with conventional PCR methods

[0219] This comparative example compares the GSM-2 primer set RAA-LFS method of this invention with the existing conventional PCR method (same as Example 6) from four dimensions: detection efficiency, sensitivity, instrument dependence, and operational complexity, to verify the effectiveness of this invention in overcoming the defects of the prior art.

[0220] (1) Detection efficiency

[0221] The RAA-LFS method of this invention takes approximately 30-35 minutes from water sample collection to obtaining the test results. The specific time allocation is as follows: 12 minutes for thermal pyrolysis pretreatment, 16 minutes for RAA amplification, and 2 minutes for lateral flow test strip detection. The entire process does not require waiting for instrument heating or program settings and can be operated continuously.

[0222] Conventional PCR method: The entire process takes about 2.5 hours, specifically allocated as follows: 30 minutes for column purification pretreatment (requiring multiple centrifugations and washing), 1.5 hours for PCR amplification (including waiting for the thermal cycling program), and 30 minutes for agarose gel electrophoresis and imaging (requiring gel preparation, electrophoresis, and UV imaging). The steps require waiting for the instrument to complete the preceding operations and cannot be performed continuously.

[0223] The comparison shows that the detection efficiency of the method of the present invention is significantly higher than that of the conventional PCR method, and the time taken is only 1 / 4 of that of the PCR method. It can realize the rapid detection of soil-producing cyanobacteria and meet the needs of on-site real-time monitoring.

[0224] (2) Sensitivity

[0225] Using serially diluted cell suspensions of Anabaena sp. FACHB-1391 as templates, two methods were used for detection:

[0226] The method of this invention has a detection limit of 1.13 soil-producing cyanobacteria cells / reaction, which can detect extremely low concentrations of cyanobacterial contamination.

[0227] Conventional PCR method: The limit of detection is 10 cyanobacterial cells producing geosmolybdenum per reaction; below this concentration, clear electrophoretic bands cannot be obtained.

[0228] The sensitivity of the method of this invention is about 9 times higher than that of conventional PCR methods, enabling early detection of soil-producing cyanobacteria before they proliferate in large quantities, thus providing sufficient time for pollution control.

[0229] (3) Instrument dependence

[0230] The method of this invention requires only a portable constant temperature mixer and a lateral flow test strip, without the need for a fixed power supply or laboratory environment, and can be operated directly at the drinking water source; the test strip detection requires no additional instruments, and the results can be interpreted with the naked eye;

[0231] Conventional PCR methods rely on PCR instruments and gel imaging systems. Both types of instruments require a stable 220V power supply and a horizontal experimental platform, and must be used in a clean laboratory environment. They cannot be used outside of a laboratory setting.

[0232] The method of this invention has low instrument dependence and its field applicability is significantly better than that of conventional PCR methods, which can meet the mobile monitoring needs of grassroots water sources.

[0233] (4) Operational complexity

[0234] The method of this invention: Water sample pretreatment uses pyrolysis, requiring only three steps: filtration, heating, and re-filtration, without the need for complex reagent kits; RAA amplification is a one-step isothermal reaction, requiring only the mixing of reagents in the correct proportions, without the need to adjust temperature parameters; results can be interpreted by visually observing the bands on the test strip, and testing personnel can operate independently after one hour of training; Amplification is performed by sealing the reaction tube and interpreting the results using lateral flow chromatography test strips, which can reduce the risk of contamination caused by traditional amplification product opening, electrophoresis, and other operations;

[0235] Conventional PCR methods involve several steps: water sample pretreatment requires column purification to remove nucleic acid impurities, including adding lysis buffer, centrifugation, column chromatography, washing, and elution, which is cumbersome and prone to introducing contamination; PCR amplification requires complex thermal cycling programs (requiring professional personnel to fine-tune parameters); result interpretation requires professional personnel to analyze electrophoresis bands under UV light, which can easily lead to misinterpretation due to blurred or non-specific bands; and electrophoresis requires opening the cap to handle amplification products, posing a risk of aerosol contamination and potentially causing false positives in subsequent experiments.

[0236] The method of this invention has a much lower operational complexity than conventional PCR methods, making it more suitable for promotion and application in grassroots monitoring units or on-site testing scenarios.

[0237] Comparative Example 2: Comparison of the RAA-LFS method of this invention with the headspace solid-phase microextraction-gas chromatography-mass spectrometry method (GB / T32470-2016)

[0238] This comparative study compares the method of this invention with the existing national standard method for detecting geosmin compounds, highlighting the advantages of this invention in early warning of geosmin-producing cyanobacteria.

[0239] (1) Detection targets and early warning timeframe

[0240] This invention utilizes a method that directly detects the geoA gene of geosmin-producing cyanobacteria, eliminating the need to wait for geosmin compound accumulation. This method is applicable when the concentration of cyanobacteria in the water is below 10... 4 Algae can be detected at a concentration of cells / mL (invisible to the naked eye), and the early warning time can be 3-7 days in advance, making it convenient to take timely measures to control algae (such as adding algaecides or adjusting the water plant process).

[0241] National standard method: To detect the geosmin compound itself, the geosmin concentration must reach the limit (10ng / L) specified in the "Standards for Drinking Water Quality" (GB5749-2022) to be detectable; at this time, cyanobacteria have already proliferated in large quantities, and some algal cells may have ruptured and released geosmin, which significantly increases the difficulty of subsequent treatment and misses the opportunity for early intervention.

[0242] The method of this invention can achieve early warning of "algae not multiplying in large quantities and taste not appearing", and the warning timeliness is significantly better than the national standard method.

[0243] (2) Detection efficiency and cost

[0244] The method of this invention takes 30-50 minutes in total, and the cost of a single test is about 50 yuan, mainly for primers, test strips and reagents; it can process multiple samples at the same time and does not require dedicated personnel to be on duty.

[0245] National standard method: The entire process takes more than 4 hours (including 2 hours for sample pretreatment and 2 hours for instrument analysis), requires a gas chromatography-mass spectrometry (purchase cost ≥ 500,000 yuan, annual maintenance cost ≥ 20,000 yuan); the cost of a single test is about 1,000 yuan (including consumables, reagents and instrument depreciation); the instrument operation requires certified professionals and cannot process samples in batches;

[0246] The method of this invention has significant advantages in both detection efficiency and cost, and is suitable for large-scale water source sample screening.

[0247] (3) On-site applicability

[0248] The method of this invention requires no large instruments; the detection equipment can be packed into a portable case, and the entire process from sample pretreatment to result interpretation can be completed on-site at the water source; no laboratory environment is required, and it can be operated outdoors at room temperature.

[0249] National standard method: Gas chromatography-mass spectrometry is bulky and requires fixed installation, and can only be used in professional laboratories; water samples need to be transported from the site back to the laboratory (which may cause geosmin volatilization or concentration changes); the pretreatment process requires the use of organic reagents (such as dichloromethane), which poses safety risks and requires a professional fume hood;

[0250] The method of this invention has far superior field applicability compared to the national standard method, and can meet the needs of real-time monitoring and emergency testing of drinking water sources.

[0251] Comparative Example 3: Comparison of the RAA-LFS method of this invention with loop-mediated isothermal amplification (LAMP) technology

[0252] This comparative example compares the method of the present invention with the existing isothermal amplification technology (LAMP) to verify that the present invention overcomes the shortcomings of the existing isothermal technology.

[0253] (1) Primer design and specificity

[0254] The method of this invention requires only the design of 3 primers / probes (1 pair of amplification primers + 1 detection probe), based on the conserved region of the geoA gene, and the specificity can be preliminarily verified by NCBIBLAST; the design cycle is about 3 days, and the primer synthesis success rate is 100%; in actual detection, there is no cross-reactivity with non-geosin-producing cyanobacteria, and the false positive rate is 0%.

[0255] LAMP method: requires the design of 4-6 primers (including 2 inner primers, 2 outer primers, and 2 loop primers), and the primers need to cover 6 different regions of the target gene, which is difficult to design; it is easy to fail due to non-specific binding between primers, and the design cycle is about 7-10 days; in actual detection, false positives are easy to occur with non-target cyanobacteria templates, with a false positive rate of about 5%, which requires additional verification;

[0256] The primer design of the method of the present invention is simpler and more specific, and can effectively avoid false positive interference.

[0257] (2) Amplification time and product detection

[0258] The method of this invention: sufficient amplification products can be obtained by reacting at a constant temperature of 39℃ for 16 minutes, which meets the detection requirements of the test strip; the products are visually detected by the lateral flow test strip, without the need for additional instruments, and the result interpretation time is ≤5 minutes;

[0259] LAMP method: requires constant temperature reaction at 65℃ for 60-90 minutes to obtain detectable amplified products; product detection relies on turbidimeter (to detect magnesium pyrophosphate precipitation) or fluorescence detector (to detect fluorescent dye signal), and results cannot be interpreted without the instruments; turbidimetry is easily affected by water sample impurities, and fluorescence method requires the addition of fluorescent dye (increasing cost and operation steps); the method of this invention has a faster amplification speed and more convenient product detection, without relying on additional detection instruments.

[0260] (3) Anti-interference capability

[0261] The method of this invention: The sample is pretreated by thermal pyrolysis, and most impurities can be removed by a 0.45μm filter membrane; the basic buffer in the RAA amplification system contains an ionic strength regulator, which can resist the interference of low concentrations of heavy metals or organic matter in the water sample; in actual detection, the detection results of turbid water samples (turbidity ≤50NTU) show no significant deviation.

[0262] LAMP method: requires high sample purity. Impurities in water samples (such as humic acid and heavy metals) can easily inhibit DNA polymerase activity, leading to false negatives. Additional column purification is required (increasing the number of steps and costs), otherwise the test results are unstable.

[0263] The method of this invention has stronger anti-interference ability, lower requirements for water sample purity, and is more suitable for water sample testing in complex water sources.

[0264] In summary, the GSM-2 primer set RAA-LFS method established by this invention through primer set screening, amplification system optimization, and actual water sample verification is significantly superior to existing technologies (conventional PCR, national standard compound detection method, LAMP) in terms of specificity, sensitivity, detection efficiency, and field applicability. It can effectively support the early warning and real-time monitoring of local geosmocyanin algae in drinking water sources, and provide reliable technical support for water quality safety management.

[0265] The present invention has been described by way of example in conjunction with the accompanying drawings. Obviously, the specific implementation of the present invention is not limited to the above-described manner. Any non-substantial improvement made by adopting the inventive concept and technical solution of the present invention, or the direct application of the inventive concept and technical solution of the present invention to other occasions without modification, shall be within the protection scope of the present invention.

Claims

1. A primer set for detecting the geoA gene in soil-producing cyanobacteria, characterized in that, The primer set can specifically recognize and amplify the geoA gene of soil-producing algae to achieve targeted detection of soil-producing algae; the primer set includes geoA gene detection primers and geoA gene detection probe geo-P2; the geoA gene detection primers include a forward primer geo-F and a reverse primer geo-R1, and the 5' end of the reverse primer geo-R1 is modified with fluorescein isothiocyanate; The 5' end of the geoA gene detection probe geo-P2 is modified with biotin, so that the amplification product formed by the probe is biotin-labeled, so that it can be detected by lateral flow chromatography test strips; the 3' end of the probe geo-P2 is modified with a phosphate group, which is used to inhibit nonspecific DNA strand elongation. The nucleotide sequence of the forward primer geo-F is: 5'-CTATAAGCGCAGTCAGGATCTAATT-3'; The nucleotide sequence of the reverse primer geo-R1 is: 5'-GTATTCAATGGGGTTAGCAATGCGA-3'; The nucleotide sequence of the geoA gene detection probe geo-P2 is: 5'-TTCCCCTTCCCACGAACCCAGTAGAGCGCGHTTTAGCTGACTTGTG-3', where H is tetrahydrofuran.

2. The primer set according to claim 1, characterized in that, The design of the forward and reverse primers follows these principles: (1) The nucleotide lengths of the forward and reverse primers are both 20-30 bp, and the difference in annealing temperature between the forward and reverse primers does not exceed 5°C to ensure consistency of amplification reaction conditions; (2) When the forward primer and the reverse primer are used together to amplify the geoA gene, the length of the amplified product is 200-500 bp, and the amplified product can be used for the specific detection of geoA gene in soil-producing algae.

3. The primer set according to claim 1, characterized in that, The geoA gene detection probe geo-P2 has a length of 45-50 nt, and the probe binds to the target region between the forward primer geo-F and the reverse primer geo-R1 in the geoA gene.

4. The primer set according to claim 3, characterized in that, The probe also satisfies the following conditions: (1) The design direction is positive, consistent with the nucleotide extension direction of the positive primer; (2) The nucleotide length is 45–50 nt; (3) The geoA gene detection probe has a cleavage site inside its sequence. When the probe binds to the geoA gene template, the cleavage site can be recognized and cleaved by the nfo enzyme, and the cleavage can initiate the DNA chain extension reaction.

5. A reagent kit for detecting soil-producing cyanobacteria, characterized in that, It includes the primer set as described in any one of claims 1-4, and the reagents required for recombinase-mediated isothermal amplification reactions.

6. The reagent kit according to claim 5, characterized in that, The concentration of the MgAc2 solution is 260-300 mM; The reagents required for the recombinase-mediated isothermal amplification reaction include RAA basal buffer, MgAc2 solution, and negative control. The RAA basal buffer includes recombinase, single-stranded binding protein, DNA polymerase, and dNTPs; The negative control is sterile double-distilled water or genomic DNA from non-soil-producing algae.

7. The reagent kit according to claim 6, characterized in that, It also includes a lateral flow chromatography test strip, which includes a sample pad, a conjugation pad, a detection zone, a control zone, and an absorbent pad; the conjugation pad is provided with a colloidal gold-labeled antifluorescein isothiocyanate antibody; the detection zone is provided with a biotin-binding molecule for capturing biotin-labeled nucleic acid amplification products; and the control zone is provided with a capture molecule for capturing the colloidal gold-labeled antifluorescein isothiocyanate antibody.

8. A method for detecting soil-producing cyanobacteria, characterized in that, Includes the following steps: S1: Obtain the water sample to be tested and preprocess it to obtain the DNA template; S2: Using the DNA template obtained in step (1) as a template, perform RAA amplification using the primer set described in any one of claims 1-4 to obtain the amplification product; S3: The RAA amplification products are visually detected using lateral flow test strips. Based on the detection results, it is determined whether the sample contains soil-producing algae.

9. The method according to claim 8, characterized in that, In step S1, the pretreatment is a pyrolysis method, specifically including: Water samples were enriched using 0.2-0.22 μm filter membranes. The filter membranes enriched with cyanobacteria were placed in sterile water and heated at 95-105℃ for 5-7 min. The samples were then filtered through 0.4-0.45 μm filter membranes, and the filtrate was collected as a DNA template.

10. The method according to claim 8, characterized in that, In step S2, the total volume of the RAA amplification reaction system is 50 μL, and the amounts of each component are as follows: 1-3 μL DNA template, 1.2-3.0 μL forward primer, 2.0-4.0 μL reverse primer, 0.2-1.0 μL geoA gene detection probe, 23.8-35.0 μL basal buffer, 2.0-3.0 μL MgAc2 solution, and bring the remaining volume to 50 μL with sterile double-distilled water. The final concentration of the forward primer, reverse primer, and geoA gene detection probe is 0.1-1.0 μM; the reaction conditions for RAA amplification are a constant temperature reaction at 37-41℃ for 15-20 min.

11. The method according to claim 8, characterized in that, In step S3, the amplification product is detected by lateral flow chromatography, and the specific steps are as follows: (1) Dilution: Take 2-5 μL of amplification product and dilute it 40-60 times with sterile double-distilled water; (2) Loading the sample: Insert the sample pad end of the lateral flow chromatography test strip into the diluted amplification product, ensuring that the liquid level does not exceed the immersion mark of the sample pad. (3) Interpretation: Place at room temperature for 1-5 minutes and record the results within 10 minutes; the interpretation criteria are: if a red band appears in both the quality control area and the test area, it is positive; if a red band appears only in the quality control area, it is negative; if no red band appears in the quality control area, the test is invalid.

Images