Human interleukin-6 RNA, CAR-T vector with recombinant expression, and method of production and use thereof

Description

Technical Field

[0001] This invention belongs to the technical field of tumor immunotherapy, specifically relating to a siRNA of human IL-6, recombinant expression CAR-T vector (especially a CAR-T transgene vector used for the remission of CRS by knocking down IL-6) and their construction methods and applications.Background Art

[0002] The theoretical basis of tumor immunotherapy is that the immune system can identify tumor-associated antigens and regulate the body to attack tumor cells (highly specific cytolysis). In the 1950s, Burnet and Thomas made the theory of "immunological surveillance" that holds that mutational tumor cells that often occur in the body can be identified and eliminated by the immune system, laying a theoretical foundation for tumor immunotherapy [Burnet FM. Immunological aspects of malignant disease. Lancet, 1967;1: 1171-4]. Then, a host of tumor immunotherapies, including cytokine therapy, monoclonal antibody therapy, adoptive immunotherapy and vaccine therapy, have been applied to clinical practice.

[0003] In 2013, CAR-T, a more advanced tumor immunotherapy, was successfully put to clinical use, and showed unprecedented clinical effects. CAR-T is short for Chimeric Antigen Receptor T-Cell Immunotherapy. Clinically, the most leading CAR-T is Novartis' CLT019. For patients with refractory-relapsed acute lymphoblastic leukemia and treated with CLT019, the six-month tumor progression-free survival rate can reach 67%, and the longest response time can be more than two years. By cooperating with hospitals, Shanghai Unicar Biomedical Technology Co., Ltd., a Shanghai-based company, treated 36 patients with refractory-relapsed acute lymphoblastic leukemia, among whom 24 as a percentage of 66.6% experienced complete remission. It's a subversive breakthrough in anti-cancer research. CAR-T may be one of the therapies that are the most likely to cure cancer, and was named the best in top 10 breakthroughs of science and technology 2013 by the journal Science.

[0004] In spite of the significant curative effect of CAR-T, in the treatment with the therapy, there may be a special clinical syndrome, of which common clinical manifestations are fever, hypotension, shivering, and a neurological symptom related to a range of significantly elevated cytokine levels in serum and called Cytokine Release Syndrome (CRS). The occurrence mechanism of the syndrome is that after the binding of antigen to T cell receptor, T cell is activated and releases a series of cytokines including IL-6, giving rise to a systematic inflammatory reaction, of which delayed treatment is likely to cause pulmonary edema and then the death of patients (see FIG. 1 for the signaling pathway of IL-6).

[0005] Currently, clinically, inflammatory reaction can be inhibited by intravenously injecting antihistamine (such as chlorphenamine maleate), or corticosteroid (such as hydrocortisone); however, correspondingly, CAR-T cell's killing effect on tumor is inhibited, leading to a higher relapse rate of such patients and affecting the curative effect of CAR-T.

[0006] Another feasible treatment option is to use commercialized Tocilizumab (yamero ®< ) to control the occurrence level of CRS. Tocilizumab is human IL-6 receptor monoclonal antibody. The specific binding of Tocilizumab to IL-6 receptor can block IL-6 signal transduction to reduce acute phase reactants, hepcidin products, B cell activation, bone resorption and transformation of cartilage and inhibit the differentiation from T-lymphocyte to Th17 cell to effectively control inflammatory reaction. However, Tocilizumab also has some obvious drawbacks. First, it's very expensive. A Tocilizumab injection for 10kg of body weight is priced at about RMB 2,000, and an adult patient generally needs 5 ones at a time, which is hard for average families to afford. Second, patients injected with Tocilizumab are vulnerable to infection later in treatment, as their IL-6 receptors are blocked.

[0007] Since 1990s, researchers have discovered that double-stranded RNA ("dsRNA") can be used to inhibit the expression of protein. As such ability of silent gene has great potential in the treatment of human diseases, a great many researchers and commercial entities have invested considerable resources in the development of therapies based on the technology.

[0008] From a mechanism perspective, after entering plant and invertebrate cells, dsRNA is broken down by Type III endonuclease Dicer into siRNA. [Sharp, RNA interference-2001, Genes Dev.2001, 15:485]. Type III endonuclease Dicer breaks dsRNA down into siRNA with 2 base bulges and 3' sticky ends. [Bernstein, Caudy, Hammond, & Hannon, Role for a bidentate ribonuclease in the initiation step of RNA interference, Nature 2001, 409:363]. In the integration of siRNA with RNA-induced Silencing Complex (RISC), one or more helicase(s) in RISC unwind(s) double-stranded siRNA, making complementary antisense strands direct target recognition. [Nykanen, Haley, & Zamore, ATP requirements and small interfering RNA structure in the RNA interference pathway, Cell 2001, 107:309]. After the integration with corresponding target mRNA, one or more endonuclease(s) in RISC cleave(s) target mRNA, giving rise to mRNA silencing. [Elbashir, Elbashir, Lendeckel, & Tuschl, RNA interference is mediated by 21-and 22-nucleotide RNAs, Genes Dev 2001, 15:188].

[0009] Such interference effect can last long and remain effective after cell division. And RNAi has very good sequence specificity. [Kisielow, M. et al. (2002) Isoform-specific knockdown and expression of adaptor protein ShcA using small interfering RNA, J. of Biochemistry 363: 1-5]. Therefore, RNAi can knock down a type of transcript with its specificity and without affecting other mRNAs with similar sequences. Such features enable siRNA system to show its potential and value in the inhibition of gene expression, gene function research and medicine target validation. In addition, siRNA system can be used to treat relevant diseases, including (1) diseases caused by gene overexpression or misexpression and (2) diseases caused by gene mutation.Open Technical Problems for the Invention

[0010] This invention aims to eliminate the drawbacks of existing technology and provide a siRNA of human IL-6, recombinant expression vector and their construction methods and applications. TEOH HOON KOON ET AL: LEUKEMIA RESEARCH, NEW YORK.NY, US, vol. 40, 17 October 2015 (2015-10-17), pages 44-53, XP029375396, ISSN: 0145-2126 DOI: 10.1016 / J.LEUKRES.2015.10.004 relates to small interfering RNA silencing of interleukin-6 in mesenchymal stromal cells inhibiting multiple myeloma cell growth. WO 2014 / 011984 A1 relates to compositions and methods for treating cancer in a patient. In one embodiment of WO 2014 / 011984 A1, the method comprises a first-line therapy comprising administering to a patient in need thereof a genetically modified T cell expressing a CAR wherein the CAR comprises an antigen binding domain, a transmembrane domain, a costimulatory signaling region, and a CD3 zeta signaling domain and monitoring the levels of cytokines in the patient post T cell infusion to determine the type of second-line of therapy appropriate for treating the patient as a consequence of the presence of the CAR T cell in the patient. EP 1 591 525 A2 relates to oligoribonucleotides which induce the degradation of mRNA of enzymes and structures involved in the inflammatory process of the skin and which are particularly suitable for the prophylaxis and treatment of inflammatory skin conditions and / or for the protection of the skin of sensitively determined skin. US 2005 / 261222 A1 concerns oligoribonucleotides which induce the degradation of mRNA in enzymes and structures involved in the inflammation process of the skin and which are particularly suitable for the prophylaxis and treatment of inflamed skin conditions and / or for skin protection with skin determined as sensitive. WO 2007 / 064846 A2 relates to compositions and methods using siRNA to target various genes expressed in cells of transplanted organs or tissues and / or genes expressed in the host to improve the success of the transplantation. WO 2008 / 109350 A2 relates to meroduplex ribonucleic acid molecules (mdRNA) capable of decreasing or silencing IL6 gene expression. WO 2007 / 079224 A2 relates to compositions and methods using siRNA to target various genes expressed in cells of injured tissue during scar formation to promote scar-free wound healing.Problem SolutionTechnical Solution

[0011] The invention is set out in the appended set of claims.

[0012] Purposes of the disclosure will be achieved with the following technical solutions:

[0013] The first purpose of the disclosure is to provide a siRNA of human IL-6, and the said siRNA is selected from nucleotide sequence as shown in SEQ ID NO.45 and SEQ ID NO.46.

[0014] Disclosed herein is a siRNA of human IL-6, and the said siRNA is selected from any of the following items: a. nucleotide sequence as shown in SEQ ID NO.43 and SEQ ID NO.44; b. nucleotide sequence as shown in SEQ ID NO.47 and SEQ ID NO.48; c. nucleotide sequence as shown in SEQ ID NO.49 and SEQ ID NO.50; d. nucleotide sequence as shown in SEQ ID NO.51 and SEQ ID NO.52; e. nucleotide sequence as shown in SEQ ID NO.53 and SEQ ID NO.54; f. nucleotide sequence as shown in SEQ ID NO.55 and SEQ ID NO.56; and g. nucleotide sequence as shown in SEQ ID NO.57 and SEQ ID NO.58.

[0015] The second purpose of the disclosure is to provide the siRNA of the disclosure for use in a method of treating or alleviating the CRS.

[0016] The third purpose of the disclosure is to provide a recombinant expression vector comprising the said siRNA.

[0017] Further, the said expression vector is lentiviral expression vector, retroviral expression vector, adenovirus expression vector, adeno-associated virus expression vector or plasmid; lentiviral expression vector comprising the said siRNA is preferable.

[0018] Further, the said lentiviral expression vector comprises the prokaryotic replicon pUC Ori sequence for plasmid replication, as shown in SEQ ID NO.2; AmpR sequence with Ampicillin resistance gene for the massive proliferation of target strains, as shown in SEQ ID NO.1; virus-replicon SV40 Ori sequence for enhancing replication in eukaryocyte, as shown in SEQ ID NO.3; lentivirus packaging cis element for lentivirus packaging; ZsGreen1 green fluorescent protein for expressing green fluorescence in eukaryocytes, as shown in SEQ ID NO.11; IRES ribosome binding sequence for the common transcription and expression of protein, as shown in SEQ ID NO.12; human EF1α promoter for the eukaryotic transcription of chimeric antigen receptor genes, as shown in SEQ ID NO.14; encoding genes of anti-CD19 chimeric antigen receptors for making up the second or third generation CAR integrating identification, transmission and promotion, as shown in SEQ ID NO.52 or SEQ ID NO.53; enhanced woodchuck hepatitis virus post-transcriptional regulatory element (eWPRE) for enhancing transgene expression efficiency, as shown in SEQ ID NO.13; human RNA polymerase III promoter hU6 for intracellular transcription of siRNA, as shown in SEQ ID NO.14.

[0019] Further, the second generation lentiviral vectors employed by the said lentivirus packaging cis element comprise lentivirus 5 terminal LTR, as shown in SEQ ID NO.5, lentivirus 3 terminal Self-Inactivating LTR, as shown in SEQ ID NO.6, Gag cis element, as shown in SEQ ID NO.7, RRE cis element, as shown in SEQ ID NO.8, env cis element, as shown in SEQ ID NO.9, and cPPT cis element, as shown in SEQ ID NO.10.

[0020] Further, the third generation lentiviral vectors employed by the said lentivirus packaging cis element comprise lentivirus 5 terminal LTR, as shown in SEQ ID NO.5, lentivirus 3 terminal Self-Inactivating LTR, as shown in SEQ ID NO.6, Gag cis element, as shown in SEQ ID NO.7, RRE cis element, as shown in SEQ ID NO.8, env cis element, as shown in SEQ ID NO.9, cPPT cis element, as shown in SEQ ID NO.10, and RSV promoter, as shown in SEQ ID NO.4.

[0021] Further, the said eWPRE has 6 enhanced nucleotide mutations, which are g.396G>A, g.397C>T, g.398T>C, g.399G>A, g.400A>T, g.411A>T.

[0022] Further, the said anti-CD19 chimeric antigen receptors (the second generation CAR) comprise serialized CD8 leader chimeric receptor signal peptide, as shown in SEQ ID NO.16, CD19 single-chain antibody light chain VL, as shown in SEQ ID NO.17, Optimal Linker C, as shown in SEQ ID NO.18, CD19 single-chain antibody heavy chain VH, as shown in SEQ ID NO.19, CD8 chimeric receptor hinge, as shown in SEQ ID NO.20, CD8 chimeric receptor transmembrane, as shown in SEQ ID NO.21, CD137 chimeric receptor co-stimulatory factor, as shown in SEQ ID NO.22, and TCR chimeric receptor T cell activation domain, as shown in SEQ ID NO.23.

[0023] Further, the said anti-CD19 chimeric antigen receptors (the third generation CAR) comprise serialized CD8 leader chimeric receptor signal peptide, as shown in SEQ ID NO.16, CD19 single-chain antibody light chain VL, as shown in SEQ ID NO.17, Optimal Linker C, as shown in SEQ ID NO.18, CD19 single-chain antibody heavy chain VH, as shown in SEQ ID NO.19, CD8 chimeric receptor hinge, as shown in SEQ ID NO.20, CD8 chimeric receptor transmembrane, as shown in SEQ ID NO.21, CD28 chimeric receptor co-stimulatory factor, as shown in SEQ ID NO.24, CD137 chimeric receptor co-stimulatory factor, as shown in SEQ ID NO.22, and TCR chimeric receptor T cell activation domain, as shown in SEQ ID NO.23.

[0024] The fourth purpose of the disclosure is to provide a construction method for recombinant expression vector comprising the said siRNA, which involves the following steps: (1) Storing in the lentiviral skeleton plasmid pLenti-3G silencer the AmpR sequence with Ampicillin resistance gene (as shown in SEQ ID NO.1), prokaryotic replicon pUC Ori sequence (as shown in SEQ ID NO.2), virus-replicon SV40 Ori sequence (as shown in SEQ ID NO.3), lentivirus packaging cis element used for lentivirus packaging, ZsGreen1 green fluorescent protein (as shown in SEQ ID NO.11), IRES ribosome binding sequence (as shown in SEQ ID NO.12), enhanced woodchuck hepatitis virus post-transcriptional regulatory element (eWPRE) (as shown in SEQ ID NO.13), and human RNA polymerase III promoter hU6 (as shown in SEQ ID NO.14); (2) Combining the human EF1α promoter (as shown in SEQ ID NO.15) and anti-CD19 chimeric antigen receptors used for making up the second or third generation CAR integrating identification, transmission and promotion into, and cloning into lentiviral skeleton plasmid through enzyme digestion, ligation and recombination reactions, the design scheme for the second or third generation CAR, to get the recombinant lentiviral plasmid pCAR19-silencer designed with the second or third generation CAR; (3) Respectively cloning into the recombinant lentiviral plasmid got through step (2) the said siRNA and the negative control sequence as shown in SEQ ID NO.41 and SEQ ID NO.42 to get IL-6 knock-down recombinant lentiviral plasmids (pCAR19-1762~pCAR19-1769 and pCAR19-1761 of negative control); (4) Transfecting recombinant lentiviral plasmids (pCAR19-1761~pCAR19-1769) got through step (3) together with lentiviral packaging plasmids pPac-GP and pPac-R as well as membrane protein plasmid pEnv-G, respectively into HEK293T / 17 cell, and collecting supernatant containing recombinant lentiviral vectors, which will be released into cell culture supernatant if packaged successfully and after gene transcript expression in HEK293T / 17 cell; and (5) Respectively getting recombinant lentiviral vectors by purifying recombinant lentivirus supernatant got through step (4) with Ion exchange modes of extraction filtration, adsorption, elution.

[0025] Further, in step (1), the second generation lentiviral vectors employed by the said lentivirus packaging cis element, include the lentivirus 5 terminal LTR as shown in SEQ ID NO.5, lentivirus 3 terminal Self-Inactivating LTR as shown in SEQ ID NO.6, Gag cis element as shown in SEQ ID NO.7, RRE cis element as shown in SEQ ID NO. 8, env cis element as shown in SEQ ID NO.9, and cPPT cis element as shown in SEQ ID NO.10; the third generation lentiviral vectors employed by the said lentivirus packaging cis element, include the lentivirus 5 terminal LTR as shown in SEQ ID NO.5, lentivirus 3 terminal Self-Inactivating LTR as shown in SEQ ID NO.6, Gag cis element as shown in SEQ ID NO.7, RRE cis element as shown in SEQ ID NO. 8, env cis element as shown in SEQ ID NO.9, cPPT cis element as shown in SEQ ID NO.10, and RSV promoter as shown in SEQ ID NO.4.

[0026] Further, in step (2), the said anti-CD19 chimeric antigen receptors used for making up the second generation CAR integrating identification, transmission and promotion, include serialized CD8 leader chimeric receptor signal peptide as shown in SEQ ID NO.16, CD19 single-chain antibody light chain VL as shown in SEQ ID NO.17, Optimal Linker C as shown in SEQ ID NO.18, CD19 single-chain antibody heavy chain VH as shown in SEQ ID NO.19, CD8 chimeric receptor hinge as shown in SEQ ID NO.20, CD8 chimeric receptor transmembrane as shown in SEQ ID NO.21, CD137 chimeric receptor co-stimulatory factor as shown in SEQ ID NO.22, and TCR chimeric receptor T cell activation domain as shown in SEQ ID NO.23; the said anti-CD19 chimeric antigen receptors used for making up the third generation CAR integrating identification, transmission and promotion, include serialized CD8 leader chimeric receptor signal peptide as shown in SEQ ID NO.16, CD19 single-chain antibody light chain VL as shown in SEQ ID NO.17, Optimal Linker C as shown in SEQ ID NO.18, CD19 single-chain antibody heavy chain VH as shown in SEQ ID NO.19, CD8 chimeric receptor hinge as shown in SEQ ID NO.20, CD8 chimeric receptor transmembrane as shown in SEQ ID NO.21, CD28 chimeric receptor co-stimulatory factor as shown in SEQ ID NO.24, CD137 chimeric receptor co-stimulatory factor as shown in SEQ ID NO.22, and TCR chimeric receptor T cell activation domain as shown in SEQ ID NO.23.

[0027] Further, in step (1), the said eWPRE has 6 enhanced nucleotide mutations, which are g.396G>A, g.397C>T, g.398T>C, g.399G>A, g.400A>T, g.411A>T.

[0028] Further, in step (2), the whole CAR gene expression is promoted by human EF1α promoter; located at the N-terminus of CAR coding sequence, CD8 leader chimeric receptor signal peptide is used to direct the localization of CAR protein in cytomembrane; Combined into scfv region, CD19 single-chain antibody light chain VL, Optimal Linker C and CD19 single-chain antibody heavy chain VH are used to identify CD19 antigen; CD8 chimeric receptor hinge is used to anchor scfv in the lateral of cytomembrane; CD8 chimeric receptor transmembrane is used to immobilize the whole chimeric receptor onto cytomembrane; CD137 chimeric receptor co-stimulatory factor is used to stimulate T cell proliferation and cytokine secretion; TCR chimeric receptor T cell activation domain is used to activate the expression of downstream signaling pathway; when scfv region is combined with CD20 antigen, signals are transferred into cells through chimeric receptors to create a series of biological effects including T cell proliferation, increased cytokine secretion, increased anti apoptosis protein, delayed cell death and target cell lysis.

[0029] Further, in step (4), the said lentiviral vector has two versions, of which one with fluorescently tagged zsGreen1 is used for in-vitro experiment, while the other without fluorescently tagged zsGreen1 is used for clinical experiment.

[0030] Further, in step (4), through the said extraction filtration, the volume of supernatant is controlled at 200ml~2000ml, and the vacuum degree of supernatant at -0.5MPA~-0.9MPA, to prevent loss of vector caused by plugging holes; through the said extraction filtration adsorption, the PH of solution is controlled at 6~8 to prevent inactivation of vector resulting from changes in PH; through the said elution, the ionic strength of eluant is controlled at 0.5M~1.0M to prevent incomplete elution or inactivation of vector arising out of changes in ionic strength.

[0031] The fifth purpose of the disclosure is to provide a recombinant expression vector containing the siRNA of the disclosure for use in a method of treating inflammatory cytokine syndrome caused by the release of IL6 in the treatment with CAR-T.

[0032] The sixth purpose of the disclosure is to provide a CAR-T cell, which is the T lymphocyte modified by the said siRNA of the disclosure.

[0033] Another purpose of the disclosure is to provide the said CAR-T cell for use in a method of treating B lymphoma, pancreatic cancer, brain glioma and myeloma.

[0034] The disclosure is to build the human RNA polymerase III promoter hU6, human EF1α promoter, CD8 leader chimeric receptor signal peptide, CD19 single-chain antibody light chain VL, Optimal Linker C, CD19 single-chain antibody heavy chain VH, CD8 chimeric receptor hinge, CD8 chimeric receptor transmembrane, CD137 chimeric receptor co-stimulatory factor and TCR chimeric receptor T cell activation domain into recombinant lentiviral vector to use the human EF1α promoter to turn on the whole CAR gene expression, localize CAR protein on cell surface, identify CD19 antigen, stimulate T cell proliferation, and activate the expression of downstream signaling pathway; when scfv region is combined with CD20 antigen, to transfer signals into cells through chimeric receptors to create a series of biological effects including T cell proliferation, increased cytokine secretion, increased anti apoptosis protein, delayed cell death and target cell lysis; to turn on the expression of siRNA with the human RNA polymerase III promoter hU6, and via RISC complex, to degrade IL-6 mRNA and inhibit the synthesis and secretion of IL-6 to inhibit CRS.

[0035] Expression vectors employed by the disclosure include the prokaryotic replicon pUC Ori used for plasmid replication, pronucleus selection marker AmpR used for the massive proliferation of target strains, virus-replicon SV40 Ori used for enhancing replication in eukaryocyte, lentivirus packaging cis elements (RSV, 5 terminal LTR, 3 terminal Self-Inactivating LTR, Gag, RRE, env, cPPT) used for lentivirus packaging, human RNA polymerase III promoter hU6 used for intracellular transcription of siRNA, eukaryotic fluorescent labeling protein ZsGreen1 used for eukaryocyte expressing green fluorescence, co-expression element IRES used for the common transcription and expression of protein, eukaryotic promoter EF1α used for the eukaryotic transcription of chimeric antigen receptor genes, chimeric antigen receptors (CD8 leader, CD19 VL, Optimal Linker C (SEQ ID NO.19), CD19 VH, CD8 Hinge, CD8 Transmembrane, CD137, TCR) used for making up the second and third generations of CAR integrating identification, transmission and promotion, and post-transcriptional regulatory element eWPRE used for enhancing transgene expression efficiency.

[0036] The disclosure comprises peptide-containing pharmaceutical preparations, comprising: 1. Recombinant lentiviral vector skeleton made up of the human RNA polymerase III promoter hU6, AmpR sequence with Ampicillin resistance gene, prokaryotic replicon pUC Ori sequence, virus-replicon SV40 Ori sequence, RSV promoter, human EF1α promoter, lentivirus 5 terminal LTR, lentivirus 3 terminal Self-Inactivating LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element, ribosome binding sequence IRES, ZsGreen1 green fluorescent protein, and woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), which skeleton can carry different therapeutic genes and be widely used in adoptive cell therapy, and carry different siRNAs and be widely used in the treatment of diseases caused by gene overexpression, mixexpression and mutation. 2. Composing recombinant lentiviral vector of recombinant lentiviral vector skeleton, IL6-siRNA, CD8 leader chimeric receptor signal peptide, CD19 single-chain antibody light chain VL, Optimal Linker C, single-chain antibody hinge Linker A, single-chain antibody hinge Linker B, single-chain antibody hinge Linker C, CD19 single-chain antibody heavy chain VH, CD8 chimeric receptor hinge, CD8 chimeric receptor transmembrane, CD28 chimeric receptor co-stimulatory factor, CD137 chimeric receptor co-stimulatory factor and TCR chimeric receptor T cell activation domain, by which recombinant lentiviral vectors got can realize the expression of CD19 chimeric antigen receptors on human T lymphocytes, guide and activate the cytotoxicity of T lymphocyte on CD19 positive cell, and be used to clinically treat B lymphocytic leukemia, B lymphoma and multiple myeloma. Expressing the siRNA of IL-6 in human T lymphocyte can effectively reduce the expression level of IL-6, and be used to ease the Cytokine Release Syndrome (CRS).

[0037] siRNA sequence designed by the disclosure contains 21-bp nucleotide and employs the oligonucleotide pattern of N2[CG]N8[AU]N8[AU]N2. Stem-loop splicing hpRNA is employed between complementary sequences. The success rate of siRNA design has been greatly improved through the screening of siRNA pattern, GC percentage, T or A or G in a row, consecutiver GC, 3'end nt pattern, thermodynamic value, siRNA target, identity, alignment and other conditions.

[0038] In the T cell cytotoxicity assay, the system in which the human RNA polymerase III promoter hU6 transcripts siRNA to inhibit the expression of IL-6 employed by the disclosure, was found to be able to effectively inhibit the transcriptional level of mRNA upon QPCR test and effectively decrease the expression level of IL-6 in cell culture supernatant upon CBA test, and can inhibit the expression level of IL-6 in vivo and ease the symptoms of the CRS in the future.

[0039] The disclosure delivers siRNAs by means of lentiviral vectors (see FIG. 2). Firstly, it saves costs and prevents the expensive cost of siRNA synthesis in vitro; secondly, it avoids inefficient delivery of siRNA in vivo; thirdly, it uses the human RNA polymerase III promoter hU6 to express siRNAs, which can effectively utilize intracellular RNA transcription system, highly express corresponding siRNAs and achieve good gene silencing efficacy through a series of enzymatic actions.

[0040] The vector skeleton employed by the disclosure is the third generation lentiviral vector (see FIG. 3A) 3' SIN LTR, from which U3 area is removed, eliminating the possibility of the self-replication of lentiviral vector and greatly increasing security, which includes elements cPPT and WPRE, strengthening the efficiency of transduction and transgene expression, and which employs RSV promoter, ensuring the continuous and efficient transcription of core RNA in lentiviral vector packaging, which employs the human EF1α promoter, so that CAR gene can be continuously expressed in vivo for a long time.

[0041] The siRNA knock-down scheme employed by the disclosure can also be applied to the third generation CAR design scheme. Over the second generation design, the third generation CAR includes CD28 chimeric receptor co-stimulatory factor (SEQ ID NO.24).

[0042] The lentiviral vector column purification system employed by the disclosure (see FIG. 8) is a lentivirus scale production process developed by the company. The common supercentrifugation or ultracentrifugation method segregates lentiviral particles with the principle of centrifugal sedimentation, which will inevitably leave a lot of impurities of similar sedimentation coefficient and adversely affect follow-up experiments. Also, the complex tubing process, cumbersome operations and multiple container transformations will increase the risk of contamination. However, the lentiviral vector column purification process employed by the disclosure is semi-automatic and entirely done in one-hundred-grade experimental region, avoiding cumbersome manual operations and risk of contamination and retrieving lentiviral vectors completely meeting clinical standards in endotoxin, mycoplasma and other indicators. The development of fully automatic purifier may be followed up.

[0043] The CAR design scheme employed by the disclosure can also be applied to the structure of the second generation lentiviral vector. The major difference in structure between the second and third generation lentiviral vectors (see FIG. 3B) is that the third generation lentiviral vector replaces the U3 area of the second vector 5'LTR with RSV promoter to eliminate dependency on Tat protein in U3 transcription to remove Tat sequence from the structural gene of lentivirus and improve the transcriptional level and continuity of lentiviral genome. The second generation lentiviral vector is mainly different from the third one in the transcriptional method of genome, and thus the CAR design scheme employed by the disclosure can be applied to the two generations of lentiviral vectors.

[0044] The third generation lentiviral skeleton plasmid involved in the disclosure employs enhanced WPRE, which, compared to the WPRE employed by Carl H. June and others at the University of Pennsylvania (Porter DL, Levine BL, Kalos M, Bagg A, June CH. Chimeric antigen receptor modified T cells in chronic lymphoid leukemia.N Engl J Med 2011;365:725-33.), has 6 enhanced nucleotide mutations (g.396G>A, g.397C>T, g.398T>C, g.399G>A, g.400A>T, g.411A>T), and can strengthen the polyadenylation of primary transcripts, intracellular content of mRNA and transgenic expression efficiency.

[0045] The lentiviral packaging system involved in the disclosure is a four-plasmid packaging system without helper virus, which produces recombinant lentiviral vectors by transfecting four plasmids into HEK293T / 17 cells. Recombined lentiviral vector is a replication-defective vector that can integrate foreign fragments into host gene, is disposable and can't be replicated or proliferated, thereby greatly increasing security.

[0046] The lentiviral vector employed by the disclosure has two versions, of which one with fluorescently tagged zsGreen1 is used for in-vitro experiment, while the other without fluorescently tagged zsGreen1 is used for clinical experiment.

[0047] The Linker design for scfv employed by the disclosure can significantly improve cytokine secretion, as well as the cytotoxicity in vitro and clinical treatment effect of CAR-T cell.

[0048] It can be seen that recombinant lentiviral vectors of the disclosure can give reliable transgenic guarantee for the CAR-T treatment of B lineage acute lymphoblastic leukemia (ALL), significantly lowering the risk of CRS and relieving patients' pain.

[0049] IL-6 know-down siRNA expression cassette and its siRNA expression products described in the disclosure can be used not only in CAR19-T treatment of acute B lymphocytic leukemia (ALL) to eliminate or alleviate the symptoms of CRS, but also to relieve CRS symptoms caused by CAR-T treatment for all types of tumors such as B-lymphoma, pancreatic cancer, brain glioma, bone cancer, even can be used to relieve CRS caused by other types of therapy.Description of Figures

[0050] FIG. 1 is a schematic diagram of IL-6 signaling pathway described in the disclosure; FIG. 2 is a schematic diagram of siRNA delivery by lentivirus described in the disclosure; FIG. 3 is a schematic diagram of the lentiviral vector structure described in the disclosure; of which FIG. 3(A) is a structure diagram of the 3 rd< generation lentiviral vector adopted by the disclosure, and FIG. 3(B) is a comparison between the 2 nd< generation and 3 rd< generation lentiviral vector structure; FIG. 4 is a flowchart of the construction of the recombinant lentiviral vector described in the disclosure; Among them, figure (A) is a structure diagram of lentiviral cytoskeleton plasmid pLenti-3G silencer; FIG. (B) is a structure diagram of pCAR19-silencer plasmid; FIG. (C) is a schematic diagram of pCAR19-1761~pCAR19-1769 plasmid; FIG. (D) is a structure diagram of lentiviral packaging plasmid pPac-GP; FIG. (E) is a structure diagram of lentiviral packaging plasmid pPac-R; FIG. (F) is a structure diagram of membrane protein pEnv-G; FIG. 5 is a diagram showing the restriction enzyme digestion prediction and enzymatic cleavage agarose gel electrophoregram of lentiviral cytoskeleton plasmid pLenti-3G silencer; Wherein, figure 5A is the schematic diagram of the restriction enzyme digestion prediction of lentiviral cytoskeleton plasmid pLenti-3G silencer; of which lane l is 1kb DNA ladder Marker: the bands from top to bottom are: 10kb, 8kb, 6kb, 5 kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp; lane 2 is the Cla I+BamH I digestion prediction of pLenti-3G silencer: the bands from top to bottom are: 7381bp, 23bp; FIG. 5B is the enzymatic cleavage agarose gel electrophoregram of lentiviral cytoskeleton plasmid pLenti-3G silencer, and lane 1 is the result of Cla I+BamH I digestion of pLenti-3G silencer; lane 2 is the result of electrophoresis of 1kb DNA ladder Marker; FIG. 6 is a diagram showing the restriction enzyme digestion prediction and enzymatic cleavage agarose gel electrophoregram of recombinant lentiviral plasmid pCAR19-silencer; Wherein, figure 6A is the schematic diagram of the restriction enzyme digestion prediction of recombinant lentiviral plasmid pCAR19-silencer, of which lane 1 is 1kb DNA ladder Marker: the bands from top to bottom are: 10kb, 8kb, 6kb, 5 kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp; lane 2 is the Kpn I digestion prediction of pCAR19-silencer: the bands from top to bottom are: 8335bp, 1708bp; FIG. 6B the enzymatic cleavage agarose gel electrophoregram of recombinant lentiviral plasmid pCAR19-silencer, and lane 1 is the result of electrophoresis of 1kb DNA ladder Marker; lane 2 is the result of Kpn I digestion of pCAR19-silencer; FIG. 7 shows the sequencing alignment results of the IL-6 know-down recombinant lentiviral plasmid pCAR19-1761~pCAR19-1769; Wherein, A is the sequencing alignment result of pCAR19-1761; B is the sequencing alignment result of pCAR19-1762; C is the sequencing alignment result of pCAR19-1763; D is the sequencing alignment result of pCAR19-1764; E is the sequencing alignment result of pCAR19-1765; F is the sequencing alignment result of pCAR19-1766; G is the sequencing alignment result of pCAR19-1767; H is the sequencing alignment result of pCAR19-1768; I is the sequencing alignment result of pCAR19-1769; FIG. 8 is a flowchart of ion exchange chromatography for purification of recombinant lentiviral vectors; FIG. 9 shows the titer detection results of recombinant lentiviral vectors; FIG. 10 shows the detection results of mycoplasma in different purification methods of recombinant lentiviral vectors. lane 1 is DL2000 marker, and the bands from top to bottom are: 2kb, 1kb, 750 bp, 500 bp, 250 bp, 100bp; lane 2 is a positive control; lane 3 is a negative control; lane 4 is PBS; lane 5 is water; lane 6 is lvCAR19-1761; lane 7 is lvCAR19-1762; lane 8 is lvCAR19-1763; lane 9 is lvCAR19-1764; lane 10 is lvCAR19-1765; lane 11 is lvCAR19-1766; lane 12 is lvCAR19-1767; lane 13 is lvCAR19-1768; lane 14 is lvCAR19-1769; FIG. 11 is a bar chart of relative expression level of mRNA; FIG. 12 shows a WB detection chart of CAR protein expression. In figure 12 A, lane 1 is PBMC blank cells; lane 2 is the control virus MOCK; lane 3 is lvCAR19-1761; lane 4 is lvCAR19-1762; lane 5 is lvCAR19-1763; lane 6 is lvCAR19-1764; lane 7 is lvCAR19-1765; lane 8 is lvCAR19-1766; lane 9 is lvCAR19-1767; lane 10 is lvCAR19-1768; lane 11 is lvCAR19-1769; FIG. 12 B are the beta-actin bands; FIG. 13 shows the results of CBA detection in supernatants of IL-6 know-down recombinant lentivirus lvCAR19-1761~lvCAR19-1769 after incubation with target cells at 4h and 24h; FIG. 13A is the CBA detection result of 4h; FIG. 13B is the CBA detection result of 24h; FIG. 14 shows the changes of IL-6 content in supernatants at 4h and 24h under different co-culture conditions of effector cells and target cells respectively; FIG. 15 shows the changes of mRNA transcription level at 24h under different co-culture conditions of effector cells and target cells respectively; FIG. 16 shows the killing of target cells at 24h after co-culture of different effector cells and target cells at a ratio of 10:1. E is the effector cell, and T is the target cell. Disclosure EmbodimentEmbodiments of the Present Disclosure

[0051] The following embodiments are only to illustrate the disclosure not to limit its scope. An experimental method without specific conditions stated in an embodiment is generally in accordance with conventional conditions or conditions recommended by the manufacturer.Embodiment 1 To Construct Recombinant Lentiviral VectorI. Material

[0052] 1. Lentiviral cytoskeleton plasmid pLenti-3G silencer, lentiviral packaging plasmid pPac-GP, pPac-R and membrane protein plasmid pEnv-G, HEK293T / 17 cells, homologous recombinase, Oligo Annealing Buffer were provided by Shiao (Shanghai) Biotech Co., Ltd.; 2. Primers: Primers required for amplification of DNA fragments and target sites were designed according to the principle of primer design, specifically as follows: EF1α-F: 5'-attcaaaattttatcgatgctccggtgcccgtcagt-3' (SEQ ID NO.25) EF1α-R: 5'-TCACGACACCTGAAATGGAAGA-3' (SEQ ID NO.26) CD8 leader-F: 5'-ggtgtcgtgaggatccgccaccatggccttaccagtgaccgc-3' (SEQ ID NO.27) CD8 leader-R: 5'-GTGTCATCTGGATGTCCGGCCTGGCGGCGTG-3'(SEQ ID NO.28) VL-F: 5'-cacgccgccaggccggacatccagatgacacagactacatc-3'(SEQ ID NO.29) VL-R: 5'-TGTGATCTCCAGCTTGGTCC-3'(SEQ ID NO.30) VH-R: 5'-TGAGGAGACGGTGACTGAGGT-3'(SEQ ID NO.32) CD8 Hinge-F: 5'-AGTCACCGTCTCCTCAACCACGACGCCAGCGCC-3'(SEQ ID NO.33) CD8 Hinge-R: 5'-GTAGATATCACAGGCGAAGTCCA-3'(SEQ ID NO.34) CD8 Transmembrane-F: 5'-cgcctgtgatatctacatctgggcgcccttggc-3'(SEQ ID NO.35) CD137-F: 5'-aaacggggcagaaagaaactc-3'(SEQ ID NO.37) CD137-R: 5'-TGCTGAACTTCACTCTCAGTTCACATCCTCCTTCTTCTTC-3'(SEQ ID NO. 38) TCR-F: 5'-agagtgaagttcagcaggagcg-3'(SEQ ID NO.39) TCR-R: 5'-GGAGAGGGGCGTCGACTTAGCGAGGGGGCAGGGC-3'(SEQ ID NO.40) siRNA1761-F (negative control) : siRNA1761-R (negative control) : WPRE-QPCR-F: 5'-CCTTTCCGGGACTTTCGCTTT-3'(SEQ ID NO.59) WPRE-QPCR-R: 5'-GCAGAATCCAGGTGGCAACA-3'(SEQ ID NO.60) Actin-QPCR-F: 5'-CATGTACGTTGCTATCCAGGC-3'(SEQ ID NO.61) Actin-QPCR-R: 5'-CTCCTTAATGTCACGCACGAT-3'(SEQ ID NO.62) CAR-QPCR-F: 5'-GACTTGTGGGGTCCTTCTCCT-3'(SEQ ID NO.63) CAR-QPCR-R: 5'-GCAGCTACAGCCATCTTCCTC-3'(SEQ ID NO.64) IL6-QPCR-F: 5'-GGATTCAATGAGGAGACTT-3'(SEQ ID NO.65) IL6-QPCR-R: 5'-ATCTGTTCTGGAGGTACT-3'(SEQ ID NO.66) 3. The DNA sequences shown in SEQ ID NO.15~SEQ ID NO.66 were synthesized by Shanghai Generay Biotech Co., Ltd., and stored as oligonucleotide dry powder or plasmid; 4. Tool enzymes BspE I, EcoR I, BamH I, Kpn I, Cla I and T4 DNA ligases were purchased from NEB; 5. PrimerSTAR HS DNA Polymerase, RN were purchased from Takara; 6. 0.22µm-0.8µm PES filters were purchased from millipore; 7. The Plasmid Extraction Kit and Agarose Gel Recovery Kit were purchased from MN; 8. TOP 10 Competent Cell were purchased from tiangen; 9. NaCl, KCl, Na 2 HPO 4 .12H 2 O, KH 2 PO 4 , Trypsin, EDTA, CaCl 2 , NaOH, PEG6000 were purchased from Shanghai Sangon Biotech; 10. Opti-MEM, FBS, DMEM, 1640, Pen-Srep, Hepes were purchased from invitrogen; 11. Biotinylated protein L was purchased from GeneScript; 12. HRP-labeled secondary antibodies and DAB working fluid were purchased from ZSGB-BIO; 13. ECL+plusTM Western blotting system was purchased from Amersham; 14. DNeasy kit was purchased from Shanghai Generay Biotech Co., Ltd.; 15. Lymphocyte Separation Medium were purchased from Dakewe Biotech Co., Ltd.; 16. Phycoerythrin(PE) -conjugated streptavidin, CBA kit were purchased from BD Bioscience; 17. SA-HRP were purchased from Yeasen Biotech Co., Ltd.; 18. Mycoplasma Detection Kit, Endotoxin Detection Kit and CD19 +< K562 Cell were purchased from Shiao (Shanghai) Biotech Co., Ltd.; 19. LDH Detection Kit were purchased from promega; II. Construction Method of Recombinant Lentiviral Vector lvCAR19-1761~lvCAR19-1769.

[0053] See FIG. 4. The construction method of the recombinant lentiviral vector described in the disclosure is as follows: 1. The human EF1α promoters, CD8 leader chimeric receptor signal peptide, CD19 single chain antibody light chain VL, Optimal Linker C, CD19 single chain antibody heavy chain VH, CD8 chimeric receptor hinge, CD8 transmembrane transmembrane domain chimeric receptor, the chimeric receptor co-stimulation factor - CD137, TCR and T cell activation domain chimeric receptor fragments were cloned into the lentiviral cytoskeleton plasmid pLenti-3G silencer to obtain recombinant lentiviral plasmid pCAR19-silencer, and the siRNA fragments were connected into pCAR19-silencer respectively to obtain IL-6 know-down recombinant lentiviral plasmid pCAR19-1761~pCAR19-1769. (1) The lentiviral cytoskeleton plasmid pLenti-3G silencer was double digested with Cla I and BamH I restriction enzymes. The product was electrophoresed on a 1.5% agarose gel to confirm the 7381bp fragment V1 (see FIG. 5), then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; Table 1 Procedures for the recovery of agarose gels[Table 1]1. SolAdd the sol solution in a ratio of 200 µl NTI / 100 mg gel, and place it in a 50°C water bath for 5-10 minutes.2. Bind to DNACentrifuge at 11,000g for 30 seconds, and discard the filtrate.3. Wash membraneAdd 700µl NT3, centrifuge at 11,000g for 30 seconds, and discard the filtrate4. Wash membraneRepeat the third step once5. DryCentrifuge at 11,000 g for 1 minute, replace with a new collection tube, and leave it at room temperature for 1 minute.6. Elute DNAAdd 15-30 µl NE, leave it at room temperature for 1 minute, centrifuge at 11,000g for 1 minute, and then collect the filtrate. (2) Use the primers EF1α-F and EF1α-R with the synthesized SEQ ID NO.15 as a template, and apply the system in Table 2. PCR circulation condition was: 98°C 3min, (98°C 10sec, 55°C 15sec, 72°C 2min)*35cycle, 72°C 10min. The product was electrophoresed on a 1.5% agarose gel to confirm the 1208bp fragment a, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; Table 2 50 µl PCR reaction system [Table 2]ReagentVolume (µl)H 2 O32.55×Buffer (with Mg2+)10dNTP (2.5mM each)4Primer1 (+)(10µM)1Primer2 (-)(10µM)1Template1PrimeSTAR0.5 (3) Use the primers CD8 leader-F and CD8 leader-R with the synthesized SEQ ID NO.16 as a template, and apply the system in Table 2. PCR circulation condition was: 98°C 3min, (98°C 10sec, 55°C 15sec, 72°C 30sec)*35cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 101bp fragment b, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (4) Use the primers VL-F and VL-R with the synthesized SEQ ID NO.17 as a template, and apply the system in Table 2. PCR circulation condition was: 98°C 3min, (98°C 10sec, 55°C 15sec, 72°C 30sec)*35cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 336bp fragment c, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (5) Use the primers OLC-VH-F and VH-R with the synthesized SEQ ID NO.19 as a template, and apply the system in Table 2. PCR circulation condition was: 98°C 3min, (98°C 10sec, 55°C 15sec, 72°C 30sec)*35cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 421bp fragment d, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (6) Use the primers CD8 Hinge-F and CD8 Hinge-R with the synthesized SEQ ID NO.20 as a template, and apply the system in Table 2. PCR circulation condition was: 98°C 3min, (98°C 10sec, 55°C 15sec, 72°C 30sec)*35cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 147bp fragment e, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (7) Use the primers CD8 Transmembrane-F and CD8 Transmembrane-R with the synthesized SEQ ID NO.21 as a template, and apply the system in Table 2. PCR circulation condition was: 98°C 3min, (98°C 10sec, 55°C 15sec, 72°C 30sec)*35cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 100bp fragment f, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (8) Use the primers CD137-F and CD137-R with the synthesized SEQ ID NO.22 as a template, and apply the system in Table 2. PCR circulation condition was: 98°C 3min, (98°C 10sec, 55°C 15sec, 72°C 30sec)*35cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 142bp fragment g, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (9) Use the primers TCR-F and TCR-R with the synthesized SEQ ID NO.23 as a template, and apply the system in Table 2. PCR circulation condition was: 98°C 3min, (98°C 10sec, 55°C 15sec, 72°C 30sec)*35cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 335bp fragment h, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (10) Applying the system in Table 3, 1µl each of DNA fragments b, c and d were taken as templates to add to Eppendorf tubes except for primers. PCR circulation condition was: 98°C 3min, (98°C 10sec, 60°C 10sec, 72°C 40sec)*6cycle. To add primer CD8 leader-F / VH-R with the conditions as (98°C 10sec, 60°C 10sec, 72°C 40sec)*24cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 814bp fragment i, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; Table 3 50 µl overlapping PCR reaction system [Table 3]ReagentVolume (µl)H 2 O33.5-1* number of templates5×Buffer (with Mg2+)10dNTP (2.5mM each)4Primer1 (+) (10µM)1Primer2 (-) (10µM)1Template1* number of templatesPrimeSTAR0.5 (11) Applying the system in Table 3, 1µl each of DNA fragments e, f, g and h were taken as templates to add to Eppendorf tubes except for primers. PCR circulation condition was: 98°C 3min, (98°C 10sec, 60°C 10sec, 72°C 40sec)*6cycle. To add primer CD8 Hinge-F / TCR-R with the conditions as (98°C 10sec, 60°C 10sec, 72°C 40sec)*24cycle, 72°C 5min. The product was electrophoresed on a 1.5% agarose gel to confirm the 704bp fragment j, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (12) The DNA fragments V1, a, i, j were added to the Eppendorf tubes in a total volume of 5µl with a molar ratio of 1:1:1:1. 15µl of the homologous recombinase reaction solution was added to the tubes, and the mixtures were incubated at 42°C for 30 minutes. Place them on ice for 2-3 minutes. Add the reaction solution to 50µl of TOP10, gently rotate to mix the contents, place them on ice for 30 minutes, then put the tubes in the thermostatic water bath pre-warmed to 42°C for 90 seconds, and quickly transfer the tubes in an ice bath. The cells were allowed to cool for 2-3 minutes. Add 900 µl of LB medium to each tube, then put the tubes to a 37°C shaker and incubate for 1 hour to resuscitate the bacteria. Take 100µl of transformant bacteria solution to apply to an Amp LB agar plate, invert the plate, and culture in a thermostatic incubator at 37°C for 16 hours. The clones were picked for colony PCR identification, and the correct clones were identified as recombinant lentiviral plasmid pCAR19-silencer. Enzyme digestion identification was performed for the correct clones (see FIG. 6); (13) The recombinant lentiviral plasmid pCAR19-silencer was double digested with BspE I and EcoR I restriction enzymes. The product was electrophoresed on a 1.5% agarose gel to confirm the 10029bp fragment V2, then such gel was recovered and placed in an Eppendorf tube. The corresponding fragments were recovered with Agarose Gel Recovery Kit of MN (see Table 1), and the purity and concentration of the product were determined; (14) The synthesized siRNA1761-F / R~siRNA1769-F / R were dissolved into 20µM with oligo annealing buffer respectively, and each 30µl of the corresponding F and R were mixed. The mixture of siRNA1761-F&R~siRNA1769-F&R was heated in a water bath at 95°C for 5 minutes, and then the water bath was opened and allowed to cool to room temperature to form double-stranded oligonucleotide fragments. Take 1µl for the ligation reaction (see Table 4), ligate at 4°C for 16h, and then place it on ice for 2-3 minutes. Add the reaction solution to 50µl of TOP10, gently rotate to mix the contents, place them on ice for 30 minutes, then put the tubes in the thermostatic water bath pre-warmed to 42°C for 90 seconds, and quickly transfer the tubes in an ice bath. The cells were allowed to cool for 2-3 minutes. Add 900 µl of LB medium to each tube, then put the tubes to a 37°C shaker and incubate for 1 hour to resuscitate the bacteria. Take 100µl of transformant bacteria solution to apply to an Amp LB agar plate, invert the plate, and culture in a thermostatic incubator at 37°C for 16 hours. The clones were picked for colony PCR identification, and the correct clones were identified as IL-6 know-down recombinant lentiviral plasmid pCAR19-1761~pCAR19-1769. The correct clones were sequenced and identified (see FIG. 7). Table 4 20 µl ligation reaction system [Table 4]ReagentVolume (µl)H 2 O13V2310×T4 DNA ligase Buffer2T4 DNA ligase1Annealed double-stranded oligonucleotides1 2. Packaging of Recombinant Lentiviral Vector lvCAR19-1761~lvCAR19-1769 (1) Complete medium: take out the pre-warmed fresh medium, add 10%FBS +5ml Pen-Srep, and mix them upside down; (2) 1XPBS solution: weigh 8g of NaCl, 0.2g of KCl, 3.58g of Na 2 HPO 4 .12H 2 O, 0.24g of KH 2 PO4, and put them in a 1000ml beaker, and add 900ml of Milli-Q grade ultrapure water to dissolve. After completion of the dissolution, the volume was adjusted to 1000ml using a 1000ml measuring cylinder, and the mixture was sterilized by heat sterilization at 121°C for 20 minutes; (3) 0.25%Trypsin solution: weigh 2.5g of Trypsin, 0.19729g EDTA, and put them in a 1000ml beaker, and add 900ml of 1XPBS solution to dissolve. After completion of the dissolution, the volume was adjusted to 1000ml using a 1000ml measuring cylinder, and the mixture was sterilized via 0.22µM filter. It could be saved in the refrigerator at -20°C for long-term use; (4) 0.5M CaCl2 solution: weigh 36.75g of CaCl 2 , and dissolve it with 400ml of Milli-Q grade ultrapure water; The volume was adjusted to 500ml with Milli-Q grade ultrapure water, and mixed; The mixture was sterilized via 0.22µM filter, and stored in 50ml centrifuge tubes with about 45ml in each tube at 4°C. (5) 2XHBS solution: weigh 4.09g of NaCl, 0.269g of Na 2 HPO4, 5.96g of Hepes, and dissolve them with 400ml Milli-Q grade ultrapure water; After calibrating the PH meter, the PH of the HBS solution was adjusted to 7.05 with 2M NaOH solution. It was about 3ml of 2M NaOH to consume to adjust the PH of each bottle of HBS. (6) The frozen HEK293T / 17 cells were removed from the liquid nitrogen container and repidly transferred to a 37°C water bath for 1-2 minutes, and then put them on a super clean bench. Aseptically transfer all the liquid in the freezing tube to a 10cm 2< petri dish, and make up DMEM containing 10%FBS to 8mL / 10cm 2< dish, and observe the cells under microscope after 24 hours. Passage was performed with the degree of cell confluence greater than 80%; (7) HEK293T / 17 cells with good cell status and no pollution were selected, and each 2-6 petri dishes were used as a group. After trypsinizing the cells, 4-12ml of complete medium was pipetted with an electric pipette to add 2ml to each digested dish to avoid drying the dish; All cells were isolated into single cell suspensions using a 1ml pipette and transferred to medium bottles; (8) The remaining cells in the above 2-6 petri dishes were transferred to the medium bottles, and the petri dishes were rinsed with the medium again; (9) Close the cap of the medium bottles and turn them upside down for about 10 times to fully mixed the cell suspension. Transfer the cells to 8-24 10cm 2< petri dishes. The cell density of each dish shall be about 4 × 10 6< / 10ml complete medium. In the case that the cell density was significantly different from the expected, the number of cells would be counted. Then the cells were inoculated according to the quantity of 4× 10 6< per dish; (10) Arrange each of the 6 petri dishes into a pile, and keep the fit between the upper and lower dishes. Shake the petri dishes left and right, back and forth several times to make cells fully spread out, and then put them into an incubator with 5% CO 2 . The remaining cells were treated as the same; (11) Upon Checking the passage cells, the cells shall be at 70-80% confluence, with full contour, good attachment and even distribution in petri dishes; (12) For changing the solution, the medium was replaced with fresh complete medium with 9ml per dish. The CO 2 concentration of incubator was increased to 8%; (13) To prepare DNA / CaCl 2 according to N+0.5. The amount of HEK293T / 17 cell transfection plasmid per dish was used in the following ratios: recombinant lentiviral plasmid (20µg), pPac-GP (15µg), pPac-R (10µg), pEnv-G (7.5µg). Take a new 5ml centrifuge tube, add 0.5M CaCl2: 0.25ml, recombinant lentiviral plasmid 20µg: pPac-GP 15µg: pPac-R 10µg: pEnv-G 7.5µg, supplement ultrapure water to 0.5ml, and cover the cap to mix them fully; (14) Take another 5ml centrifuge tube and add 0.5ml DNA / CaCl2 solution. Open a vortex mixer, hold the upper end of the 5ml centrifuge tube with one hand, and make the bottom of the tube contact the oscillation chamber, so that the liquid could spread on the tube wall. Take a 1ml pipette with anther hand to suck 0.5mL 2×HBS solution, add it into the centrifuge tube slowly and control the flow velocity. It was advisable to complete the drip in half a minute. After 2×HBS was added, it should be oscillated for another 5 seconds, and then stop oscillating. It could be directly added into the cells that need transfection; (15) Take a dish of cells and drop 1mL calcium transfection solution in the centrifuge tube in the dish to distribute the calcium transfection solution throughout the petri dish as much as possible; (16) After the calcium transfection solution was added, the petri dish was marked on the cover, and put back in another incubator with 5% CO 2 . Make sure that the petri dish was placed horizontally, and that there were no more than 6 petri dishes in each pile. These dishes were placed in the incubator with 5% CO 2 for 6-8h; (17) The CO 2 concentration of the first incubator was adjusted at 5%; (18) The cells status was check24 hours later. The cell confluence should be around 80-85% and in good condition. Aspirate the medium and replace 10ml of fresh DMEM complete medium; (19) The transfection efficiency was observed 48 hours later. Most cells were still adherent. It could be seen that more than 95% of the cells would have green fluorescence. The supernatant of the same virus packaging was collected together, and 10mL of fresh medium was added to the petri dish; (20) The same virus supernatant was collected again 72 hours later. The two collections were put together, and the petri dishes were discarded; the supernatant collected at this time contained the recombinant lentiviral vector lvCAR19-1761~lvCAR19-1769. Embodiment 2 Concentration and Detection of Recombinant Lentivirus Vector

[0054] I. Purification of Recombinant Lentiviral Vectors by Ion Exchange Chromatography (see FIG. 8); (1) The collected supernatant was filtered through a 0.22µm-0.8µm PES filter using a Thermo vacuum pump to remove impurities; (2) 1.5M NaCl 250 mM Tris-HCl (PH6-8) was added to the supernatant at a ratio of 1:1 to 1:10 (3) Two ion exchange columns were placed in series, and they were passed through sequentially by 4ml 1M NaOH, 4ml 1M NaCl, 5ml 0.15M NaCl 25 mM Tris-HCl (pH 6-8) solution; (4) The solution obtained in step 2 was pumped into the ion exchange column with a peristaltic pump at a rate of 1-10ml / min; (5) After all the supernatant was passed through the column, it was washed with 10ml of 0.15M NaCl 25 mM Tris-HCl (pH 6-8) solution; (6) According to the sample size, 1-5ml of 1.5M NaCl 25 mM Tris-HCl (pH 6-8) was used for elution and the eluate was collected; (7) The eluate was divided into tubes about 25 to 50 µl each, and stored in a refrigerator with -80°C for long-term storage; II. Titre Determination; (1) 293T cells were inoculated with 24-well plates. The number of cells in each well was 5×104, and the volume of medium added was 500ul. As the growth rate of different types of cells was different, the rate of cell fusion during viral infection was 40%-60%; (2) Three sterile EP tubes were prepared, and 90ul fresh complete medium (high glucose DMEM+10%FBS) was added into each tube to inoculate the cells. 24 hours later, the cells in the two pores were taken and counted with a hemocytometer to determine the actual number of cells at the time of infection, denoted as N; (3) 10ul of the virus stock to be determined was added to the first tube. After gently mixing, 10ul of the virus stock was added to the second tube, and then sequentially operated until the last tube; 410ul complete medium (high glucose DMEM+10%FBS) was added into each tube, and the final volume was 500ul; (4) 20 hours after the infection, the cultural supernatant was removed and changed into 500µl complete medium (high glucose DMEM+10%FBS). The cells was continuously cultured for 48 hours in 5%CO2; (5) After 72 hours, the fluorescence expression was observed. Under normal circumstances, the number of fluorescence cells decreased with the increase of dilution ratio. At the same time, photos were taken; (6) The cells were digested with 0.2ml 0.25% trypsin-EDTA solution, and then they were placed at 37°C for 1 minute. The whole cellular surface were purged with medium, and the cells were collected by centrifugation. Genomic DNA was extracted according to the instructions of DNeasy kit. 200µl of eluent were added to each sample tube to remove DNA, and then they were quantified; (7) The DNA detection qPCRmix manifold I was prepared (QPCR primer sequences were SEQ ID NO.59 --- SEQ ID NO.60): [Table 5] 2× TaqMan Master Mix25 µl × nForward primer (100 pmol ml-1)0.1µl × nReverse primer (100 pmol ml-1)0.1µl × nProbe (100 pmol ml-1)0.1µl × nH 2 O19.7µl × n n = number of reactions. For example, the total n were 40. 1ml of 2× TaqMan Universal PCR Master Mix, 4µl of forward primer, 4µl of reverse primer, 4µl of probe and 788µl of H 2 O were mixed and Placed on ice after being shaken; (8) The reference DNA detection qPCRmix manifold II were prepared (QPCR primer sequences were SEQ ID NO.59 --- SEQ ID NO.60): [Table 6] 2× TaqMan Master Mix25 µl × n10×RNaseP primer / probe mix2.5 µl × nH 2 O17.5µl × n n = number of reactions. For example, the total n were 40. 1ml of 2× TaqMan Universal PCR Master Mix, 100µl pf 10×RNaseP primer / probe mix and 700µl of H 2 O were mixed and placed on ice after being shaken; (9) The PCR system was established on a pre-cooled 96-well PCR plate. Take 45 µl from each tube of manifold I to add to the wells of each row of A-D. Take 45 µl from each tube of manifold II to add to the wells of each row of E-G. (10) 5 µl of the standard plasmid and the genomic DNA from the samples to be tested were taken respectively to add to the A-D row, and each sample was repeated once. 1 well was left to add 5µl of water as no-template control. (11) 5µl of the genomic standards and the genomic DNA from the samples to be tested were taken respectively to add to the E-G row, and each sample was repeated once. 1 well was left to add 5µl of water as no-template control. (12) The quantitative PCR instrument used was the ABI PRISM 7500 quantitative system. The cyclic conditions were set to: 50°C 2 min, 95°C 10min, (95°C 15sec, 60°C 1min) × 40 cycle. Data analysis: the copy number of lentiviral vectors integrated in the measured DNA samples was calibrated with the number of genomes to obtain the copy number of viruses integrated in each genome. The calculation formula of integration units per ml (IU ml -1< ) was as follows: IU ml − 1 = C × N × D × 1000 / V [Table 7] Of which:C = the average virus copy number per genome integrationN = number of cells at the time of infection (approximately 1×10 5< )D = dilution of the viral vectorV = the volume of diluted virus added (13) Titer results of recombinant lentiviral vector lvCAR19-1761~lvCAR19-1769 (see FIG. 9); III. Endotoxin Determination; (1) The working standard of endotoxin was 15EU per dose; (2) Sensitivity of Tachypiens Amebocyte Lysate (TAL) λ=0.25EU / ml, 0.5ml / tube (3) Dilution of endotoxin standard: take one endotoxin standard, dilute it into 4λ and 2λ solution with BET water, seal with sealing film and vortex for 15 min; During dilution, each dilution step should be mixed on the vertex mixer for 30s; (4) Adding: Several TAL were taken, each was dissolved in 0.5ml of BET water, and then divided into several exdotoxin-free tubes (0.1ml each tube). Two of them were negative control which were added 0.1ml of BET water to each of them; Two tubes were positive control which were added 0.1ml of endotoxin working standard solution with concentration of 2λ to each of them; Two tubes were positive control of sample which were added 0.1ml sample solution contained 2λ endotoxin standard (1ml of 20x dilution of sample to be tested + 1ml of solution contained 4λ endotoxin standard = 2ml of 40x dilution of sample contained 2λ endotoxin standard). 0.1ml of sample was added to the sample tube. The dilution ratio was in accordance with the Table 5. They were placed in water bath (or incubator) at 37±1°C for 60±1min; Table 5 Dilution ratio of exdotoxin and corresponding endotoxin content [Table 8]Dilution MultipleOriginal Fluid510204080160Corresponding EU / ml0.251.252.55102040 (5) The endotoxin detection results of the recombinant lentiviral vector lvCAR19-1761~lvCAR19-1769 (as shown in Table 6) showed that the endotoxin content was between 0~2.5 EU / ml, which met the requirements; Table 6 Detection results of endotoxin [Table 9]Dilution Multiple Original Fluid 5 10 20 40 80 160 Corresponding EU / ml 0.25 1.25 2.5 5 10 20 40 IvCAR19-1761 (+)(+)(-)(-)(-)(-)(-)IvCAR19-1762 (+)(+)(+)(-)(-)(-)(-)IvCAR19-1763 (+)(+)(-)(-)(-)(-)(-)IvCAR19-1764 (+)(+)(-)(-)(-)(-)(-)IvCAR19-1765 (-)(-)(-)(-)(-)(-)(-)IvCAR19-1766 (+)(-)(-)(-)(-)(-)(-)IvCAR19-1767 (+)(+)(-)(-)(-)(-)(-)IvCAR19-1768 (+)(+)(-)(-)(-)(-)(-)IvCAR19-1769 (+)(+)(+)(-)(-)(-)(-) IV. Determination and Comparison of Mycoplasma; (1) Cell samples were cultured in antibiotic-free medium three days before the experiment; (2) 1ml of cell suspension was collected (the number of cells is greater than 1*105) to place in a 1.5ml centrifuge tube; (3) Centrifuge at 13000×g for 1min, collect the precipitate, and discard the medium; (4) 500ul of PBS was added. The mixture was blew and sucked with a pipette or vortex oscillated to resuspend the precipitate. Centrifuge at 13000×g for 5min; (5) To repeat step 4 once; (6) 50µl of Cell Lysis Buffer was added. The mixture was blew and sucked with a pipette. After fully mixed, it was incubated in the water at 55°C for 20 min; (7) The sample was heated at 95°C for 5 min; (8) After centrifugation at 13000×g for 5 min, 5µl of supernatant was used as a template. 25 µlPCR reaction system was: 6.5µl of ddH20, 1µl of Myco Mix, 12.5µl of 2x Taq Plus Mix Master (Dye Plus), 5µl of template; PCR circulation condition was: 95°C 30sec, (95°C 30sec, 56°C 30sec, 72°C 30sec)*30cycle, 72°C 5min. (9) Detection results of mycoplasma (as shown in FIG. 10 and Table 7) showed that the recombinant lentiviral vector lvCAR19-1761~lvCAR19-1769 did not contain mycoplasma. Table 7 Detection results of mycoplasma [Table 10]PCR template PCR products Determination description Positive control 280b and 150bp were contained Positive No band or only one band Not positive Negative control 150bp band Negative No band or more than two bands Not negative Sample 280 and 150 bands were contained Contaminated by mycoplasma Only 280 band Severely contaminated by mycoplasma Only 150bp band No mycoplasma contamination No band Too few cells or PRC reaction was inhibited Embodiment 3 Functional Detection of Recombinant Lentivrial Vector lvCAR19-1761~lvCAR19-1769

[0055] I. Detection of Cellular Level Expression of CAR Gene: (1) After PBMC cells were infected with recombinant lentiviral vector lvCAR19-1761~lvCAR19-1769 and control virus MOCK, the cells were collected. RT-PCR was used to detect the transcription level of CAR mRNA and verify the expression of CAR gene. If the transcription level of CAR mRNA increased, it indicated that the transcription level of CAR gene was successfully expressed; (2) After PBMC cells were infected with recombinant lentiviral vector lvCAR19-1761~lvCAR19-1769 and control virus MOCK, the cells were collected. Western blot was used to detect the expression level of CAR protein and verify the expression of CAR gene. If the expression level of CAR protein increased, it indicated that the translation level of CAR gene was successfully expressed; (3) lvCAR19-1761~lvCAR19-1769 with MOI=15 and control virus MOCK were infected with cells respectively. After 48h, total RNA and total protein of the cells in the 6-well plate were extracted for fluorescence quantitative PCR and western blot assay. Specific steps: four wells of the 6-well plate were coated. Relevant PBS and RN were added to each well and overnight at 4°C. After 12 hours, the virus was coated according to MOI=15, and placed the plate in a incubator at 37°C for 5h; Take out the 6-well plate, and discard viral superatant. The plate was washed twice with PBS, coated with PBMC (isolated from human blood with lymphocyte separation solution) at 1*10 6< / well, and added 500ul of medium (containing 10% serum, 20U / ml IL-2, Polybrene 8ug / ml). Then such plate was allowed to stand for 20 min, centrifuge at 1000g for 20 min at 20°C, and culture for 48 h at 37°C. (4) The total RNA of PBMC cells in 6-well plate was extracted by Trizol method, and the cDNA was amplified by reverse transcription. QPCR primers (SEQ ID NO.63---SEQ ID NO.64) were used for fluorescence quantitative PCR assay (the reaction system was shown in Table 8) to verify the transcription of its mRNA with Action as its control group. Table 8 20µl qPCR reaction system[Table 11]ReagentVolume (µl )SYBR premix ex taq:10 µlROX Reverse Dye(50x)0.4µlUpstream primer (2.5µM):0.5µlDownstream primer (2.5µM):0.5µlcDNA1.0µlddH 2 O7.6µl (5) Western Blot was used to separate the total protein extracted from PBMC by relative molecular weight by polyacrylamide gel electrophoresis. The protein was transferred to the PVDF membrane by wet transfer (4°C, 400 mA, 120min). The PVDF membrane was blocked with a blocking solution (TBST solution containing 5% skim milk) for 1h at room temperature. The blocking solution was diluted with Biotinylated protein L at 1:1000, and then incubated with the blocked PVDF membrane at room temperature and overnight at 4°C. The membrane was washed three times with TBST, 10 min each time. The blocking solution was diluted with the corresponding SA-HRP at 1:500, and then used to incubated PVDF membrane at room temperature for 2h. The membrane was washed three times with TBST, 10 min each time. ECL+plusTM Western blotting system kit of Amersham was used for color development. X-ray optical development was used to obtain film showing bands. (6) RT-QPCR detection showed that the transcription level of CAR gene infected with PBMC by recombinant lentiviral vectors was significantly higher than that of control virus MOCK and blank cells (as shown in FIG. 11 and Table 9), indicating that the transcription level of CAR gene was successfully expressed. Table 9 [Table 12]Sample name Actin (CT) CAR (CT) -ΔCt -ΔΔCt 2 -ΔΔCt< IvCAR19-1761 19.51814 29.58243 -10.0643 5.91976 60.53753 IvCAR19-1762 19.15714 29.11395 -9.9568 6.02725 65.22033 IvCAR19-1763 19.20232 29.19465 -9.99233 5.99172 63.6338 IvCAR19-1764 19.26301 29.27989 -10.0169 5.96717 62.55993 IvCAR19-1765 19.29964 29.35456 -10.0549 5.92914 60.93236 IvCAR19-1766 19.3805 29.55666 -10.1762 5.8079 56.02099 IvCAR19-1767 19.52714 29.39926 -9.87212 6.11194 69.16335 IvCAR19-1768 19.75407 29.71702 -9.96295 6.02111 64.94329 IvCAR19-1769 19.48712 29.36486 -9.87774 6.10631 68.89426 MOCK 19.31164 35.11353 -15.8019 0.18217 1.134585 Blank 19.94915 35.93321 -15.9841 0 1 (7) Western Blot results showed that the expression level of CAR protein infected with PBMC with recombinant lentiviral vectors was significantly higher than that of control virus MOCK and blank cells (as shown in FIG. 12), indicating that the translation level of CAR gene was successfully expressed. II. Evaluation of IL-6 Know-down Effect (mRNA Transcription Level and IL-6 Expression Level in Supernatant) (1) CD19+K562 cells and PBMC cells were cultured separately; (2) Four days before start of the experiment, the virus of lvCAR19-1761~lvCAR19-1769 with MOI=15 was infected with PBMC cells, and cultured for 72-96h; (3) 4x10 5< of target cells (CD19+K562) and 2.8x10 6< of effector cells (lvCAR19-1761-PBMC~lvCAR19-1769-PBMC cells) were collected, centrifuged at 800g for 6min, and supernatant was discarded; (4) The target cells and effector cells were resuspended with 1ml of 1xPBS solution respectively, centrifuged at 800g for 6min, and the supernatant was discarded; (5) Step 4 was repeated once; (6) Effector cells were resuspended with 700ul medium (1640 medium +10% FBS), and target cells were resuspended with 2ml medium (1640 medium +10% FBS). (7) The experimental ports was set with the ratio of effector cells to target cells of 10:1, and the control group was set; (8) Being plate centrifuged at 250xg for 5min; (9) They were co-cultured in a incubator with 5%CO 2 at 37°C for 4 hours. 100ul of co-cultured supernatant was collected to perform CBA for detecting the content of IL-6; (10) They were continued to co-cultured in a incubator with 5%CO 2 at 37°C for up to 24 hours. After being plate centrifuged at 1000xg for 2min, 100ul of co-cultured supernatant was collected to perform CBA for detecting the content of IL-6. Cells were collected to detect the transcription level of IL-6 mRNA; (11) The steps of detecting IL-6 content by CBA was: IL-6 standard tube, sample tube and negative control tube were added 50ul IL-6 trapping microparticles suspension respectively, and the microparticles were mixed before adding; 50ul PE signal antibody was added to each tube; IL-6 standard tube was added with IL-6 standard diluent; The diluted sample and negative control solution were added into the sample tube and negative control tube respectively; They were incubated at room temperature keeping out of the sun for 3h; Each tube was added with 1ml of cleaning solution, and centrifuged at 200 xg for 5min; The supernatant was discarded; Each tube was added with 300ul of cleaning solution to resuspend the microparticles; Attune ®< NxT flow cytometry was used to analyze these samples which were mixed fully for 3-5s before starting the machine on that day; (12) The total RNA of the mixed cells above was extracted by Trizol method, and the cDNA was amplified by reverse transcription. QPCR primers (SEQ ID NO.65---SEQ ID NO.66) were used for fluorescence quantitative PCR assay (the reaction system was shown in Table 6) to verify the transcription of its mRNA with Action as its control group. (13) CBA detection results at 4h and 2h (as shown in FIG. 13) showed that after IL-6 know-down recombinant lentiviral vector was infected with PBMC and incubated with target cells, the supernatant content of IL-6 gene was significantly lower than that of control virus lvCAR19-1761 and blank cells (as shown in FIG. 14), indicating that the expression level of IL-6 gene was obviously decreased. (14) RT-QPCR detection results showed that IL-6 know-down recombinant lentiviral vector was infected with PBMC and incubated with target cells, the mRNA content of IL-6 gene was significantly lower than that of control virus lvCAR19-1761 and blank cells (as shown in FIG. 15), indicating that the transcription level of IL-6 gene was obviously decreased. III. Effect Evaluation of Cell Killing Test (1) CD19+K562 cells and PBMC cells were cultured separately; (2) Four days before start of the experiment, the virus of lvCAR19-1761~lvCAR19-1769 with MOI=15 was infected with PBMC cells, and cultured for 72-96h; (3) 4x10 5< of target cells (CD19+K562) and 2.8x10 6< of effector cells (CART cells) were collected, centrifuged at 800g for 6min, and supernatant was discarded; (4) The target cells and effector cells were resuspended with 1ml of 1xPBS solution respectively, centrifuged at 800g for 6min, and the supernatant was discarded; (5) Step 3 was repeated once; (6) Effector cells were resuspended with 700ul medium (1640 medium +10% FBS), and target cells were resuspended with 2ml medium (1640 medium +10% FBS); (7) The experimental ports was set with the ratio of effector cells to target cells of 1:1, 5:1, 10:1, and the control group was set with 3 multiple wells each group; (8) Being plate centrifuged at 250xg for 5min; (9) They were co-cultured in a incubator with 5%CO 2 at 37°C for 4 hours; (10) Being plate centrifuged at 250xg for 5min; (11) 50ul of supernatant taken from each well was added into a new 96-well plate with 50ul of substrate solution each well (light protection operation); (12) They were incubated in the dark for 25min; (13) 50ul of TMAH was added to each well; (14) 490nm absorbance was detected by enzyme-labeled instrument; (15) Average of the three multiple wells was taken; The average of median background absorbance was subtracted from the absorbance of all experimental ports, target cell wells and effector cell wells; The average of control absorbance of volume correction was subtracted from the maximum absorbance of target cells. (16) The corrected values obtained in step 15 were taken into the following formula to calculate the percentage of cytotoxicity produced by each ratio of effector cells to target cells. Results as shown in FIG. 16, the killing efficiency of IL-6 know-down recombinant lentiviral vector transduced PBMC cells was significantly higher than that of PBMC blank cells at the ratio of effector cells to target cells 10:1, and lower than that of control virus lvCAR19-1761 transduced PBMC cells; wherein, the killing efficiency of lvCAR19-1763-PBMC was slightly lower than that of the control virus IvCAR19-1761-PBMC, however, the expression level of IL-6 decreased by more than 70%. In the future, less IL-6 could be released while killing tumor cells and effectively alleviating CRS.

[0056] The better embodiments of the disclosure have been specified above, but the disclosure is not limited to the said embodiments.

[0057] IL-6 know-down siRNA expression cassette and its siRNA expression products described in the disclosure not only can be used in CAR19-T treatment of acute B lymphocytic leukemia (ALL) to eliminate or alleviate the symptoms of CRS, but also can be used to relieve CRS symptoms caused by CAR-T treatment for all types of tumors such as B-lymphoma, pancreatic cancer, brain glioma, bone cancer, even can be used to relieve CRS caused by other types of therapy.Free Content of Sequence ListingSequence Listing

[0058] <110> Shanghai Unicar Biomedical Technology Co., Ltd. <120> siRNAs of Human IL-6 and Recombinant Expression CAR-T Vector and Their Construction Methods and Applications <130> HJPCT16-1218 <160> 66 <170> PatentIn version 3.3 <210> 1 <211> 861 <212> DNA <213> Artificial sequence <400> 1 <210> 2 <211> 674 <212> DNA <213> Artificial sequence <400> 2 <210> 3 <211> 147 <212> DNA <213> Artificial sequence <400> 3 <210> 4 <211> 228 <212> DNA <213> Artificial sequence <400> 4 <210> 5 <211> 180 <212> DNA <213> Artificial sequence <400> 5 <210> 6 <211> 234 <212> DNA <213> Artificial sequence <400> 6 <210> 7 <211> 353 <212> DNA <213> Artificial sequence <400> 7 <210> 8 <211> 233 <212> DNA <213> Artificial sequence <400> 8 <210> 9 <211> 489 <212> DNA <213> Artificial sequence <400> 9 <210> 10 <211> 119 <212> DNA <213> Artificial sequence <400> 10 <210> 11 <211> 696 <212> DNA <213> Artificial sequence <400> 11 <210> 12 <211> 575 <212> DNA <213> Artificial sequence <400> 12 <210> 13 <211> 592 <212> DNA 449] <213> Artificial sequence <400> 13 <210> 14 <211> 256 <212> DNA <213> Artificial sequence <400> 14 <210> 15 <211> 1178 <212> DNA <213> Artificial sequence <400> 15 <210> 16 <211> 63 <212> DNA <213> Artificial sequence <400> 16 <210> 17 <211> 321 <212> DNA <213> Artificial sequence <400> 17 <210> 18 <211> 45 <212> DNA <213> Artificial sequence <400> 18 <210> 19 <211> 360 <212> DNA <213> Artificial sequence <400> 19 <210> 20 <211> 141 <212> DNA <213> Artificial sequence <400> 20 <210> 21 <211> 66 <212> DNA <213> Artificial sequence <400> 21 <210> 22 <211> 126 <212> DNA <213> Artificial sequence <400> 22 <210> 23 <211> 336 <212> DNA <213> Artificial sequence <400> 23 <210> 24 <211> 123 <212> DNA <213> Artificial sequence <400> 24 <210> 25 <211> 36 <212> DNA <213> Artificial sequence <400> 25 attcaaaatt ttatcgatgc tccggtgccc gtcagt 36 <210> 26 <211> 22 <212> DNA <213> Artificial sequence <400> 26 tcacgacacc tgaaatggaa ga 22 <210> 27 <211> 42 <212> DNA <213> Artificial sequence <400> 27 ggtgtcgtga ggatccgcca ccatggcctt accagtgacc gc 42 <210> 28 <211> 31 <212> DNA <213> Artificial sequence <400> 28 gtgtcatctg gatgtccggc ctggcggcgt g 31 <210> 29 <211> 41 <212> DNA <213> Artificial sequence <400> 29 cacgccgcca ggccggacat ccagatgaca cagactacat c 41 <210> 30 <211> 20 <212> DNA <213> Artificial sequence <400> 30 tgtgatctcc agcttggtcc 20 <210> 31 <211> 82 <212> DNA <213> Artificial sequence <400> 31 caagctggag atcacaggtg gcggtggctc gggcggtggt gggtcgggtg gcggcggatc 60 tgaggtgaaa ctgcaggagt ca 82 <210> 32 <211> 21 <212> DNA <213> Artificial sequence <400> 32 tgaggagacg gtgactgagg t 21 <210> 33 <211> 33 <212> DNA <213> Artificial sequence <400> 33 agtcaccgtc tcctcaacca cgacgccagc gcc 33 <210> 34 <211> 23 <212> DNA <213> Artificial sequence <400> 34 gtagatatca caggcgaagt cca 23 <210> 35 <211> 33 <212> DNA <213> Artificial sequence <400> 35 cgcctgtgat atctacatct gggcgccctt ggc 33 <210> 36 <211> 39 <212> DNA <213> Artificial sequence <400> 36 tctttctgcc ccgtttgcag taaagggtga taaccagtg 39 <210> 37 <211> 21 <212> DNA <213> Artificial sequence <400> 37 aaacggggca gaaagaaact c 21 <210> 38 <211> 40 <212> DNA <213> Artificial sequence <400> 38 tgctgaactt cactctcagt tcacatcctc cttcttcttc 40 <210> 39 <211> 22 <212> DNA <213> Artificial sequence <400> 39 agagtgaagttcagcaggag cg 22 <210> 40 <211> 34 <212> DNA <213> Artificial sequence <400> 40 ggagaggggc gtcgacttag cgagggggca gggc 34 <210> 41 <211> 54 <212> DNA <213> Artificial sequence <400> 41 ccggttctcc gaacgtgtca cgtctcgaga cgtgacacgt tcggagaatt tttg 54 <210> 42 <211> 54 <212> DNA <213> Artificial sequence <400> 42 aattcaaaaa ttctccgaac gtgtcacgtc tcgagacgtg acacgttcgg agaa 54 <210> 43 <211> 59 <212> DNA <213> Artificial sequence <400> 43 ccgggtgaag ctgagttaat ttatgctcga gtaaattaac tcagettcac atttttttg 59 <210> 44 <211> 59 <212> DNA <213> Artificial sequence <400> 44 aattcaaaaa aatgtgaagc tgagttaatt tactcgagca taaattaact cagcttcac 59 <210> 45 <211> 59 <212> DNA <213> Artificial sequence <400> 45 ccgggcacag aacttatgtt gttctctcga gaacaacata agttctgtgc ccttttttg 59 <210> 46 <211> 59 <212> DNA <213> Artificial sequence <400> 46 aattcaaaaa agggcacaga acttatgttg ttctcgagag aacaacataa gttctgtgc 59 <210> 47 <211> 59 <212> DNA <213> Artificial sequence <400> 47 ccggctcaga ttgttgttgt taatgctcga gttaacaaca acaatctgag gtttttttg 59 <210> 48 <211> 59 <212> DNA <213> Artificial sequence <400> 48 aattcaaaaa aacctcagat tgttgttgtt aactcgagca ttaacaacaa caatctgag 59 <210> 49 <211> 59 <212> DNA <213> Artificial sequence <400> 49 ccgggcagct ttaaggagtt cctgcctcga gaggaactcc ttaaagctgc gcttttttg 59 <210> 50 <211> 59 <212> DNA <213> Artificial sequence <400> 50 aattcaaaaa agcgcagctt taaggagttc ctctcgaggc aggaactcct taaagctgc 59 <210> 51 <211> 59 <212> DNA <213> Artificial sequence <400> 51 ccgggtgtag gcttacctca aataactcga gatttgaggt aagcctacac ttttttttg 59 <210> 52 <211> 59 <212> DNA <213> Artificial sequence <400> 52 aattcaaaaa aaagtgtagg cttacctcaa atctcgagtt atttgaggta agcctacac 59 <210> 53 <211> 59 <212> DNA <213> Artificial sequence <400> 53 ccggctcaaa taaatggcta acttactcga gagttagcca tttatttgag gtttttttg 59 <210> 54 <211> 59 <212> DNA <213> Artificial sequence <400> 54 aattcaaaaa aacctcaaat aaatggctaa ctctcgagta agttagccat ttatttgag 59 <210> 55 <211> 59 <212> DNA <213> Artificial sequence <400> 55 ccgggatgct tccaatctgg attcactcga gaatccagat tggaagcatc cattttttg 59 <210> 56 <211> 59 <212> DNA <213> Artificial sequence <400> 56 aattcaaaaa atggatgctt ccaatctgga ttctcgagtg aatccagatt ggaagcatc 59 <210> 57 <211> 59 <212> DNA <213> Artificial sequence <400> 57 ccggcttcca atctggattc aatgactcga gattgaatcc agattggaag cattttttg 59 <210> 58 <211> 59 <212> DNA <213> Artificial sequence <400> 58 aattcaaaaa atgcttccaa tctggattca atctcgagtc attgaatcca gattggaag 59 <210> 59 <211> 21 <212> DNA <213> Artificial sequence <400> 59 cctttccggg actttcgctt t 21 <210> 60 <211> 20 <212> DNA <213> Artificial sequence <400> 60 gcagaatcca ggtggcaaca 20 <210> 61 <211> 21 <212> DNA <213> Artificial sequence <400> 61 catgtacgtt gctatccagg c 21 <210> 62 <211> 21 <212> DNA <213> Artificial sequence <400> 62 ctccttaatg tcacgcacga t 21 <210> 63 <211> 21 <212> DNA <213> Artificial sequence <400> 63 gacttgtggg gtccttctcc t 21 <210> 64 <211> 21 <212> DNA <213> Artificial sequence <400> 64 gcagctacag ccatcttcct c 21 <210> 65 <211> 19 <212> DNA <213> Artificial sequence <400> 65 ggattcaatg aggagactt 19 <210> 66 <211> 18 <212> DNA <213> Artificial sequence <400> 66 atctgttctg gaggtact 18

Claims

1. An siRNA of human IL-6, which siRNA is selected from nucleotide sequence as shown in SEQ ID NO.45 and SEQ ID NO.46.

2. An siRNA as defined in Claim 1 for use in the treatment of the cytokine release syndrome (CRS).

3. A recombinant expression vector comprising the siRNA of Claim 1.

4. The recombinant expression vector of Claim 3, wherein the expression vector is a lentiviral expression vector, a retroviral expression vector, an adenovirus expression vector, an adeno-associated virus expression vector or a plasmid.

5. The recombinant expression vector of Claim 4, wherein the lentiviral expression vector comprises: a prokaryotic replicon pUC Ori sequence for plasmid replication, as shown in SEQ ID NO.2; an AmpR sequence with Ampicillin resistance gene for the massive proliferation of target strains, as shown in SEQ ID NO.1; a virus-replicon SV40 Ori sequence for enhancing replication in eukaryocytes, as shown in SEQ ID NO.3; a lentivirus packaging cis element for lentivirus packaging; ZsGreen1 green fluorescent protein for expressing green fluorescence in eukaryocytes, as shown in SEQ ID NO. 11; IRES ribosome binding sequence for transcription and expression of protein, as shown in SEQ ID NO.12; a human EF1α promoter for the eukaryotic transcription of chimeric antigen receptor genes, as shown in SEQ ID NO.14; encoding genes of anti-CD19 chimeric antigen receptors for making up the second or third generation CAR integrating identification, transmission and promotion, as shown in SEQ ID NO.52 or SEQ ID NO.53; an enhanced woodchuck hepatitis virus post-transcriptional regulatory element (eWPRE) for enhancing transgene expression efficiency, as shown in SEQ ID NO.13; a human RNA polymerase III promoter hU6 used for intracellular transcription of siRNA, as shown in SEQ ID NO.14.

6. The recombinant expression vector of Claim 5, wherein the lentivirus packaging cis element employs the second generation lentiviral vector, which comprises a lentivirus 5 terminal LTR as shown in SEQ ID NO.5, a lentivirus 3 terminal Self-Inactivating LTR as shown in SEQ ID NO.6, a Gag cis element as shown in SEQ ID NO.7, a RRE cis element as shown in SEQ ID NO. 8, an env cis element as shown in SEQ ID NO.9, and a cPPT cis element as shown in SEQ ID NO.10.

7. The recombinant expression vector of Claim 5, wherein the lentivirus packaging cis element employs the third generation lentiviral vector, which comprises a lentivirus 5 terminal LTR as shown in SEQ ID NO.5, a lentivirus 3 terminal Self-Inactivating LTR as shown in SEQ ID NO.6, a Gag cis element as shown in SEQ ID NO.7, a RRE cis element as shown in SEQ ID NO. 8, an env cis element as shown in SEQ ID NO.9, a cPPT cis element as shown in SEQ ID NO.10, and a RSV promoter as shown in SEQ ID NO.4.

8. The recombinant expression vector of Claim 5, wherein the eWPRE has 6 enhanced nucleotide mutations, which are g.396G>A, g.397C>T, g.398T>C, g.399G>A, g.400A>T, g.411A>T.

9. The recombinant expression vector of Claim 5, wherein the anti-CD19 chimeric antigen receptors comprise serialized CD8 leader chimeric receptor signal peptide, as shown in SEQ ID NO.16, CD19 single-chain antibody light chain VL, as shown in SEQ ID NO.17, Optimal Linker C, as shown in SEQ ID NO.18, CD19 single-chain antibody heavy chain VH, as shown in SEQ ID NO.19, CD8 chimeric receptor hinge, as shown in SEQ ID NO.20, CD8 chimeric receptor transmembrane, as shown in SEQ ID NO.21, CD137 chimeric receptor co-stimulatory factor, as shown in SEQ ID NO.22, and TCR chimeric receptor T cell activation domain, as shown in SEQ ID NO.23.

10. The recombinant expression vector of Claim 5, wherein the anti-CD19 chimeric antigen receptors comprise serialized CD8 leader chimeric receptor signal peptide, as shown in SEQ ID NO.16, CD19 single-chain antibody light chain VL, as shown in SEQ ID NO.17, Optimal Linker C, as shown in SEQ ID NO.18, CD19 single-chain antibody heavy chain VH, as shown in SEQ ID NO.19, CD8 chimeric receptor hinge, as shown in SEQ ID NO.20, CD8 chimeric receptor transmembrane, as shown in SEQ ID NO.21, CD28 chimeric receptor co-stimulatory factor, as shown in SEQ ID NO.24, CD137 chimeric receptor co-stimulatory factor, as shown in SEQ ID NO.22, and TCR chimeric receptor T cell activation domain, as shown in SEQ ID NO.23.

11. A method for constructing recombinant expression vector comprising the siRNA of claim 1, wherein the method comprises the following steps: (1) Storing in the lentiviral skeleton plasmid pLenti-3G silencer an AmpR sequence with Ampicillin resistance gene (as shown in SEQ ID NO.1), a prokaryotic replicon pUC Ori sequence (as shown in SEQ ID NO.2), a virus-replicon SV40 Ori sequence (as shown in SEQ ID NO.3), a lentivirus packaging cis element for lentivirus packaging, a ZsGreen1 green fluorescent protein (as shown in SEQ ID NO.11), an IRES ribosome binding sequence (as shown in SEQ ID NO.12), an enhanced woodchuck hepatitis virus post-transcriptional regulatory element (eWPRE) (as shown in SEQ ID NO.13), and a human RNA polymerase III promoter hU6 (as shown in SEQ ID NO.14); (2) Combining the human EF1α promoter (as shown in SEQ ID NO.15) and anti-CD19 chimeric antigen receptors for making up the second or third generation CAR integrating identification, transmission and promotion into, and cloning into lentiviral skeleton plasmid through enzyme digestion, ligation and recombination reactions, the design scheme for the second or third generation CAR, to get the recombinant lentiviral plasmid designed with the second or third generation CAR; (3) Respectively cloning into the recombinant lentiviral plasmid got through step (2) the siRNA and the negative control sequence as shown in SEQ ID NO.41 and SEQ ID NO.42 to get IL-6 knock-down recombinant lentiviral plasmids; (4) Transfecting recombinant lentiviral plasmids got through step (3) together with lentiviral packaging plasmids pPac-GP and pPac-R as well as membrane protein plasmid pEnv-G, respectively into HEK293T / 17 cell, and collecting supernatant containing recombinant lentiviral vectors, which will be released into cell culture supernatant if packaged successfully and after gene transcript expression in HEK293T / 17 cell; and (5) Respectively getting recombinant lentiviral vectors by purifying recombinant lentivirus supernatant got through step (4) with Ion exchange modes of extraction filtration, adsorption, elution.

12. The method of Claim 11 (4), wherein the volume of supernatant is controlled at 200ml~2000ml in the extraction filtration step, and the vacuum degree is at -0.5MPA~-0.9MPA to prevent loss of vector caused by plugging holes; in the adsorption step, the PH of solution is controlled at 6~8 to prevent inactivation of vector resulting from changes in PH; in the elution step, the ionic strength of eluant is controlled at 0.5M~1.0M to prevent incomplete elution or inactivation of vector due to changes in ionic strength.

13. A recombinant expression vector as defined in any one of Claim 3-10 for use in the treatment of inflammatory cytokine syndrome caused by the release of IL6 in the treatment with CAR-T.

14. A CAR-T cell, which is the T lymphocyte modified by the siRNA of claim 1.

15. A CAR-T cell as defined in Claim 14 for use in the treatment of B lymphoma, pancreatic cancer, brain glioma and myeloma.