Methods and kits for determining the efficiency of plasma separation from whole blood

HK40035631BActive Publication Date: 2026-07-10NUCLEIX LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
HK62021025577
Authority / Receiving Office
HK · HK
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-02-21
Filing Date
2021-02-09
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing methods for evaluating the efficiency of whole blood plasma separation are laborious, expensive, and inaccurate, especially in circulating cell-free DNA (cfDNA) analysis, where it is difficult to achieve a simple, cost-effective, and accurate evaluation of separation efficiency.

Method used

Quantitative PCR was used to amplify two types of amplicon, short amplicon (70-150 bp) and long amplicon (350-600 bp), by co-amplification in the same reaction mixture. The difference in amplicon signal intensity was used to assess the separation efficiency of plasma and whole blood, avoiding the need for absolute DNA quantification and locus copy number.

Benefits of technology

This provides a simple and cost-effective method to accurately assess the separation efficiency of plasma and whole blood, reduces the influence of noise factors, is applicable to any template DNA concentration, requires no dilution or other adjustments, and ensures sensitivity and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000019_0000
    Figure 00000019_0000
  • Figure 00000019_0001
    Figure 00000019_0001
  • Figure 00000019_0002
    Figure 00000019_0002
Patent Text Reader

Abstract

A method and kit are provided for determining the efficiency of plasma separation from whole blood using real-time PCR amplification of two amplicons: a short amplicon and a long amplicon, with the short amplicon being, for example, 70–150 bp and the long amplicon being, for example, 350–600 bp. The separation efficiency is determined based on the difference in amplification patterns between the two amplicons.
Need to check novelty before this filing date? Find Prior Art

Description

Invention Field

[0001] This invention relates to a real-time PCR assay for assessing whether a plasma sample is adequately separated from the cellular fraction of whole blood. This invention is advantageous for diagnostic tests that require the use of circulating cell-free DNA. Background of the Invention

[0003] Circulating cell-free DNA (cfDNA) is DNA released into the bloodstream from both normal and tumor cells. The origin of cfDNA in the blood is not fully understood, but it is believed to be associated with apoptosis, necrosis, and active release from cells. While the presence of cfDNA in the blood has been known for decades, its true diagnostic potential has only been recognized in recent years, leading to increasing interest in its detection and analysis. For example, fetal cfDNA present in maternal blood is now used for non-invasive prenatal diagnosis, and clinical studies using tumor-derived cfDNA as a surrogate biomarker for cancer patients are underway.

[0004] Analyzing cfDNA first requires separating plasma (containing cfDNA) from whole blood. Plasma is typically separated from blood by centrifugation or filtration. Newer microfluidic methods are emerging. After separation, the cfDNA can be further purified through extraction before further analysis.

[0005] Effective separation of cfDNA from blood cells is crucial for the quality of cfDNA analysis. Between blood collection and plasma processing, plasma becomes contaminated with DNA released from leukocytes, reducing the proportion of cfDNA in the sample and increasing noise and inaccuracy in cfDNA analysis. To assess separation efficiency, blood cell counting is typically performed manually using a hemocytometer or automatically using flow cytometry. However, such methods have several drawbacks, some being laborious and expensive, while others are not accurate enough.

[0006] Studies have shown that circulating cfDNA is mostly fragments less than 300 bp and even less than 200 bp in length (Chan et al., 2004, Clinical Chemistry, 50(1):88-92), while DNA derived from leukocytes is mostly long fragments greater than 10 kb.

[0007] Gel electrophoresis, which separates DNA based on molecular size by detecting the presence of long DNA fragments compared to short DNA fragments, has been suggested for determining separation efficiency. However, such methods require large amounts of DNA, which is a major challenge when processing circulating cell-free DNA.

[0008] Norton et al. (2013, Clinical Biochemistry, 46:1561-1565) investigated the ability of stabilizers to prevent cell-free DNA (cfDNA) from being contaminated with cellular genomic DNA (gDNA) during the storage and transport of blood samples. gDNA contamination was assessed using digital PCR. Specifically, contaminating gDNA was quantified using digital PCR by amplifying a 420 bp DNA fragment from the β-actin gene. cfDNA was quantified using a second digital PCR assay by amplifying a shorter 136 bp β-actin amplicon. These assays were used to determine the quality of plasma cfDNA samples to assess the degree of gDNA contamination.

[0009] There is a need for improved methods and kits that are simple, cost-effective, and accurate for determining the efficiency of plasma separation from whole blood. Invention Overview

[0011] According to some aspects, the present invention provides methods and kits for determining the efficiency of plasma separation from whole blood using quantitative PCR amplification of two amplicons, namely a short amplicon and a long amplicon, the short amplicon being, for example, 70-150 bp and the long amplicon, for example, 350-600 bp. The separation efficiency is determined based on the difference in amplification levels between the two amplicons. Advantageously, determining the separation efficiency does not require absolute quantification of DNA and / or determination of the copy number of any gene / locus.

[0012] The DNA in blood plasma fractions is mostly short, cell-free DNA fragments, with the longest being approximately 300 bp. When plasma fractions are not fully separated from the cellular components of blood, they also contain DNA derived from leukocytes. This latter type of DNA is mostly long fragments greater than 10 kb. Therefore, the presence of long DNA fragments in plasma samples provides an indicator of the efficiency of plasma separation from whole blood.

[0013] In the method disclosed herein, short and long amplicones from the plasma sample being tested are co-amplified, and the amplification pattern is analyzed. According to the method disclosed herein, a significant difference in the amplification levels of these two amplicones was observed in plasma samples well separated from blood at the cellular level, with the short amplicon amplifying at a higher efficiency than the long amplicon. Without being limited by any theory or mechanism of action, the difference in amplification levels reflects the proportion of short, cell-free DNA relative to long DNA from leukocytes in the plasma sample being tested, and thus indicates the efficiency of plasma separation.

[0014] Advantageously, the difference in amplification levels is calculated between amplicones co-amplified from the same DNA template in the same reaction mixture (i.e., under the same reaction conditions). This setup makes the method disclosed herein insensitive to a variety of “noise” factors such as changes in template DNA concentration, PCR conditions, and the presence of impurities / inhibitors. It should be noted that the method of the present invention does not require absolute quantification of DNA and / or determination of the copy number of any gene / locus. Therefore, the method of the present invention is not related to the actual amount, concentration, and / or copy number of any genomic locus. Thus, the method disclosed herein eliminates the need for standard curves and / or additional laborious steps involving absolute quantification, thereby providing a simple and cost-effective procedure without compromising sensitivity, quality, and / or accuracy. Furthermore, by employing real-time PCR, the method is effective for template DNA of any concentration and does not require template dilution or other adjustments.

[0015] According to one aspect, the present invention provides a method for determining the efficiency of separating plasma from whole blood, the method comprising:

[0016] (a) Obtaining DNA from a plasma sample;

[0017] (b) Generated by PCR co-amplification:

[0018] (i) The first amplification product of 70-150 bp, generated from the first genomic locus using the first primer pair, and

[0019] (ii) A second amplification product of at least 350 bp, generated from a second genomic locus using a second primer pair;

[0020] (c) Calculate the signal intensity of each of the first amplification product and the second amplification product; and

[0021] (d) When the difference between signal intensities exceeds a predetermined threshold, the plasma sample is determined to have been separated.

[0022] For plasma DNA and whole blood DNA, the first amplification product and the second amplification product produce different signal intensity differences.

[0023] In some embodiments, step (b) is performed using real-time PCR. In some embodiments, when step (b) is performed using real-time PCR, the method further includes adding a fluorescent probe for specifically detecting the first and second amplification products.

[0024] In some embodiments, when step (b) is performed using real-time PCR, the signal intensity is quantitatively cycled (Cq), and plasma sample separation is determined based on the difference (ΔCq) between the Cq values ​​of the first and second amplification products. In some embodiments, plasma sample separation is determined when ΔCq(Cq(second) - Cq(first)) is higher than a predetermined threshold ΔCq.

[0025] In some implementations, the first primer pair and the second primer pair have equivalent efficiency.

[0026] In some implementations, the first amplification product is 100-150 bp.

[0027] In some embodiments, the second amplification product is 350-700 bp. In some embodiments, the second amplification product is 350-650 bp. In some embodiments, the second amplification product is 350-550 bp.

[0028] In some embodiments, the first amplification product comprises a sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:10. Each possibility represents a separate embodiment of the invention. In some embodiments, the first amplification product consists of a sequence listed in SEQ ID NO:1 or SEQ ID NO:10. Each possibility represents a separate embodiment of the invention.

[0029] In some embodiments, the second amplification product comprises a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9. Each possibility represents a separate embodiment of the invention. In some embodiments, the second amplification product consists of a sequence listed in SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9. Each possibility represents a separate embodiment of the invention.

[0030] In some embodiments, the first amplification product and the second amplification product comprise the sequences listed in SEQ ID NO:1 and SEQ ID NO:2, respectively. In some specific embodiments, the first amplification product and the second amplification product consist of the sequences listed in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0031] In some implementations, plasma samples are derived from human blood samples.

[0032] According to another aspect, the present invention provides a kit for determining the efficiency of plasma separation from whole blood, the kit comprising:

[0033] (i) The first primer pair is used to generate a first amplification product of 70-150 bp from the first genomic locus by PCR;

[0034] (ii) A second primer pair for generating a second amplification product of at least 350 bp from a second genomic locus via PCR; and

[0035] (iii) A probe for detecting the first and second amplification products to determine the signal intensity of each amplification product.

[0036] For plasma DNA and whole blood DNA, the first amplification product and the second amplification product produce different signal intensity differences.

[0037] In some embodiments, the kit also includes an instruction manual that guides the correlation between signal intensity differences and separation levels. In some embodiments, the instruction manual provides a threshold signal intensity difference between the first and second amplification products; a difference exceeding this threshold indicates that the plasma sample has been separated. In some specific embodiments, the instruction manual provides a threshold ΔCq(Cq(second) - Cq(first)); a difference exceeding this threshold ΔCq indicates that the plasma sample has been separated.

[0038] In some implementations, the probe is a fluorescently labeled oligonucleotide probe.

[0039] In some implementations, the first primer pair and the second primer pair have equivalent efficiency.

[0040] In some implementations, the first amplification product is 100-150 bp.

[0041] In some embodiments, the second amplification product is 350-700 bp. In some embodiments, the second amplification product is 350-650 bp. In some embodiments, the second amplification product is 350-550 bp.

[0042] In some embodiments, the first amplification product comprises a sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:10. In some embodiments, the first amplification product consists of a sequence listed in SEQ ID NO:1 or SEQ ID NO:10.

[0043] In some embodiments, the second amplification product comprises a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9. In some embodiments, the second amplification product consists of a sequence listed in SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9.

[0044] In some embodiments, the first amplification product and the second amplification product comprise the sequences listed in SEQ ID NO:1 and SEQ ID NO:2, respectively. In some specific embodiments, the first amplification product and the second amplification product consist of the sequences listed in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0045] In some implementations, the first primer pair is SEQ ID NO:3 (forward) and SEQ ID NO:4 (reverse).

[0046] In some implementations, the second primer pair is SEQ ID NO:5 (forward) and SEQ ID NO:6 (reverse).

[0047] In some implementations, the first primer pair is SEQ ID NO:3 (forward) and SEQ ID NO:4 (reverse), and the second primer pair is SEQ ID NO:5 (forward) and SEQ ID NO:6 (reverse).

[0048] These and other aspects and features of the invention will become apparent from the appended detailed description, embodiments and claims. Brief description of the attached diagram

[0050] Figure 1A -C. Exemplary quantitative PCR curves of short (“JOE”) and long (“FAM”) amplification products from DNA samples from plasma (A), leukocyte-contaminated plasma (B), and DNA from whole blood (C). Invention Details

[0052] This invention relates to the use of real-time PCR to amplify two types of amplicons, namely, a short amplicon of 70-150 bp and a long amplicon of at least 350 bp, to determine the efficiency of separating cell fractions from plasma and whole blood.

[0053] The DNA present in plasma (“plasma DNA”) is mostly cell-free DNA, typically consisting of DNA fragments shorter than 300 bp. In contrast, the DNA in whole blood (“whole blood DNA”) is mostly DNA released from leukocytes, typically consisting of DNA fragments longer than 10 kb. The difference in the ratio of short to long DNA fragments between plasma and whole blood DNA contents establishes distinct amplification patterns for short and long amplicones, enabling the determination of the separation efficiency of plasma samples from the cellular components of blood.

[0054] As used herein, the terms “cell-free DNA” and “circulating cell-free DNA” (abbreviated as “cfDNA”) are used interchangeably and refer to DNA molecules circulating freely in the blood. Most cell-free DNA molecules are less than 400 bp in length, and some are even less than 300 bp or even less than 200 bp.

[0055] As used in this article, the terms "DNA from leukocytes," "leukocyte DNA," and "contaminated leukocyte DNA" refer to DNA released from leukocytes. Leukocyte DNA mainly consists of DNA fragments longer than 10 kb.

[0056] As used herein, the terms “determining plasma separation efficiency,” “determining that the plasma sample was separated,” and “determining that the plasma sample was adequately / effectively separated” are interchangeable and refer to determining the level of contaminating leukocyte DNA in the plasma such that it does not interfere with the analysis of cell-free DNA. It should be noted that different diagnostic applications involving cell-free DNA analysis may require different levels of plasma purity (i.e., can be characterized as tolerance to different levels of leukocyte DNA contamination). Therefore, for different assays, the threshold (above which determines that the plasma sample was separated) (such as the threshold ΔCq between short and long amplicon amplifications according to the present invention) may differ. The threshold can be set based on the requirements of a specific diagnostic assay.

[0057] The selection of first and second genomic loci and the generation of short and long amplicones. Primer design :

[0058] The assays disclosed herein for assessing the quality of plasma separation include dual PCR using primers that generate short amplicones (e.g., ~100 bp) from a first genomic locus and long amplicones (e.g., ~500 bp) from a second genomic locus. For plasma DNA and whole blood DNA, the short and long amplicones produce different signal intensity differences, such as different ΔCq values ​​for plasma DNA and whole blood DNA.

[0059] Plasma DNA is not merely fragmented genomic DNA, but rather a genomically biased representation, where some genomic loci are underrepresented and others are overrepresented compared to whole blood DNA. Pairs of short and long amplicones that produce different ΔCq values ​​for plasma and whole blood DNA include pairs of short and long amplicones from genomic loci that are equally represented in plasma DNA, and pairs where the long amplicon originates from genomic loci that are underrepresented in plasma DNA compared to the genomic loci of the short amplicon.

[0060] When such loci are amplified with primers of equal efficiency, the difference in their amplification levels reflects the ratio of short DNA fragments to long DNA fragments in the sample. The lower amplification level of the long amplicons reflects a lower amount of long DNA fragments in the sample and thus reflects better plasma separation.

[0061] Therefore, in some embodiments, the first genomic locus and the second genomic locus are equally present in plasma DNA. In other embodiments, the second genomic locus is less present in plasma DNA compared to the first locus. According to some embodiments, the method of the present invention includes: (a) obtaining DNA from a plasma sample; (b) co-amplifying by PCR to generate a first amplification product of 70-150 bp and a second amplification product of at least 350 bp, the first amplification product being generated from the first genomic locus using a first primer pair and the second amplification product being generated from the second genomic locus using a second primer pair, wherein the first genomic locus and the second genomic locus are equally present in plasma DNA, or the second genomic locus is less present in plasma DNA compared to the first locus; (c) calculating the signal intensity of each of the first amplification product and the second amplification product; and (d) determining that the plasma sample has been separated when the difference between the signal intensities is higher than a predetermined threshold.

[0062] In some embodiments, the method of the present invention includes: (a) obtaining DNA from a plasma sample; (b) generating a first amplification product of 70-150 bp and a second amplification product of at least 350 bp by real-time PCR, wherein the first amplification product is generated from a first genomic locus using a first primer pair and the second amplification product is generated from a second genomic locus using a second primer pair, wherein the first genomic locus and the second genomic locus are equally present in the plasma DNA, or the second genomic locus is less present in the plasma DNA than the first locus; (c) calculating the Cq value of each of the first amplification product and the second amplification product; and (d) determining that the plasma sample has been separated when ΔCq(Cq(second) - Cq(first)) is higher than a predetermined threshold ΔCq.

[0063] In some embodiments, this document provides a method for analyzing plasma samples, the method comprising: (a) obtaining DNA from the plasma sample; (b) generating a first amplification product of 70-150 bp and a second amplification product of at least 350 bp by real-time PCR, the first amplification product being generated from a first genomic locus using a first primer pair and the second amplification product being generated from a second genomic locus using a second primer pair, wherein the first genomic locus and the second genomic locus are equally present in the plasma DNA, or the second genomic locus is less present in the plasma DNA compared to the first locus; (c) determining the Cq value of each of the first amplification product and the second amplification product; and optionally (d) calculating ΔCq(Cq(second) - Cq(first)), wherein the first amplification product and the second amplification product produce different ΔCq for plasma DNA and whole blood DNA.

[0064] Selecting two genomic loci that are identically presented in cell-free plasma DNA and designing short and long amplicones from these loci can be done, for example, as follows:

[0065] 1. Select random pairs of genomic loci. For example, loci with a GC content between 30% and 60% can be selected;

[0066] 2. Design primer pairs for amplification to produce short (~100bp) amplicons;

[0067] 3. Determine the efficiency of primer pairs against whole blood DNA in a single (alone) reaction in PCR.

[0068] Methods for determining primer efficiency are known in the art. For example, primer pair efficiency can be determined by: (i) selecting a specific concentration of primers; (ii) performing real-time PCR reactions on serially diluted template DNA (e.g., whole blood DNA) and determining the Cq value for each reaction (each dilution); (iii) generating a standard curve by plotting the logarithm of the Cq value against the initial amount of template for each dilution; (iv) calculating the slope of the standard curve; and (v) determining the reaction efficiency based on the slope. Typically, efficiency is calculated using the following formula: efficiency = 10 -1 / 斜率 Amplification efficiency is often expressed as a percentage, that is, the percentage of template amplified in each cycle. The percentage is calculated using the following formula: %efficiency = (efficiency - 1) x 100.

[0069] 4. Eliminate pairs of genomic loci with unequal primer efficiencies and continue to use pairs of genomic loci with equal primer efficiencies;

[0070] 5. For each pair of genomic loci, compare the copy number of the loci in plasma DNA and eliminate pairs with different copy numbers (in other words, eliminate pairs with presentation bias in plasma DNA (where one locus is presented higher than another in plasma DNA), and select pairs with equivalent presentation in plasma DNA).

[0071] The assessment of copy number differences in plasma DNA can be performed, for example, by: (i) quantitatively amplifying genomic loci from plasma DNA and from whole blood DNA using primers selected in the preceding steps, the primers amplifying short amplicon from each locus with equivalent efficiency; (ii) calculating ΔCq between the two loci for each DNA sample (plasma DNA or whole blood DNA); and (iii) determining the copy number difference based on ΔCq in plasma DNA compared to ΔCq in whole blood DNA.

[0072] 6. For the selected pairs of genomic loci that are equally present in plasma DNA as identified in the previous steps, design primers for a long (>350 bp) amplicon for one of the genomic loci in the pair;

[0073] 7. As described above, determine the efficiency of the primers for long amplicon pairings on whole blood DNA;

[0074] 8. Calibrate the efficiency of the primers for the short and long amplicon until they achieve the same efficiency. Efficiency can be altered by slightly changing the primer sequence, for example, by adding / deleting bases at the 5' or 3' end of the primer. Optionally or additionally, the primer concentration can be adjusted to achieve equivalent efficiency.

[0075] The resulting primers amplified two genomic loci that were identically presented in plasma DNA with the same efficiency (although with amplicons of different sizes).

[0076] The design of pairs of short and long amplicones (where the long amplicon originates from a genomic locus that is deficient in plasma DNA compared to the genomic locus of the short amplicon) can be performed, for example, as follows:

[0077] 1. Select random pairs of genomic loci;

[0078] 2. Design primers for generating short (~100bp) amplicons;

[0079] 3. As described above, determine the efficiency of primer pairs for whole blood DNA in a single (alone) reaction in PCR.

[0080] 4. Eliminate pairs of genomic loci with unequal primer efficiencies and continue to use pairs of genomic loci with equal primer efficiencies;

[0081] 5. For each pair of genomic loci, compare the copy number of the loci in plasma DNA (as described above) and select pairs with different copy numbers, where one locus is deficient in plasma DNA compared to the other.

[0082] 6. For a selected locus pair, design primers for long (>350 bp) amplicons to discover genomic loci that are deficient compared to another genomic locus;

[0083] 7. As described above, determine the efficiency of the primers for long amplicon pairings on whole blood DNA;

[0084] 8. Calibrate the efficiency of the primers for the short and long amplicon until they achieve the same efficiency. Efficiency can be altered by slightly changing the primer sequence, for example, by adding / deleting bases at the 5' or 3' end of the primer. Optionally or additionally, the primer concentration can be adjusted to achieve equivalent efficiency.

[0085] As detailed above, the efficiency of primer / PCR reactions can be measured by known methods (e.g., by generating a standard curve and calculating the efficiency based on the slope of the standard curve) and is expressed as a numerical value or percentage. As used herein, the term "equivalent efficiency" in reference to amplification efficiency / primer efficiency means exactly the same efficiency (e.g., the same percentage efficiency) and also refers to an efficiency difference of up to 5%. "Equivalently efficient primers" include adjusting the primer sequence and / or concentration in the reaction to achieve equivalent efficiency. Primers with equivalent efficiency advantageously avoid result bias due to primer efficiency.

[0086] As used herein, the term "equivalently presented in plasma DNA" when referring to a genomic locus means that the genomic locus has the same copy number in plasma DNA. This term includes identical presentation (i.e., identical copy number) and also includes a presentation difference of up to 5%. The term "insufficiently presented in plasma DNA" when referring to a particular locus compared to another locus indicates that the particular locus has a lower copy number in plasma DNA compared to another locus. This term indicates a presentation difference greater than 5%.

[0087] The copy number can be measured using known methods, such as those detailed above.

[0088] When designing short and long amplification products for use in the methods of this invention, the CG content of the amplification sequence can be taken into consideration. For example, in some embodiments, the CG content of each amplification product is less than 50%.

[0089] Plasma sample processing

[0090] As used herein, the terms “whole blood” and “blood” refer to an ungraded blood sample that contains both cellular components (red blood cells, white blood cells, and platelets) and fluid components.

[0091] The term "plasma" refers to the fluid remaining after a whole blood sample has undergone a separation process to remove blood cells.

[0092] According to some embodiments, the plasma samples analyzed using the methods of the present invention are derived from human subjects. According to some embodiments, the plasma samples are derived from subjects suffering from malignant diseases such as a specific type of cancer, or subjects suspected of having malignant diseases such as one or more types of cancer. According to other embodiments, the plasma samples are derived from healthy subjects. As used herein, the term "healthy subject" means a subject who has not been diagnosed with a malignant disease such as a specific type of cancer and / or is not suspected of having cancer and / or is not prone to cancer.

[0093] Plasma samples can be samples separated from whole blood using any separation method. Exemplary procedures are described in the following Examples section. Plasma samples can be freshly separated samples or samples stored for a period of time prior to analysis.

[0094] The terms “DNA from”, “DNA obtained from”, etc., refer to DNA isolated from a plasma sample (e.g., extracted from plasma using methods known in the art) as well as the plasma sample itself, i.e., a plasma sample containing DNA.

[0095] In some embodiments, the method of the present invention includes providing a plasma sample. In some embodiments, the method of the present invention includes providing DNA from the plasma sample.

[0096] Generate amplification products

[0097] According to some implementation schemes, the method disclosed herein includes using a first primer pair to co-amplify an amplicon of 70-150 bp from a first genomic locus and using a second primer pair to co-amplify an amplicon of 350-650 bp from a second genomic locus.

[0098] The first and second amplification products of the present invention are generated by amplification using reverse and forward primer pairs known in the art that are designed to specifically generate each amplification product.

[0099] The length of the first (short) amplified product is typically between 70 and 150 bp, for example, between 80 and 150 bp, 100 and 150 bp, or 100 and 130 bp. Each possibility represents a separate embodiment of the invention.

[0100] The length of the second (long) amplified product is at least 350 bp, typically between 350-750 bp, between 350-650 bp, between 350-600 bp, between 350-550 bp, or between 400-500 bp. Each possibility represents a separate embodiment of the invention.

[0101] In some embodiments, the first amplification product comprises the sequence listed in SEQ ID NO:1. In some embodiments, the first amplification product consists of the sequence listed in SEQ ID NO:1. In some embodiments, the first amplification product comprises the sequence listed in SEQ ID NO:10. In some embodiments, the first amplification product consists of the sequence listed in SEQ ID NO:10.

[0102] In some embodiments, the second amplification product comprises the sequence listed in SEQ ID NO:2. In some embodiments, the second amplification product consists of the sequence listed in SEQ ID NO:2. In some embodiments, the second amplification product comprises the sequence listed in SEQ ID NO:7. In some embodiments, the second amplification product consists of the sequence listed in SEQ ID NO:7. In some embodiments, the second amplification product comprises the sequence listed in SEQ ID NO:8. In some embodiments, the second amplification product consists of the sequence listed in SEQ ID NO:8. In some embodiments, the second amplification product comprises the sequence listed in SEQ ID NO:9. In some embodiments, the second amplification product consists of the sequence listed in SEQ ID NO:9.

[0103] In some embodiments, the first amplification product and the second amplification product comprise the sequences listed in SEQ ID NO:1 and SEQ ID NO:2, respectively. In other embodiments, the first amplification product and the second amplification product consist of the sequences listed in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0104] In some implementations, the primer pair used to amplify the first amplification product is: SEQ ID NO:3 (forward) and SEQ ID NO:4 (reverse).

[0105] In some implementations, the primer pair used to amplify the second amplification product is: SEQ ID NO:5 (forward) and SEQ ID NO:6 (reverse).

[0106] In plasma samples contaminated with high levels of leukocyte DNA, both short and long DNA fragments are present, resulting in the efficient amplification of both short and long amplification products. In plasma samples well-separated from the cellular fraction of blood, short cell-free DNA fragments are predominantly (or only) present. In these samples, short amplification products amplify with higher efficiency compared to long amplification products. The better the separation of the plasma sample, the better the amplification of short amplification products compared to long amplification products, which is reflected, for example, in an increase in the ΔCq value (Cq(long) - Cq(short)) between the Cq of long and short amplicones after quantitative real-time PCR.

[0107] As used herein, the terms “genomic locus” or “locus” are interchangeable and refer to a specific location on a chromosome. A specific location can be identified by its molecular position, i.e., by the numbering of the start and stop base pairs on the chromosome. Variants of the DNA sequence at a given genomic location are called alleles. Alleles of a locus are located at the same locus on homologous chromosomes. A locus includes the gene sequence as well as other genetic elements (e.g., intergenic sequences).

[0108] As used herein, “amplification” refers to the increase in the copy number of one or more nucleic acid sequences of interest. As is known in the art, amplification is typically performed by polymerase chain reaction (PCR) in the presence of a PCR reaction mixture, which may include a suitable buffer supplemented with DNA template, polymerase (typically Taq polymerase), dNTPs, primers, and probes (as applicable).

[0109] As used herein, the term "polynucleotide" includes nucleotides in polymeric form (deoxyribonucleotides or ribonucleotides or their analogues) of any length. The term "oligonucleotide" is also used herein to include nucleotides in polymeric form that are typically up to 100 bases in length.

[0110] The terms "amplification product" and "amplifier" are used interchangeably and generally refer to nucleic acid molecules containing a specific target sequence that are generated and accumulate during an amplification reaction. The term typically refers to nucleic acid molecules generated by PCR using a given set of amplification primers.

[0111] As used herein, a “primer” is defined as an oligonucleotide capable of annealing (hybridizing) with a target sequence to produce a double-stranded region that can serve as the starting point for DNA synthesis under suitable conditions. The term “primer pair” herein refers to a pair of oligonucleotides selected together for amplification of a chosen nucleic acid sequence by one of many types of amplification methods, preferably PCR. As is generally known in the art, primers can be designed to bind to complementary sequences under selected conditions.

[0112] Depending on the specific assay format and specific needs, primers can be of any suitable length. In some embodiments, primers may comprise a length of at least 15 nucleotides, preferably between 19 and 25 nucleotides. Primers can be modified to be particularly suitable for a chosen nucleic acid amplification system. As is generally known in the art, oligonucleotide primers can be designed by taking into account the unwinding point of hybridization between the oligonucleotide primer and its target sequence.

[0113] The methods disclosed herein involve the simultaneous amplification of more than one target sequence (a first amplification product and a second amplification product) in the same reaction mixture, a process known as multiplex amplification or co-amplification. This process requires the simultaneous use of two primer pairs. As is known in the art, primers can be designed such that they operate at the same annealing temperature during amplification. In some embodiments, primers with similar melting temperatures (Tm) are used in the methods disclosed herein. For primers used in pools, a Tm variation between approximately 3°C and 5°C is considered acceptable.

[0114] According to some implementation schemes, the amplification of genomic loci is performed using real-time PCR (RT-PCR) (also known as quantitative PCR (qPCR)), in which amplification and detection of amplification products are performed simultaneously.

[0115] In some implementations, the detection of amplification products in RT-PCR can be achieved using polynucleotide probes (typically fluorescently labeled polynucleotide probes).

[0116] As used herein, “polynucleotide probe” or “oligonucleotide probe” is used interchangeably and refers to a labeled polynucleotide complementary to a specific subsequence within the nucleic acid sequence of a locus of interest (e.g., within the sequences of the first (short) genomic locus and the second (long) genomic locus as described herein). In some embodiments, detection is achieved using a TaqMan assay based on a combination of reporter and quencher molecules (Roche Molecular Systems Inc.). In such assays, the polynucleotide probe has a fluorescent portion (fluorophore) attached to its 5' end and a quencher attached to its 3' end. During PCR amplification, the polynucleotide probe selectively hybridizes to its target sequence on the template, and as the polymerase replicates the template, it also cleaves the polynucleotide probe due to the 5' nuclease activity of the polymerase. When the polynucleotide probe is intact, the close proximity between the quencher and the fluorescent portion typically results in low levels of background fluorescence. When the polynucleotide probe is cleaved, the quencher uncouples from the fluorescent portion, resulting in an increase in fluorescence intensity. The fluorescence signal is correlated with the amount of amplification product; that is, the signal increases as the amplification product accumulates.

[0117] As used herein, “selective hybridization with” (and “selective hybridization,” “specific hybridization with” and “specific hybridization”) refers to a nucleic acid molecule (such as a primer or probe) preferentially binding, double-stranding, or hybridizing with a specific complementary nucleotide sequence under stringent conditions. The term “stringent conditions” refers to conditions under which a nucleic acid molecule will preferentially hybridize with its target sequence and, to a lesser extent, hybridize with other non-target sequences or not hybridize with other non-target sequences at all. “Stringent hybridization” in the context of nucleic acid hybridization is sequence-dependent and varies under different conditions, as is known in the art.

[0118] The length of the polynucleotide probe can vary. In some embodiments, the polynucleotide probe may contain between 15 and 30 bases. In other embodiments, the polynucleotide probe may contain between 25 and 30 bases. In some embodiments, the polynucleotide probe may contain between 20 and 30 bases, such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases. Each possibility represents a separate embodiment of the invention.

[0119] Polynucleotide probes can be designed to bind to either strand of the template. Other considerations include the Tm of the polynucleotide probe, which should preferably be compatible with the Tm of the primer. Computer software can be used to design primers and probes.

[0120] As described above, the methods disclosed herein involve simultaneously amplifying more than one target sequence in the same reaction mixture. To distinguish between the multiple target sequences amplified in parallel, polynucleotide probes labeled with different fluorescent colors can be used.

[0121] In some embodiments, the polynucleotide probe forms a fluorophore / quencher pair as known in the art, and includes, for example, FAM-TAMRA, FAM-BHQ1, Yakima Yellow-BHQ1, ATTO550-BHQ2, and ROX-BHQ2.

[0122] In some implementations, the dye combination can be compatible with the selected RT-PCR thermal cycler.

[0123] In some implementations, fluorescence can be monitored during each PCR cycle to provide an amplification curve that shows changes in fluorescence signal from the probe as a function of the cycle number.

[0124] In the context of RT-PCR, the following terminology is used:

[0125] A “quantitative cycle” (“Cq”) refers to the number of cycles in which fluorescence increases to above a threshold fluorescence level, which is set automatically by software or manually by the user. In some embodiments, the threshold fluorescence level can be constant for all amplicons and can be set in advance before amplification and detection. In other embodiments, the threshold fluorescence level for each amplicon can be defined individually after the run based on the maximum fluorescence level detected during each amplification cycle. In some embodiments, the threshold fluorescence level can be a value higher than baseline fluorescence and / or higher than background noise and within the exponential growth phase of the amplification curve. “Baseline” refers to the initial cycle of PCR in which fluorescence changes are little to no.

[0126] Computer software can be used to analyze amplification curves and determine baseline, threshold, and Cq.

[0127] In plasma samples that are well separated from cellular components and contain no cellular DNA or only residual cellular DNA, template DNA for amplifying long amplicons is essentially absent. Following PCR using the first and second primer pairs, short amplicons amplify with high efficiency, while long amplicons form very low amounts of amplification product (if any). Amplification curves will show low Cq values ​​for short amplicons (amplification product detected after relatively low amplification cycle numbers) and high Cq values ​​for long amplicons (amplification product detected after relatively high amplification cycle numbers).

[0128] In plasma samples contaminated with cellular genomic DNA, the higher the contamination level, the lower the Cq value of the long amplicon.

[0129] The difference between the Cq of short amplicon and the Cq of long amplicon indicates the separation quality of plasma samples.

[0130] Determine the efficiency of separation

[0131] The efficiency of plasma separation is determined based on differences in signal intensity, such as the difference in Cq values ​​between short and long amplification products after real-time PCR.

[0132] As used herein, the term "signal intensity" refers to a measure of the amount of sequence-specific amplified product that reflects an initial amount corresponding to a copy of the target sequence. However, signal intensity may not indicate the actual amount of amplified product / target sequence and may not involve any calculation of the absolute amount of amplified product / target sequence. Therefore, in some embodiments, a standard curve or reference DNA is not used to calculate the signal intensity of the amplified product because it is not necessary to calculate the actual amount of DNA itself.

[0133] In some implementations, amplification and detection of the amplification product are performed by RT-PCR, wherein the signal intensity of a particular amplification product is represented by a Cq calculated for that amplification product.

[0134] In some implementations, Cq is determined to be "infinity" in the case of no amplification or very little amplification. In some implementations, the value of ΔCq is set to 14 in this case.

[0135] In some implementations, calculating the difference in signal intensity between a first amplification product and a second amplification product in a DNA sample includes determining the Cq for each locus and calculating the difference (ΔCq) between the Cq values. In some implementations, the difference in signal intensity between the two amplification products is calculated by subtracting Cq(short) from Cq(long).

[0136] For example, assuming the first (short) Cq of the first amplification product is "25" and the second Cq of the second (long) amplification product is "30", then Cq(long) - Cq(short) is "5".

[0137] In some implementations, computer software is used to calculate the differences between Cq values ​​of the amplified products.

[0138] In some implementations, when the calculated ΔCq is higher than a predetermined threshold ΔCq, the calculated ΔCq indicates that the plasma sample being tested has been adequately separated from whole blood.

[0139] The “threshold ΔCq” refers to the ΔCq that distinguishes a well-separated plasma sample from a poorly separated or unseparated plasma sample. This threshold is typically set to reflect a lower amount or percentage of contaminating leukocyte DNA that does not interfere with the analysis of cell-free DNA. As described above, different diagnostic applications involving cell-free DNA analysis may require different levels of plasma purity (i.e., can be characterized as tolerance to different levels of leukocyte DNA contamination). For example, in some embodiments, the separated plasma sample is a plasma sample containing less than 50% contaminating leukocyte DNA, less than 40% contaminating leukocyte DNA, less than 30% contaminating leukocyte DNA, less than 20% contaminating leukocyte DNA, less than 10% contaminating leukocyte DNA, less than 5% contaminating leukocyte DNA, or less than 1% contaminating leukocyte DNA. Each possibility represents a separate embodiment of the invention.

[0140] The threshold ΔCq (above which plasma samples are considered separated) can be set based on the requirements of a specific diagnostic assay.

[0141] For example, in some implementations, the threshold ΔCq is one cycle, reflecting a 50:50 ratio between contaminated leukocyte DNA and cell-free DNA in the sample.

[0142] In some embodiments, the threshold ΔCq is approximately one cycle. In some embodiments, the threshold ΔCq is at least one cycle. In other embodiments, the threshold ΔCq is at least two cycles. In yet another embodiment, the threshold ΔCq is at least three cycles. In still another embodiment, the threshold ΔCq is at least four cycles.

[0143] In some implementations, determining the threshold ΔCq includes: (i) incorporating different amounts (or percentages) of erythrocyte sedimentation rate (ESR) brown layer or whole blood DNA into plasma samples to obtain a series of plasma samples with different degrees of leukocyte DNA contamination; (ii) performing real-time PCR on a pair of short and long amplicones in each sample and determining the Cq for each amplicon in each sample; and (iii) calculating the ΔCq for each sample (each degree of leukocyte DNA contamination) and determining the threshold based on the maximum contamination allowed for the specific assay / application.

[0144] In some implementations, the method of the present invention includes providing a threshold ΔCq.

[0145] In some embodiments, the threshold is a statistically significant value. Statistical significance is typically determined by comparing two or more groups and determining confidence intervals (CIs) and / or p-values. In some embodiments, a statistically significant value is defined as a confidence interval (CI) of about 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9%, and 99.99%, while a p-value preferably is less than about 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, or less than 0.0001. Each possibility represents a separate embodiment of the invention. According to some embodiments, the p-value of the threshold is at most 0.05.

[0146] As used herein, when referring to measurable values, the term “about” means including variations from a specified value of + / -10%, more preferably + / -5%, even more preferably + / -1%, and still more preferably + / -0.1%.

[0147] Reagent kits and systems

[0148] In some embodiments, this document provides a kit for determining the efficiency of plasma separation from whole blood using the method according to the invention.

[0149] In another embodiment, this document provides a system for determining the efficiency of separating plasma from whole blood using the method according to the invention.

[0150] In some embodiments, the kit comprises: a primer pair for amplifying a first amplification product of 70-150 bp from a first genomic locus and a second amplification product of at least 350 bp from a second genomic locus; a tool for detecting the first and second amplification products; and an instruction manual for determining plasma separation efficiency according to the methods disclosed herein. In some embodiments, the instruction manual may be an electronic instruction manual.

[0151] In some implementations, the instruction manual may provide a threshold ΔCq above which plasma samples are determined to have been separated.

[0152] In some implementations, the manual may include descriptions of the method steps described herein.

[0153] In some implementations, the instruction manual may include instructions guiding the relationship between ΔCq and separation.

[0154] In some implementations, the instruction manual may include instructions for performing plasma separation using computer software stored on a computer-readable medium, which instructs a computer processor to determine plasma separation based on the difference in signal intensity between a first amplification product and a second amplification product.

[0155] In some implementations, the kit may also include a computer-readable medium storing computer software that instructs a computer processor to determine plasma separation based on the difference in signal intensity between a first amplification product and a second amplification product.

[0156] In some embodiments, the system of the present invention includes: (i) a first primer pair for generating a first amplification product of 70-150 bp from a first genomic locus by PCR; (ii) a second primer pair for generating a second amplification product of at least 350 bp from a second genomic locus by PCR; (iii) a probe for detecting the first and second amplification products to determine the signal intensity of each amplification product; and (iv) computer software stored on a computer-readable medium that instructs a computer processor to determine plasma separation based on the difference in signal intensity between the first and second amplification products.

[0157] In some embodiments, the computer software of the present invention instructs a computer processor to perform the following steps: determining the signal intensity of each of a first amplification product and a second amplification product; and calculating the difference between the signal intensities. In some embodiments, the computer software further instructs the computer processor to compare the calculated difference with a predetermined threshold, and based on the comparison, output whether the plasma sample has been separated. In some embodiments, the computer software may be computer software that instructs the computer processor to calculate at least one of Cq and ΔCq.

[0158] In some implementations, the computer software receives parameters or raw data from a real-time PCR run as input. In some implementations, the computer software instructs a computer processor to analyze the real-time PCR run to determine signal intensity (Cq) and signal intensity difference (ΔCq).

[0159] Computer software includes processor-executable instructions stored on a non-transitory computer-readable medium. Computer software may also include stored data. Computer-readable media are tangible computer-readable media, such as optical discs (CDs), magnetic storage, optical storage, random access memory (RAM), read-only memory (ROM), or any other tangible medium.

[0160] In some implementations, the system includes a processor configured to perform the following operation: determine plasma separation based on a comparison of the signal intensity difference between a calculated first amplification product and a second amplification product with a threshold signal intensity difference.

[0161] In some implementations, the system includes instruments for performing amplification product generation, such as real-time PCR instruments.

[0162] In some embodiments, the kit or system includes a fluorescently labeled oligonucleotide probe that is complementary to a subsequence in the first amplification product and the second amplification product for detecting the first amplification product and the second amplification product.

[0163] In some implementations, the kit or system includes a first primer pair and a second primer pair, each primer pair being designed to selectively amplify fragments of the genome to generate a first amplification product and a second amplification product, as described herein.

[0164] In some implementations, the first primer pair is: SEQ ID NO:3 (forward) and SEQ ID NO:4 (reverse).

[0165] In some implementations, the second primer pair is: SEQ ID NO:5 (forward) and SEQ ID NO:6 (reverse).

[0166] In some implementations, the kit or system may also include at least one additional component required for amplification and detection of the amplification products, such as a mixture of DNA polymerase and nucleotides.

[0167] In some embodiments, the kit or system may also include suitable reaction buffers and a written protocol for performing the assay. The written protocol may include instructions for performing any of the steps disclosed herein, including but not limited to PCR cycling parameters, Cq determination and analysis, and ΔCq thresholds.

[0168] It should be understood that the computer-related methods, steps, and processes described herein are implemented using software stored on non-volatile or non-transitory computer-readable instructions, which, when executed, configure or instruct a computer processor or computer to execute the instructions.

[0169] The following examples are shown to illustrate certain embodiments of the invention more fully. However, they should in no way be construed as limiting the broad scope of the invention. Many variations and modifications of the principles disclosed herein will be readily conceived by those skilled in the art without departing from the scope of the invention. Example

[0170] Example 1—Testing Plasma Samples

[0171] The following pairs of short and long amplicones were designed to test DNA from plasma samples, leukocyte-contaminated plasma samples, and whole blood samples:

[0172] "Short" (126bp) (SEQ ID NO:1):

[0173]

[0174] The short amplicon corresponds to positions 155565467-155565601 on chromosome 1 (according to hg18). The short amplicon was designed to be amplified using the following primers:

[0175] Forward (SEQ ID NO:3): GTCTTTGTGACATTGAGTTACAG

[0176] Reverse (SEQ ID NO:4): ATATTTGGCATCTTCTCCAGGAC

[0177] "Long" (450bp) (SEQ ID NO:2):

[0178]

[0179] The long amplicon corresponds to positions 121380810-121381259 on chromosome 7 (according to hg18). The long amplicon was designed to be amplified using the following primers:

[0180] Forward (SEQ ID NO:5): GTCAGCCCTTTATTATCACTTTGC

[0181] Reverse (SEQ ID NO:6): TGACTCTGACTGATGACTGAGG

[0182] Blood samples were collected from human subjects and processed to obtain plasma or plasma + erythrocyte sedimentation rate (ESR) layer (leukocytes and platelets), or left unprocessed (whole blood).

[0183] To obtain the plasma + erythrocyte sedimentation rate (ESR) brown layer, blood tubes (containing anticoagulant) were centrifuged at 1500g for 10 min to separate blood components. After centrifugation, the plasma layer and the ESR brown layer (leukocytes and platelets) were collected and transferred to new tubes.

[0184] To obtain a plasma sample, centrifuge the blood tube (containing anticoagulant) at 1500g for 10 min to separate the blood components. After centrifugation, collect the plasma layer (avoiding the erythrocyte sedimentation rate (ESR) layer) and transfer it to a new tube. Centrifuge the plasma again (1500g for 10 min) and transfer the purified plasma to a new tube.

[0185] use Cyclic nucleic acid test kit ( DNA was extracted from the samples using a Circulating Nucleic Acid Kit. The extracted DNA was then subjected to real-time (RT) PCR to amplify the short and long amplicones described above from each sample (co-amplification).

[0186] The amplification reaction (total volume 25 μL) contained 2 μL of extracted DNA (DNA concentration not measured prior to amplification), 0.05–0.5 μM primers, dNTPs, and reaction buffer. To enable detection of amplification products during amplification, fluorescently labeled polynucleotide probes for each amplicon were added to the reaction (FAM-labeled for long amplicons and JOE-labeled for short amplicons). Primer and probe concentrations for each amplicon were adjusted to achieve equivalent efficiency. RT-PCR reactions were performed on an ABI 7500 FastDx instrument using the following PCR program: 95 °C, 10 min -> 45X (95 °C, 15 sec) -> 60 °C, 1 min.

[0187] After amplification, the quantitative PCR curves were analyzed to calculate the quantitative cycle number (Cq) for each amplicon. The quantitative PCR curves show the changes in fluorescence signal from the probe as a function of the cycle number. The ΔCq(Cq(long) - Cq(short)) between the Cq of the long amplicon and the Cq of the short amplicon was calculated.

[0188] Figure 1A -C indicates the source from plasma ( Figure 1A , ΔCq=3), plasma contaminated with leukocytes ( Figure 1B , ΔCq=(-0.4)) and DNA from whole blood ( Figure 1C Exemplary quantitative PCR curves for short and long amplification products in DNA samples with ΔCq = (-0.2)).

[0189] In plasma samples, where the amount of DNA from leukocytes is very low, long amplicon amplification is inefficient. Its rise is approximately 3-4 cycles later than that of short amplicon amplification.

[0190] In plasma samples contaminated with leukocytes and in whole blood samples, where leukocyte DNA levels are high, long amplicon and short amplicon amplify with similar efficiency. The increase in long amplicon levels is roughly the same as that of short amplicon levels over approximately the same number of cycles.

[0191] The above description of specific embodiments so fully reveals the general nature of the invention that others, by applying existing knowledge, can readily modify and / or adapt such specific embodiments for various applications without excessive experimentation and without departing from the general concept. Therefore, such modifications and alterations should and are intended to be included within the meaning and scope of equivalent embodiments of the embodiments disclosed herein. It should be understood that the wording or terminology used herein is for descriptive purposes and not for limitation. The means, materials, and steps used to achieve the various disclosed chemical structures and functions may take many alternative forms without departing from the invention. sequence list <110> Newclex Ltd. <120> Methods and kits for determining the efficiency of plasma separation from whole blood. <130> NCLX / 008 PCT <150> US 62 / 633,094 <151> 2018-02-21 <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 126 <212> DNA <213> Homo sapiens <400> 1 gtctttgtga cattgagtta cagggctttg actcctgggt ctaaaaatta caccaaatat 60 tgttaaatct taaacactaa cagcaattca agcctcatct tcaggtcctg gagaagatgc 120 caatat 126 <210> 2 <211> 450 <212> DNA <213> Homo sapiens <400> 2 gtcagccttt attatcactt tgcaatacaa agaaagcaag gtgaagacta acttttctct 60 tgtacagaat catcaggcta aatttttggc attatttcag tccttggaga catctgagag 120 attccgggat gccagtggtg cctctctggc cacactgaca acaaataatt cacctaagga 180 atagttcact tcagctattt tttgctactc attggttgtc agtgccattg aggagagctc 240 agtgtagatc aaagaaaacg gtgtagatca aagaaaacgg tgattcggtg attgttcccc 300 ttcttcccag ccacccacca tctgaaccta atgcatcatt gtacaatggc cgtaaaggat 360 gacaagggac tcagcaatca gttcctggag gaaatgatgc tgtggctttt ggctggtggc 420 accatcatcc tcagtcatca gtcagagtca 450 <210> 3 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 3 gtctttgtga cattgagtta cag 23 <210> 4 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 4 atattggcat cttctccagg ac 22 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 5 gtcagccttt attatcactt tgc 23 <210> 6 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 6 tgactctgac tgatgactga gg 22 <210> 7 <211> 520 <212> DNA <213> Homo sapiens <400> 7 gatgcaatag tcagactggg aaaaggtaga tgaatggaaa aggcaaacag gtctttatga 60 aaaacaatgc agatgatctc tggtgtcaca taatgtttat tattattcag ctatgtacat 120 acttgaaaag atccattgtc attaaattat tttttatgtc agcctttatt atcactttgc 180 aatacaaaga aagcaaggtg aagactaact tttctcttgt acagaatcat caggctaaat 240 ttttggcatt atttcagtcc ttggagacat ctgagagatt ccgggatgcc agtggtgcct 300 ctctggccac actgacaaca aataattcac ctaaggaata gttcacttca gctatttttt 360 gctactcatt ggttgtcagt gccattgagg agagctcagt gtagatcaaa gaaaacggtg 420 tagatcaaag aaaacggtga ttcggtgatt gttccccttc ttcccagcca cccaccatct 480 gaacctaatg catcattgta caatggccgt aaaggatgac 520 <210> 8 <211> 642 <212> DNA <213> Homo sapiens <400> 8 atgaatggaa aaggcaaaca ggtctttatg aaaaacaatg cagatgatct ctggtgtcac 60 ataatgttta ttattattca gctatgtaca tacttgaaaa gatccattgt cattaaatta 120 ttttttatgt cagcctttat tatcactttg caatacaaag aaagcaaggt gaagactaac 180 ttttctcttg tacagaatca tcaggctaaa tttttggcat tatttcagtc cttggagaca 240 tctgagagat tccgggatgc cagtggtgcc tctctggcca cactgacaac aaataattca 300 cctaaggaat agttcacttc agctattttt tgctactcat tggttgtcag tgccattgag 360 gagagctcag tgtagatcaa agaaaacggt gtagatcaaa gaaaacggtg attcggtgat 420 tgttcccctt cttcccagcc acccaccatc tgaacctaat gcatcattgt acaatggccg 480 taaaggatga caagggactc agcaatcagt tcctggagga aatgatgctg tggcttttgg 540 ctggtggcac catcatcctc agtcatcagt cagagtcatc aaagtgatca ttcatccatt 600 cactccctcc tctgtctcca ccccacagct aatcaactaa cc 642 <210> 9 <211> 538 <212> DNA <213> Homo sapiens <400> 9 tgaggtagag aaaagaatac tcatgttaaa gatagacatg gaagatataa aaaagaccaa 60 aatcaaactt ctagagatga aaaatgtata ggatgggatc aatagcaaat tagtgcaaaa 120 aaagcaaact tgaaggcaca gcaaaagaaa ccatccaaaa ttaaaacaaa gaaaaggttg 180 gaaaaacata taaagcatca atgagttgag gaacaacttc aagcagtcta atacatgt 240 aaatttgagt cccagaagga agaagtaga gtagactata gaaatttat tttaggaat 300 agcaaaaattt tttccaaact gtatgtgaaa atagaaact acatataaaa atatgatta 360 hurricane rapccagta gttchaacaa ccccaagcac agacacatg agaaagcta 420 aaccaatgta ccctataatt gattgcaca attcaatgg taaaagaaa atcttaaaa 480 gtagccagag ttttaaaaaaaaaagaaaaaaagac acttacata cagaggag 538 <210> 10 <211> 77 <212> DNA <213> Homo sapiens <400> 10 agcaggtga agactactt ttcttgta cagaatcatc agcaggtaatt tttggcatta 60 tttcagtcct tggagag 77

Claims

1. A method for determining the level of contaminating leukocyte DNA in a plasma sample such that it does not interfere with the analysis of cell-free DNA in the plasma sample, the method comprising: (a) Obtaining DNA from the plasma sample; (b) Generated by PCR co-amplification: (i) A first amplification product of 70-150 bp, generated from a first genomic locus using a first primer pair, and (ii) a second amplification product of at least 350 bp, which is generated from a second genomic locus using a second primer pair; (c) Calculate the signal intensity of each of the first amplification product and the second amplification product; and (d) When the difference between the signal intensities is higher than a predetermined threshold, the level of contaminating leukocyte DNA in the plasma sample is determined to be such that it does not interfere with the analysis of cell-free DNA in the plasma sample. For plasma DNA and whole blood DNA, the first amplification product and the second amplification product produce different signal intensity differences.

2. The method of claim 1, wherein step (b) is performed using real-time PCR.

3. The method of claim 2, wherein the method further comprises adding a fluorescent probe for specifically detecting the first amplification product and the second amplification product.

4. The method of claim 3, wherein the signal intensity is a quantitative cycle (Cq), and wherein the separation of the plasma sample is determined based on the difference (ΔCq) between the Cq values ​​of the first amplification product and the second amplification product.

5. The method of claim 4, wherein when the difference between the Cq of the second amplification product and the Cq of the first amplification product is higher than a predetermined threshold ΔCq, the plasma sample is determined to be separated.

6. The method of claim 1, wherein the first primer pair and the second primer pair have equivalent efficiency.

7. The method of claim 1, wherein the first amplification product is 100-150 bp.

8. The method of claim 1, wherein the second amplification product is 350-700 bp.

9. The method of claim 1, wherein the second amplification product is 350-550 bp.

10. The method of claim 1, wherein the first amplification product comprises a sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:

10.

11. The method of claim 1, wherein the first amplification product consists of the sequence listed in SEQ ID NO:1 or SEQ ID NO:

10.

12. The method of claim 1, wherein the second amplification product comprises a sequence selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:

9.

13. The method of claim 1, wherein the second amplification product comprises a sequence listed in SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8 or SEQ ID NO:

9.

14. The method of claim 1, wherein the first amplification product and the second amplification product respectively comprise the sequences listed in SEQ ID NO:1 and SEQ ID NO:

2.

15. The method of claim 1, wherein the first amplification product and the second amplification product are respectively composed of the sequences listed in SEQ ID NO:1 and SEQ ID NO:

2.

16. The method of claim 1, wherein the plasma sample is derived from a human blood sample.