Tagmentation using immobilized transposomes with linkers
Patent Information
- Authority / Receiving Office
- HK · HK
- Patent Type
- Patents
- Current Assignee / Owner
- ILLUMINA INC
- Filing Date
- 2023-09-19
- Publication Date
- 2026-07-10
AI Technical Summary
Existing nucleic acid sample preparation methods are cumbersome, expensive, and inefficient. Immobilized transposon complexes are not stable enough during storage and library preparation, resulting in low enrichment of certain reads in the genome and severe off-target capture.
Transposon complexes with modified linkers are used and immobilized on solid supports via covalent or non-covalent methods. Transposase-mediated fragmentation and labeling methods are employed to combine affinity elements with affinity-binding partners, thereby improving the stability of the complex and reducing off-target capture.
It improves the efficiency of nucleic acid library read enrichment, reduces off-target capture, ensures the consistency and stability of library quality, and simplifies the sample input and library preparation process.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[0001] Related applications
[0002] This application is a divisional application of Chinese Patent Application No. 201880002462.3 and claims priority to U.S. Provisional Patent Application No. 62 / 461,620, filed February 21, 2017, which is incorporated herein by reference in its entirety.
[0003] Referenced sequence list
[0004] This disclosure includes an electronic sequence list. The sequence list is provided by a file named ILLINC-398WO_Sequence_Listing.txt, which was created on February 20, 2017, and is approximately 7KB in size. The information presented in the electronic sequence list is incorporated herein by reference in its entirety. Background Technology Invention Field
[0005] This disclosure relates to methods, compositions, and kits for processing nucleic acids, including methods and compositions for fragmenting and labeling nucleic acids (such as DNA) using transposon complexes immobilized on a solid support.
[0006] Current protocols for next-generation sequencing (NGS) of nucleic acid samples typically employ sample preparation methods to convert DNA or RNA into libraries of fragmented, sequenceable templates. These sample preparation methods often require multiple steps and material transfer, and utilize expensive instruments for fragmentation, making them generally difficult, cumbersome, costly, and inefficient.
[0007] In one approach, nucleic acid fragment libraries can be prepared using a transposon-based method, wherein two transposon terminal sequences (one linked to a tag sequence) and a transposase form a transposon complex. The transposon complex is used to fragment and tag target nucleic acids in solution to produce a tagged fragmentation library for use by a sequencer. The transposon complex can be immobilized on a solid surface, for example, by attaching biotin to the 5' end of one of the two terminal sequences. Using immobilized transposons offers significant advantages over solution-phase methods, namely reduced hands-on and overall library preparation time, cost, and reagent requirements, lower sample input requirements, and the ability to use unpurified or degraded samples as a starting point for library preparation. Exemplary transposon procedures and systems for immobilizing transposons on solid surfaces to produce uniform fragment size and library yield are described in detail in WO 2014 / 108810 and WO 2016 / 189331, each of which is incorporated herein by reference in its entirety.
[0008] In certain bead-based tagmentation methods described in PCT Publication No. WO 2016 / 189331 and US 2014 / 093916 Al, biotin-streptavidin interactions are used to bind transposomes to magnetic beads. During the subsequent PCR amplification step of the protocol, the biotin-streptavidin linkage is disrupted by heat denaturation, releasing the biotinylated tagmentation products into solution. If desired, amplicons or target amplicons with a sequence of interest can be enriched, for example, by hybrid capture, and sequenced.
[0009] However, when libraries prepared by tagmentation using immobilized transposomes are enriched for certain regions of the genome using common hybrid capture methods, lower read enrichment can be achieved for certain regions of the genome compared to enrichment of libraries generated using solution-based transposome methods.
[0010] Furthermore, the stability of support-bound transposome complexes varies depending on the linker configuration used to link the transposome complex to the support. If the complex is removed from the support during storage or during library preparation, the quality and efficiency of the resulting library is affected. Thus, there is a need for immobilized transposome complexes with improved stability and related methods that demonstrate improved efficiency of tagmentation library generation and, in turn, increased read enrichment of the resulting library. There is also a need for compositions and methods that will improve read enrichment of the resulting library.
[0011] The present disclosure relates to support-bound transposome complexes having modified linkers and component arrangements. The present disclosure provides methods and compositions for generating nucleic acid libraries for sequencing using such modified complexes. SUMMARY
[0012] The present disclosure relates to methods, compositions, and kits for processing nucleic acids, including methods and compositions for fragmenting and labeling DNA using transposome complexes on a solid support.
[0013] The present disclosure provides a transposome complex comprising a transposase, a first transposon, and a second transposon, wherein the first transposon comprises (a) a 3' portion comprising a first transposon end sequence, and (b) a first adapter sequence at the 5' end of the first transposon end sequence, and the second transposon comprises a second transposon end sequence that is complementary to at least a portion of the first transposon end sequence. Typically, the first transposon end sequence and the second transposon end sequence anneal together to form a double-stranded transposon end sequence that is recognized by the transposase, which combination forms a functional transposome complex.
[0014] In some aspects, the transposome complex comprises a cleavable linker that is capable of linking the first transposon (and thus the complex) to a solid support. In such aspects, a first end of the cleavable linker is linked to the 5’ end of the first adapter sequence, and in some aspects, a second end of the cleavable linker is linked to an affinity element. The affinity element is capable of binding (covalently or non-covalently) to an affinity binding partner on the solid support. In some aspects, the affinity element binds (covalently or non-covalently) to the affinity binding partner on the solid support, providing a solid support-bound transposome complex. These complexes are 5’-linker transposome complexes and solid support-bound 5’-linker transposome complexes.
[0015] In other aspects, the transposome complex comprises a 3’ linker that is capable of linking the second transposon (and thus the complex) to a solid support. In such aspects, a first end of the linker is linked to the 3’ end of the second transposon, and a second end of the linker is linked to an affinity element. The affinity element is capable of binding (covalently or non-covalently) to an affinity binding partner on the solid support. In some aspects, the affinity element binds (covalently or non-covalently) to the affinity binding partner on the solid support, providing a solid support-bound transposome complex. In some aspects, the linker is a cleavable linker. These complexes are 3’-linker transposome complexes and solid support-bound 3’-linker transposome complexes.
[0016] In some aspects, the disclosure relates to a modified oligonucleotide. In some aspects, the modified oligonucleotide comprises a first transposon and a second transposon, wherein the first transposon comprises (a) a 3’ portion comprising a first transposon end sequence and (b) a first adapter sequence at the 5’ end of the first transposon end sequence, and the second transposon comprises a second transposon end sequence that is complementary to and anneals to at least a portion of the first transposon end sequence, and wherein a first end of a cleavable linker is attached to the 5’ end of the first adapter sequence, and in some aspects, a second end of the cleavable linker is attached to an affinity element.
[0017] In other aspects, the modified oligonucleotide comprises a first transposon and a second transposon, wherein the first transposon comprises (a) a 3’ portion comprising a first transposon end sequence and (b) a first adapter sequence at the 5’ end of the first transposon end sequence, and the second transposon comprises a second transposon end sequence that is complementary to and anneals to at least a portion of the first end sequence, and a first end of a linker is attached to the 3’ end of the second transposon, and a second end of the linker is attached to an affinity element. In some aspects, the linker is a cleavable linker.
[0018] In some embodiments of the 3' linker transposome complex, the affinity element and the linker have a structure of Formula (I), Formula (I'), Formula (la), Formula (lb), Formula (Ic), Formula (I(a)), Formula (I(b)), or Formula (I(c)) as described herein. In some aspects, the affinity element is covalently linked to the 3' end of the second transposon, wherein the affinity element and the linker have a structure of Formula (I):
[0019]
[0020] wherein:
[0021] AE is an affinity element;
[0022] Y is C 2-6 alkylene;
[0023] X 1 is O, NR 1 , or S;
[0024] wherein R 1 is H or C 1-10 alkyl;
[0025] n is an integer selected from the group consisting of 1, 2, 3, 4, 5, and 6;
[0026] X 2 is O, CH2, or S;
[0027] R a is H or -OH; and
[0028] Z is absent when R a is H, or Z is CH2when R a is H or OH;
[0029] wherein marks the point of attachment to the second transposon.
[0030] In some aspects, the linkers described herein are 5' linkers, wherein the phosphate group in Formula (I) is a terminal phosphate group at the 5' position of a terminal nucleotide of the first transposon. In some aspects, the linkers described herein are 3' linkers, wherein the phosphate group in Formula (I) is linked to a 3' hydroxyl group, such as a 3' terminal nucleotide, of the second transposon oligonucleotide.
[0031] In other aspects, the present disclosure provides methods of generating a library of tagged nucleic acid fragments from a double-stranded target nucleic acid, comprising incubating the target with a transposome complex bound to a solid support as described herein. In some aspects, the method comprises treating the target with the immobilized transposome complex under conditions in which the target is fragmented and the 3' end of the first transposon is ligated to the 5' end of the target fragments to generate a plurality of 5' tagged target fragments. In some embodiments, a plurality of transposome complexes are used.
[0032] In some embodiments, the method further comprises amplifying one or more of the 5' tagged target fragments. In some embodiments, the method further comprises sequencing one or more of the 5' tagged target fragments or amplification products thereof.
[0033] Accordingly, some other embodiments of the present disclosure relate to methods of generating a library of tagged nucleic acid fragments, comprising:
[0034] Provided are solid supports comprising a transposome complex as described herein immobilized thereon; and
[0035] contacting the solid support with a double-stranded target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and ligate the 3' end of the first transposon to the 5' end of the target fragments to provide a plurality of 5' tagged target fragments.
[0036] In some aspects, the method further comprises amplifying the 5' tagged target fragments.
[0037] In some aspects, the present disclosure provides a library of 5' tagged target fragments generated by the methods described herein.
[0038] The present disclosure also provides methods of making modified oligonucleotides, transposome complexes, and solid support-bound transposome complexes as described herein. In some aspects, such methods comprise treating a transposase with a first transposon and a second transposon as described herein under conditions suitable for complex formation. Methods for making solid support-bound transposome complexes comprise incubating a transposome complex as described herein with a solid support comprising an affinity binding partner under conditions sufficient for the affinity element to bind (covalently or non-covalently) to the affinity binding partner.
[0039] In some embodiments of the compositions and methods described herein, the transposome complex comprises two populations, wherein the first adapter sequence in each population is different.
[0040] By way of non-limiting example, the present application provides the following embodiments:
[0041] 1. A transposome complex, comprising:
[0042] (i) a transposase,
[0043] (ii) a first transposon comprising:
[0044] (a) a 3' portion comprising a first transposon end sequence; and
[0045] (b) a first adaptor sequence at the 5' end of the first transposon end sequence;
[0046] (iii) a second transposon comprising a second transposon end sequence complementary to at least a portion of the first transposon end sequence; and
[0047] (iv) a linker attached to the first or second transposon and comprising an affinity element.
[0048] 2. The complex of embodiment 1, wherein the linker is attached to the second transposon at the 3' end of the second transposon.
[0049] 3. The complex of embodiment 2, wherein a second end of the linker is attached to the affinity element.
[0050] 4. The complex of embodiment 3, wherein the linker and affinity element have the structure of formula (I):
[0051]
[0052] wherein:
[0053] AE is the affinity element;
[0054] Y is C 2-6 alkylene;
[0055] X 1 is O, NR 1 , or S;
[0056] wherein R 1 is H or C 1-10 alkyl;
[0057] n is an integer from 1 to 6;
[0058] X 2 is O, CH2, or S;
[0059] R a is H or -OH; and
[0060] Z is absent when R a is H, or Z is CH2when R a is H or OH;
[0061] wherein labeled with a linking moiety to a connecting point of the second transposon.
[0062] 5. The complex of embodiment 4, wherein the phosphate group in formula (I) is linked to the 3' hydroxyl of the terminal nucleotide of the second transposon.
[0063] 6. The complex of embodiment 4 or embodiment 5, wherein AE comprises or is an optionally substituted biotin or amino group.
[0064] 7. The complex of embodiment 6, wherein AE is biotin.
[0065] 8. The complex of any one of embodiments 4-7, wherein Y is C 2-6 alkylene, C 2-5 alkylene, C 2-4 alkylene, or C 2-3 alkylene.
[0066] 9. The complex of embodiment 8, wherein Y is ethylene, propylene, or butylene.
[0067] 10. The complex of any one of embodiments 4-9, wherein X 1 is NR 1 and wherein R 1 is H or C 1-10 alkyl.
[0068] 11. The complex of embodiment 10, wherein R 1 is H.
[0069] 12. The complex of any one of embodiments 4-11, wherein n is 1 or 2.
[0070] 13. The complex of any one of embodiments 4-12, wherein X 2 is CH2.
[0071] 14. The complex of any one of embodiments 4-12, wherein X 2 is O.
[0072] 15. The complex of any one of embodiments 4-14, wherein R a is H and Z is absent.
[0073] 16. The complex of any one of embodiments 4-14, wherein R a is H and Z is CH2.
[0074] 17. The complex of any one of embodiments 4-14, wherein R ais -OH and Z is CH2.
[0075] 18. The complex of embodiment 4, wherein the linker and affinity element have the structure of Formula (I’):
[0076]
[0077] wherein Z is absent or CH2.
[0078] 19. The complex of embodiment 4, wherein the linker and affinity element have the structure of Formula (la):
[0079]
[0080] 20. The complex of embodiment 4, wherein the linker and affinity element have the structure of Formula (lb) or Formula (lc):
[0081]
[0082] wherein n is 1 or 2;
[0083] X 2 is O or CH2; and
[0084] Z is absent or CH2.
[0085] 21. The complex of embodiment 4, wherein the linker and affinity element have a structure selected from the group consisting of:
[0086]
[0087]
[0088] 22. The complex of any one of embodiments 1-21, wherein the transposase is a Tn5 transposase.
[0089] 23. The complex of embodiment 22, wherein the Tn5 transposase is a wild-type Tn5 transposase or a hyperactive Tn5 transposase or a mutant thereof, wherein the transposase is optionally conjugated to a purification tag.
[0090] 24. The complex of embodiment 22 or embodiment 23, wherein the first transposon end sequence and the second transposon end sequence are ME and ME’.
[0091] 25. The complex of any one of embodiments 1-24, wherein the first adapter sequence comprises a primer sequence.
[0092] 26. The complex of embodiment 25, wherein the first adaptor sequence comprises A14 or B15.
[0093] 27. A first complex of embodiment 25, wherein the first adaptor comprises a first primer sequence, and a second complex of embodiment 25, wherein the first adaptor comprises a second primer sequence.
[0094] 28. The complex of embodiment 27, wherein the first primer sequence comprises A14 and the second primer sequence comprises B15.
[0095] 29. A modified oligonucleotide comprising a first transposon and a second transposon, wherein the first transposon comprises (a) a 3’ portion comprising a first transposon end sequence and (b) a first adaptor sequence at the 5’ end of the first transposon end sequence, and the second transposon comprises a second transposon end sequence that is complementary to and anneals to at least a portion of the first transposon end sequence, and wherein a first end of a linker is attached to the 3’ end of the second transposon and a second end of the linker is attached to an affinity element.
[0096] 30. The modified oligonucleotide of embodiment 29, wherein the linker and the affinity element have a structure of Formula (I), Formula (I’), Formula (la), Formula (lb), Formula (lc), Formula (I(a)), Formula (I(b)), or Formula (I(c)) of any one of embodiments 1-28.
[0097] 31. The complex of any one of embodiments 1-28, wherein the affinity element binds to an affinity binding partner on a solid support, whereby the complex is bound to the solid support.
[0098] 32. The complex of embodiment 31, wherein the affinity element is biotin and the affinity binding partner is streptavidin.
[0099] 33. The complex of embodiment 31 or 32, wherein the solid support is a bead or a paramagnetic bead.
[0100] 34. A method for generating a library of tagged nucleic acid fragments from a double- stranded target nucleic acid, the method comprising incubating the target nucleic acid with a bound complex of any one of embodiments 31-33 under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to join the 3’ end of the first transposon to the 5’ end of the target fragments to produce a plurality of 5’ tagged target fragments.
[0101] 35. The method of embodiment 34, further comprising amplifying one or more of the 5’- tagged target fragments.
[0102] 36. The method of embodiment 35, wherein the amplifying comprises generating and / or amplifying fully duplexed 5’-tagged target fragments.
[0103] 37. The method of embodiment 35 or 36, wherein the amplifying comprises incubating at least one fully duplexed 5’-tagged target fragment comprising a primer sequence at each end with a secondary adaptor carrier, a single nucleotide, and a polymerase under conditions sufficient to amplify the target fragment and incorporate into a secondary adaptor carrier, wherein the secondary adaptor carrier comprises a complement of the primer sequence and a secondary adaptor sequence, thereby generating a library of sequencing fragments.
[0104] 38. The method of embodiment 37, wherein the secondary adaptor carrier comprises a primer sequence, an index sequence, a barcode sequence, a purification tag, or a combination thereof.
[0105] 39. The method of embodiment 38, wherein the secondary adaptor carrier comprises an index sequence and a primer sequence.
[0106] 40. The method of any one of embodiments 36-39, wherein the fully duplexed 5’-tagged target fragments comprise different primer sequences at each end, optionally wherein the different primer sequences are A14 and B15.
[0107] 41. The method of any one of embodiments 38-40, wherein the secondary adaptor carrier each comprises one of two primer sequences, optionally wherein the two primer sequences are a P5 primer sequence and a P7 primer sequence, and one of a plurality of index sequences.
[0108] 42. The method of any one of embodiments 34-41, wherein the fragments hybridize to complementary primers grafted to a flow cell or a solid support.
[0109] 43. The method of any one of embodiments 34-42, further comprising sequencing one or more of the 5’-tagged target fragments or amplification products thereof.
[0110] 44. A method for making a solid support-bound transposome complex, the method comprising treating a transposase with the modified oligonucleotide of embodiment 29 or 30 under conditions sufficient to bind the transposase to the modified oligonucleotide in a transposome complex.
[0111] 45. The method of embodiment 44, further comprising incubating the transposome complex with a solid support comprising an affinity binding partner under conditions sufficient for the affinity element to bind to the affinity binding partner.
[0112] 46. The transposome complex of embodiment 1, wherein the linker is a cleavable linker.
[0113] 47. The transposome complex of embodiment 46, the cleavable linker is attached to the 5’ end of the first adaptor sequence.
[0114] 48. The transposome complex of embodiment 1, wherein the linker is attached to the 5’ end of the first transposon and the linker is a cleavable linker.
[0115] 49. The complex of embodiment 48, wherein the affinity element binds to an affinity binding partner on a solid support.
[0116] 50. The complex of embodiment 49, wherein the solid support is a tube, a plate well, a slide, a bead, or a flow cell, optionally, wherein solid support is a paramagnetic bead.
[0117] 51. The complex of embodiment 49 or embodiment 50, wherein the affinity element is biotin and the affinity binding partner is streptavidin.
[0118] 52. The complex of any one of embodiments 49-51, wherein the adaptor sequence comprises one or more sequences selected from a universal sequence, a primer sequence, or a sequencing related sequence.
[0119] 53. A method of preparing a sample for sequencing, comprising:
[0120] providing a complex of any one of embodiments 49-52;
[0121] applying a nucleic acid to the complex under conditions suitable for tagmentation, thereby immobilizing fragments of the target nucleic acid to the solid support;
[0122] amplifying the immobilized, tagmented nucleic acid;
[0123] cleaving the cleavable moiety; and
[0124] enriching the targeted amplified nucleic acid, thereby preparing a sample for sequencing.
[0125] 54. The method of embodiment 53, wherein the cleavable linker comprises a photo- cleavable or an enzymatically cleavable nucleotide, optionally wherein the cleavable nucleotide is a uracil, uridine, 8-oxo-guanine, xanthine, hypoxanthine, 5,6-dihydrouracil, 5- methylcytosine, thymine dimer, 7-methylguanosine, 8-oxo-deoxyguanosine, xanthosine, inosine, dihydrouridine, bromodeoxyuridine, uridine, or 5-methylcytidine, optionally wherein the cleavable nucleotide is a uracil.
[0126] 55. The method of embodiment 54, wherein the cleavage is accomplished with an enzyme that is (a) a glycosylase enzyme, optionally wherein the glycosylase enzyme is selected from the group comprising: uracil DNA glycosylase, MUG, SMUG, TDG, or MBD4, optionally wherein the glycosylase enzyme is uracil DNA glycosylase, or (b) an apurinic / apyrimidinic (AP) endonuclease, optionally wherein the AP endonuclease is selected from the group comprising: Endo VIII, Endo IV, or Endo V, optionally wherein the AP endonuclease is Endo VIII.
[0127] 56. The method of any one of embodiments 53-55, wherein the solid support comprises a bead, optionally wherein the bead is a paramagnetic bead.
[0128] 57. The method of any one of embodiments 53-56, wherein the nucleic acid is (a) a DNA, optionally wherein the DNA is double stranded, optionally wherein the double stranded DNA is genomic DNA, optionally wherein the genomic DNA is selected from the group comprising: single cell, tissue, tumor, blood, plasma, urine, or cell-free nucleic acid, or (b) an RNA or derivative thereof, or a cDNA.
[0129] 58. The method of any one of embodiments 53-57, wherein the amplification step comprises one or more of a PCR or an isothermal amplification, or the amplification step is a PCR.
[0130] 59. The method of any one of embodiments 53-58, wherein the transposon sequence further comprises one or more adaptor sequences selected from the group comprising: a universal sequence, a primer sequence, or a sequencing-related sequence. SUMMARY
[0131] Figure 1 Exemplary steps of a method of immobilizing an embodiment of a transposome complex to a surface of a bead are shown.
[0132] Figure 2 A schematic diagram of an exemplary tagmentation process on a bead surface by a cluster on a flow cell is shown.
[0133] Figure 3 Exemplary steps of a method for fragmenting and labeling DNA using transposome complexes immobilized on the surface of a bead followed by target enrichment are shown, resulting in contaminant target reads.
[0134] Figure 4 Exemplary steps of a method for fragmenting and labeling DNA using transposome complexes immobilized on the surface of a bead using enzymatically cleavable linkers are shown followed by target enrichment.
[0135] Figure 5A Examples of biotinylated 5’ ends of a transposon sequence attached to a solid surface for tagmentation and subsequent amplification are shown.
[0136] Figure 5B Examples of biotinylated 3’ ends of a transposon sequence attached to a solid surface for tagmentation and subsequent amplification are shown.
[0137] Figure 6A Library yield from solid phase tagmentation based on streptavidin beads using transposome complexes with two different 3’ biotinylated linkers are compared.
[0138] Figure 6B Accelerated stability data for sample libraries prepared from solid phase tagmentation based on streptavidin beads using transposome complexes with 3’-biotinylated linkers of Formula (I(a)) after aging for 4 months compared to sample libraries prepared from the same complexes from non-aged batches (control) are demonstrated.
[0139] Figure 6C Accelerated stability data for sample libraries prepared from transposome complexes with 3’-biotinylated linkers of Formula (I(c)) after aging for 4 and 8 months compared to sample libraries prepared from non-aged complexes (control) are demonstrated.
[0140] Figure 7A Target insert size of DNA molecules as a function of complex density is demonstrated using solid phase library preparation based on streptavidin beads, wherein the beads contain immobilized transposome complexes bound thereon by 3’-biotinylated linkers.
[0141] Figure 7B is a line plot showing target insert size of DNA molecules as a function of SPRI conditions using streptavidin beads containing immobilized transposome complexes containing highly active Tn5 transposase and 3’-biotinylated linkers and a complex density of 100 nM.
[0142] Figure 7Cis a plot showing the target insert size of DNA molecules as a function of SPRI conditions using streptavidin beads containing immobilized transposome complexes containing highly active Tn5 transposase and 3 '-biotinylated linkers and a complex density of 600 nM. DETAILED DESCRIPTION
[0143] Libraries of fragmented nucleic acids are often generated from genomic nucleic acids for next generation sequencing (NGS) applications. The present disclosure provides methods, compositions, and kits for methods of immobilized transposition library preparation. Methods of immobilized transposition library preparation are fast relative to other library preparation methods and efficiently prepare libraries from crude or unpurified samples (such as blood, sputum, cell extracts, etc.) and purified samples (such as purified genomic nucleic acids). Typically, transposomes are immobilized on a substrate (such as a slide or bead) using covalent or non-covalent binding partners (such as affinity elements and affinity binding partners). Figure 1 For example, transposome complexes are immobilized on streptavidin-coated beads through biotinylated linkers attached to the transposome complexes. Target nucleic acids are captured by the immobilized transposome complexes, and the nucleic acids are fragmented and labeled ("tagmentation"). The labeled fragments are amplified, optionally, target amplicons are captured (e.g., via hybridization probes), and the labeled fragments are sequenced.
[0144] The use of solid support-linked transposome complexes for library preparation reduces the need for normalization of sample input into the library preparation process, as well as normalization of library output prior to enrichment or sequencing steps. The use of these complexes produces libraries with more consistent insert sizes relative to solution phase methods, even with different sample input concentrations. However, it was observed that the stability of certain transposome complexes with biotinylated linkers was reduced. In addition, certain support-bound complex configurations produced off-target products; in particular, hybridization and capture of amplicons of 5' labeled target fragments can be contaminated by nucleic acid fragments that are still hybridized to immobilized nucleic acids. Figure 3 This inefficiency can result in waste of reagents and measurement instrument or flow cell space (for off-target fragments and sequencing data). The present application discloses various transposome complex designs to address library quality issues and reduce off-target capture, and complexes with modified linkers that show improved chemical stability.
[0145] In some embodiments, the nucleic acid libraries obtained by the methods disclosed herein can be sequenced using any suitable nucleic acid sequencing platform to determine the nucleic acid sequence of the target sequences. In some aspects, the target sequences are associated with or linked to one or more congenital or genetic disorders, pathogenicity, antibiotic resistance, or genetic modification. Sequencing can be used to determine the nucleic acid sequence of short tandem repeats, single nucleotide polymorphisms, genes, exons, coding regions, exomes, or portions thereof. Accordingly, the methods and compositions described herein relate to creating sequencable libraries for use in, but not limited to, cancer and disease diagnosis, prognosis, and treatment, DNA fingerprinting applications (e.g., DNA databases, criminal case work), metagenomic research and discovery, agricultural genomics applications, and pathogen identification and monitoring.
[0146] By using transposase-mediated fragmentation and tagging, the number of steps required to transform a target nucleic acid, such as DNA, into an adaptor-modified template ready for next generation sequencing can be minimized. This process is referred to herein as "tagmentation," and generally involves modification of a target nucleic acid by a transposome complex comprising a transposase complexed with a pair of transposons comprising a single-stranded adaptor sequence and a double-stranded transposon end sequence region, and optionally other sequences designed for a particular purpose. Tagmentation results in simultaneous fragmentation of the target nucleic acid and ligation of adaptors to the 5' ends of both strands of the duplex nucleic acid fragments. If the transposome complex is support-bound, the resulting fragments bind to a solid support following the tagmentation reaction (either directly in the case of a 5' ligating transposome complex, or via hybridization in the case of a 3' ligating transposome complex).
[0147] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. All patents, applications, publications, and other publications cited herein are incorporated herein by reference in their entirety unless otherwise stated. If a term has multiple definitions herein, those definitions in this section shall prevail unless otherwise stated. As used in the specification and appended claims, the singular forms “a,” “an,” and “the” include plural indicators unless the context clearly specifies otherwise. Unless otherwise stated, conventional mass spectrometry, NMR, HPLC, protein chemistry, biochemistry, recombinant DNA techniques, and pharmacological methods are employed. Unless otherwise stated, the use of “or” or “and” means “and / or.” Furthermore, the use of the term “including” and other forms such as “include,” “includes,” and “included” is not restrictive. As used in this specification, whether in transitional phrases or in the body of the claims, the terms “including” and “comprising” shall be interpreted in an open-ended sense. In other words, this term is interpreted synonymously with the phrases "having at least" or "including at least". When used in the context of a process, the term "comprising" means that the process includes at least the steps referenced, but may include additional steps. When used in the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the features or components referenced, but may also include additional features or components.
[0148] The chapter titles used in this article are for organizational purposes only and should not be construed as limiting the topics described.
[0149] Chemical terms
[0150] As used herein, “alkyl” refers to a fully saturated (i.e., without double or triple bonds) straight-chain or branched hydrocarbon chain. The alkyl group may have 1 to 20 carbon atoms (wherever it appears herein, numerical ranges such as “1 to 20” refer to every integer within a given range; e.g., “1 to 20 carbon atoms” means that the alkyl group may consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and including 20 carbon atoms, although this definition also covers the term “alkyl” where no numerical range is specified). Alkyl groups may also be medium-sized alkyl groups having 1 to 9 carbon atoms. Alkyl groups may also be lower alkyl groups having 1 to 6 carbon atoms. Alkyl groups may be specified as “C…” 1-4 Alkyl or similar names. For example only, "C 1-6"Alkyl" denotes the presence of one to six carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of: methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl. Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, and hexyl, and the like.
[0151] As used herein, "alkoxy" refers to the group -OR, where R is an alkyl group as defined above, such as "C 1-9 alkoxy," includes, but is in no way limited to, methoxy, ethoxy, n-propoxy, 1-methylethoxy (isopropoxy), n-butoxy, isobutoxy, sec-butoxy, and t-butoxy, and the like.
[0152] As used herein, "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing only carbon in the main ring. When the aryl group is a ring system, each ring in the system is aromatic. The aryl group can have 6-18 carbon atoms, although the present definition also encompasses the term "aryl" as it appears without a numerical range being specified. In some embodiments, the aryl group has 6 to 10 carbon atoms. The aryl group can be designated as "C 6-10 aryl," "C6or C 10 aryl," or similar designations. Examples of aryl groups include, but are in no way limited to, phenyl, naphthyl, azulenyl, and anthracenyl.
[0153] "Arylalkyl" or "arylalkyl" is an aryl group as a substituent connected via an alkylene group, such as "C 7-14 arylalkyl" and the like, include, but are in no way limited to, benzyl, 2-phenylethyl, 3-phenylpropyl, and naphthylalkyl. In some cases, the alkylene group is a lower alkylene group (i.e., a C 1-6 alkylene group).
[0154] As used herein, "carbocyclyl" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When the carbocyclyl group is a ring system, two or more rings can be joined together in a fused, bridged, or spiro- connection. The carbocyclyl group can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Thus, carbocyclyl includes cycloalkyl, cycloalkenyl, and cycloalkynyl. The carbocyclyl group can have 3 to 20 carbon atoms, although the present definition also encompasses the term "carbocyclyl" as it appears without a numerical range being specified. The carbocyclyl group can also be a medium size carbocyclyl group having 3 to 10 carbon atoms. The carbocyclyl group can also be a carbocyclyl group having 3 to 6 carbon atoms. The carbocyclyl group can be designated as "C 3-6"Carbocyclic" or similar names. Examples of carbocyclic rings include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octyl, adamantyl, and spiro[4.4]nonyl.
[0155] As used in this article, where "a" and "b" are integers, "C" represents the integers. a To C b "or "C a-b The 'a' indicates the number of carbon atoms in a specified group. That is, the group can contain "a" to "b" (including the terminal value) carbon atoms. Therefore, for example, "C1 to C4 alkyl" or "C 1-4 "Alkyl" groups refer to all-alkyl groups having 1 to 4 carbons, namely CH3-, CH3CH2-, CH3CH2CH2-, (CH3)2CH-, CH3CH2CH2CH2-, CH3CH2CH(CH3)- and (CH3)3C-.
[0156] As used herein, the terms "covalent attachment" or "covalent bonding" refer to the formation of a chemical bond characterized by the sharing of electron pairs between atoms. For example, a covalently attached polymer coating refers to a polymer coating that forms a chemical bond with a functionalized surface of a substrate, as opposed to attachment to a surface via other means such as adhesion or electrostatic interactions. It should be understood that polymers covalently attached to surfaces can also be bonded via means other than covalent attachment, such as physical adsorption.
[0157] The term “halogen” or “halogen group”, as used herein, refers to any of the radioactive stable atoms in column 7 of the periodic table, such as fluorine, chlorine, bromine, or iodine, with fluorine and chlorine being preferred.
[0158] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent atoms) that contains one or more heteroatoms, i.e., elements other than carbon, in the ring backbone, including but not limited to nitrogen, oxygen, and sulfur. When the heteroaryl is a ring system, each ring in the system is aromatic. Heteroaryl groups can have 5-18 ring members (i.e., the number of atoms (including carbon atoms and heteroatoms) that make up the ring backbone), although the present definition also encompasses the term "heteroaryl" as it appears to specify no numerical range. In some embodiments, a heteroaryl group has 5 to 10 ring members or 5 to 7 ring members. Heteroaryl groups can be designated as "5-7 membered heteroaryl," "5-10 membered heteroaryl," or similar designations. Examples of heteroaryl rings include, but are not limited to, furanyl, thienyl, phthalazinyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, triazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzoxazolyl, benzothiazolyl, indolyl, isoindolyl, and benzothiophenyl.
[0159] As used herein, "heterocyclyl" means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the main ring. Heterocyclyl groups can be linked together in a fused, bridged, or spiro-connected manner. Heterocyclyl groups can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. One or more heteroatoms can be present in the non-aromatic or aromatic rings in the ring system. Heterocyclyl groups can have 3 to 20 ring members (i.e., the number of atoms comprising the ring backbone, including carbon atoms and heteroatoms), although the present definition also encompasses the term "heterocyclyl" appearing without a numerical range designator. Heterocyclyl groups can also be medium-sized heterocyclyl groups having 3 to 10 ring members. Heterocyclyl groups can also be heterocyclyl groups having 3 to 6 ring members. Heterocyclyl groups can be designated as "3-6 membered heterocyclyl" or similar designations. In preferred six-membered monocyclic heterocyclyl groups, one or more heteroatoms are selected from one up to three of O, N, or S, and in preferred five-membered monocyclic heterocyclyl groups, one or more heteroatoms are selected from one or two heteroatoms selected from O, N, or S. Examples of heterocyclyl rings include, but are not limited to, azepinyl, acridinyl, carbazolyl, cinnolinyl, dioxolanyl, imidazolinyl, imidazolidinyl, morpholinyl, oxiranyl, oxepanyl, thiepanyl, piperidinyl, piperazinyl, dioxopiperazinyl, pyrrolidinyl, pyrrolidonyl, pyrrolidionyl, 4-piperidonyl, pyrazolinyl, pyrazolidinyl, 1,3-dioxinyl, 1,3-dioxanyl, 1,4-dioxinyl, 1,4-dioxanyl, 1,3-oxathiolanyl, 1,4-oxathianyl, 2H-l,2-oxazinyl, trioxanyl, hexahydro-l,3,5-triazinyl, 1,3- dioxolyl, 1,3-dioxolanyl, 1,3-dithiolyl, 1,3-dithiolanyl, isoxazolinyl, isoxazolidinyl, oxazolinyl, oxazolidinyl, oxazolidinonyl, thiazolinyl, thiazolidinyl, 1,3-oxathiolanyl, indolinyl, isoindolinyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydro-l,4-thiazinyl, thiamorpholinyl, dihydrobenzofuranyl, benzimidazolidinyl, and tetrahydroquinolinyl.
[0160] As used herein, a substituted group is derived from an unsubstituted parent group in which one or more hydrogen atoms has been exchanged for another atom or group. Unless otherwise indicated, when a group is deemed to be "substituted," it is meant that the group is substituted with one or more substituents independently selected from C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, C1-C6 heteroalkyl, C3-C7 carbocyclyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), C3-C7-carbocyclyl-C1-C6-alkyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), 3-10 membered heterocyclyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), 3-10 membered heterocyclyl-C1-C6-alkyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), aryl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), aryl(C1-C6)alkyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), 5-10 membered heteroaryl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), 5-10 membered heteroaryl(C1-C6)alkyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), halo, cyano, hydroxy, C1-C6 alkoxy, C1-C6 alkoxy(C1-C6)alkyl (i.e., an ether), aryloxy, thiol (mercapto), halo(C1-C6)alkyl (e.g., -CF3), halo(C1-C6)alkoxy (e.g., -OCF3), C1-C6 alkylthio, arylthio, amino, amino(C1-C6)alkyl, nitro, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, C-amido, N-amido, S-sulfonamido, N-sulfonamido, C-carboxy, O-carboxy, acyl, cyanato, isocyanoato, thiocyanato, isothiocyanato, sulfinyl, sulfonyl, sulfo, sulfo, oxo (=0). Where a group is described as "optionally substituted," the group can be substituted with the above-listed substituents.
[0161] In some embodiments, the transposome complex is immobilized to a support via one or more polynucleotides (e.g., oligonucleotides), such as a polynucleotide (oligonucleotide) comprising a transposon end sequence. In some embodiments, the transposome complex can be immobilized via a linker attached to the end of the transposon sequence, for example, coupling the transposase enzyme to a solid support. In some embodiments, both the transposase enzyme and the transposon polynucleotide (e.g., oligonucleotide) are immobilized to a solid support. When referring to immobilizing a molecule (e.g., a nucleic acid, an enzyme) to a solid support, the terms "immobilize," "immobilized," and "attached" are used interchangeably herein, and both terms are intended to include attachment, either directly or indirectly, covalently or non-covalently, unless expressly stated otherwise or otherwise apparent from the context. In certain embodiments of the present disclosure, covalent attachment can be preferred, but what is generally required is that the molecule (e.g., nucleic acid, enzyme) remains immobilized or attached to the support under the conditions in which the support is intended to be used (e.g., in applications requiring nucleic acid amplification and / or sequencing). In some cases, in bead-based tagmentation, the transposome can bind to the bead surface via a ligand pair, such as an affinity element and an affinity binding partner.
[0162] Transposomes and transposases
[0163] Transposon-based techniques can be used to fragment DNA, for example, as exemplified by the workflow of NEXTERA XT and FLEX DNA Sample Preparation Kits (Illumina, Inc.), in which a target nucleic acid, such as genomic DNA, is treated with a transposome complex that simultaneously fragments and labels ( "tagments") the target, thereby creating a population of fragmented nucleic acid molecules labeled at the fragment ends with unique adapter sequences. TM
[0164] A transposition reaction is a reaction in which one or more transposons insert at random or nearly random sites into a target nucleic acid. Components in a transposition reaction include a transposase enzyme (or other enzyme capable of fragmenting and labeling a nucleic acid as described herein, such as an integrase) and a transposon element, which includes a double-stranded transposon end sequence bound to the enzyme and an adapter sequence attached to one of the two transposon end sequences. One strand of the double-stranded transposon end sequence is transferred to a strand of the target nucleic acid and the complementary transposon end sequence strand is not transferred (i.e., untransferred transposon sequence). The adapter sequence can comprise one or more functional sequences (e.g., primer sequences), as desired or as desired.
[0165] A "transposome complex" includes at least one transposase and a transposon recognition sequence. In some such systems, the transposase binds to the transposon recognition sequence to form a functional complex capable of catalyzing a transposition reaction. In some aspects, the transposon recognition sequence is a double-stranded transposon end sequence. The transposase or integrase binds to a transposase recognition site in a target nucleic acid and inserts the transposon recognition sequence into the target nucleic acid. In some such insertion events, one strand of the transposon recognition sequence (or end sequence) is transferred to the target nucleic acid, also resulting in a cleavage event. Exemplary transposition procedures and systems that can be readily adapted for use with the transposases of the present disclosure are described, for example, in PCT Publication No. WO 10 / 048605, U.S. Patent Publication No. 2012 / 0301925, U.S. Patent Publication No. 2012 / 13470087, or U.S. Patent Publication No. 2013 / 0143774, each of which is incorporated herein by reference in its entirety.
[0166] Exemplary transposases that can be used with certain embodiments provided herein include (or are encoded by): Tn5 transposase (see Reznikoff et al., Biochem. Biophys. Res. Commun. 2000, 266, 729-734), Vibrio harveyi (transposase featured in Agilent and used in SureSelect QXT products), MuA transposase and Mu transposase recognition site containing R1 and R2 end sequences (Mizuuchi, K., Cell, 35:785, 1983; Savilahti, H, et al., EMBO J., 14:4893, 1995), Staphylococcus aureus Tn552 (Colegio, O. et al., J. Bacteriol., 183:2384-8, 2001; Kirby, C. et al., Mol. Microbiol., 43:173-86, 2002), Ty1 (Devine & Boeke, Nucleic Acids Res., 22:3765-72, 1994 and PCT Publication No. WO 95 / 23875), transposon Tn7 (Craig, N.L., Science, 271:1512, 1996; Craig, N.L., Curr. Top. Microbiol. Immunol., 204:27-48, 1996), Tn / O and IS10 (Kleckner N. et al., Curr. Top. Microbiol. Immunol., 204:49-82, 1996), Mariner transposase (Lampe, D.J. et al., EMBO J., 15:5470-9, 1996), Tc1 (Plasterk, R.H., Curr. Top. Microbiol. Immunol., 204:125-43, 1996), P element (Gloor, G.B., Methods Mol. Biol., 260:97-114, 2004), Tn3 (Ichikawa & Ohtsubo, J. Biol. Chem., 265:18829-32, 1990), bacterial insertion sequences (Ohtsubo & Sekine, Curr. Top. Microbiol. Immunol. 204:1-26, 1996), retroviruses (Brown et al., Proc. Natl. Acad. Sci. USA, 86:2525-9, 1989), and yeast retrotransposons (Boeke & Corces, Ann. Rev.43:403-34, 1989). Further examples include IS5, TnlO, Tn903, IS911, and engineered versions of transposase family enzymes (Zhang et al., (2009) PLoS Genet. 5:el000689. Epub October 16; Wilson C. et al. (2007) J. Microbiol. Methods 71 :332-5). The methods described herein can also include combinations of transposases, rather than just a single transposase.
[0167] In some embodiments, the transposase is Tn5, MuA, or Vibrio harveyi transposase, or an active mutant thereof. In other embodiments, the transposase is a Tn5 transposase or an active mutant thereof. In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase (see, e.g., Reznikoff et al., PCT Publication No. WO2001 / 009363, U.S. Patent Nos. 5,925,545, 5,965,443, 7,083,980, and 7,608,434, and Goryshin and Reznikoff, J. Biol. Chem. 273:7367, 1998) or an active mutant thereof. In one aspect, the Tn5 transposase is a Tn5 transposase as described in PCT Publication No. WO2015 / 160895, which is incorporated by reference herein. In some embodiments, the Tn5 transposase is a fusion protein. In some embodiments, the Tn5 transposase fusion protein comprises a fused elongation factor Ts (Tsf) tag. In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase comprising mutations at amino acids 54, 56, and 372 relative to the wild type sequence. In some embodiments, the hyperactive Tn5 transposase is a fusion protein, optionally wherein the fusion protein is an elongation factor Ts (Tsf). In some embodiments, the recognition site is a Tn5-type transposase recognition site (Goryshin and Reznikoff, J. Biol. Chem., 273:7367, 1998). In one embodiment, a transposase recognition site that forms a complex with a hyperactive Tn5 transposase is used (e.g., EZ-Tn5 TM Transposase, Epicentre Biotechnologies, Madison, Wis.).
[0168] In some embodiments, the transposome complex is a dimer of two molecules of transposase. In some embodiments, the transposome complex is a homodimer, where each of the two molecules of transposase is bound to the same type of first and second transposon (e.g., the sequence to which each monomer binds to two transposons is the same, forming a "homodimer"). In some embodiments, the compositions and methods described herein employ two populations of transposome complexes. In some embodiments, the transposases in each population are the same. In some embodiments, the transposome complexes in each population are homodimers, where a first population has a first adapter sequence in each monomer and a second population has a different adapter sequence in each monomer.
[0169] In some embodiments, the transposase is a Tn5 transposase. In some embodiments, the transposase complex comprises a dimer of transposases (e.g., Tn5 transposases) comprising a first monomer and a second monomer. Each monomer comprises a first transposon and a second transposon, where the first transposon comprises a first transposon end sequence and a first adapter sequence at its 3' end (where the adapter sequence in each monomer of the dimer is the same or different), and the second transposon comprises a second transposon end sequence that is complementary to at least a portion of the first transposon end sequence. In some embodiments with 5' cleavable linkers, the first transposon comprises a cleavable linker at its 5' end that is linked to an affinity element. In some embodiments with 3' linkers, the second transposon comprises a linker (optionally cleavable) at its 3' end that is linked to an affinity element. Thus, in preferred embodiments, one transposon from each monomer comprises an affinity element. In some embodiments, however, only one of the two monomers comprises an affinity element.
[0170] Adapter sequences
[0171] In any embodiment of the methods described herein, the first transposon comprises a first adapter sequence. In some embodiments, a secondary adapter is added to the tagged fragments as described herein using a secondary adapter carrier, which comprises a primer sequence and a secondary adapter sequence. The adapter sequence can comprise one or more functional sequences selected from the group consisting of a universal sequence, a primer sequence, an index sequence, a capture sequence, a barcode sequence (e.g., for counting or error correction), a cleavage sequence, a sequencing-related sequence, and combinations thereof. In some embodiments, the adapter sequence comprises a primer sequence. In other embodiments, the adapter sequence comprises a primer sequence and an index sequence or a barcode sequence. The primer sequence can also be a universal sequence. The disclosure is not limited to the type of adapter sequence that can be used, and the skilled artisan will recognize other sequences that can be used for library preparation and next generation sequencing.
[0172] An adaptor sequence (e.g., a first adaptor sequence) transferred to the 5' end of a nucleic acid fragment by tagmentation can comprise, for example, a universal sequence. A universal sequence is a region of nucleotide sequence that is common to two or more nucleic acid fragments. Optionally, the two or more nucleic acid fragments also have regions of sequence difference. A universal sequence that can be present in different members of a plurality of nucleic acid fragments can allow a single universal primer that is complementary to the universal sequence to be used to replicate or amplify multiple different sequences.
[0173] In some embodiments, the compositions and methods described herein employ two populations of transposome complexes. In some embodiments, each population comprises an adaptor sequence with a different primer sequence. In some embodiments, a first population comprises an A14 primer sequence and a second population comprises a B15 primer sequence.
[0174] Affinity elements and affinity binding partners
[0175] An affinity element, as used herein, is a moiety that can be used to covalently or noncovalently bind to an affinity binding partner. In some aspects, the affinity element is on a transposome complex and the affinity binding partner is on a solid support.
[0176] In some embodiments, the affinity element can noncovalently bind or be bound to an affinity binding partner on a solid support, thereby noncovalently attaching the transposome complex to the solid support. In such embodiments, the affinity element comprises or is, for example, biotin, and the affinity binding partner comprises or is, for example, avidin or streptavidin. In other embodiments, the affinity element / binding partner combination comprises or is FITC / anti-FITC, digoxigenin / digoxigenin antibody, or hapten / antibody. Other suitable affinity pairs include, but are not limited to, dithiobiotin-avidin, iminobiotin-avidin, biotin-avidin, dithiobiotin-succinylated avidin, iminobiotin-succinylated avidin, biotin-streptavidin, and biotin-succinylated avidin.
[0177] In some embodiments, the affinity element can be bound to the affinity binding partner via a chemical reaction, or covalently bound by reaction with the affinity binding partner on the solid support, thereby covalently attaching the transposome complex to the solid support. In some aspects, the affinity element / binding partner combination comprises or is an amine / carboxylic acid (bound via standard peptide coupling reactions such as EDC or NHS mediated coupling under conditions known to those of ordinary skill in the art). Reaction of the two components links the affinity element and binding partner through an amide bond. Alternatively, the affinity element and binding partner can be two click chemistry partners (e.g., azide / alkyne, which react to form a triazole linkage).
[0178] Cleavable linkers
[0179] The ability to break the bond that links two molecular entities can be an effective tool to reduce off-target hybridization product capture, preventing the possibility of genome-wide off-target capture during the first hybridization. As defined herein, a cleavable linker is a molecule with two functional heads linked together by a cleavable bond. The two functional heads serve to attach the linker to other moieties; in such cases, the cleavable linker links the 5' end of the first transposon sequence to the affinity element. Wagner et al., Bioorg. Med. Chem. 20, 571-582 (2012), which is incorporated herein by reference, lists an overview of cleavable linkers categorized by their cleavage conditions and biological applications.
[0180] A cleavable linker as used herein is a linker that can be cleaved by chemical or physical means, e.g., photolytic, chemical cleavage, thermal cleavage, or enzymatic cleavage. In some embodiments, cleavage can be by biochemical, chemical, enzymatic, nucleophilic, reductively sensitive agents, or other means.
[0181] In some embodiments, a cleavable linker can comprise a nucleotide or nucleotide sequence that can be fragmented by various means. For example, a cleavable linker can comprise a restriction endonuclease site; at least one ribonucleotide that can be cleaved by an RNAse; a nucleotide analog that can be cleaved in the presence of a chemical reagent(s); a cleavable diol linkage by treatment with, e.g., periodate; a cleavable disulfide group with a chemical reducing agent; a cleavable moiety that can be photochemically cleaved; and a peptide that can be cleaved by a peptidase or other suitable means. See, e.g., U.S. Patent Publication Nos. 2012 / 0208705 and 2012 / 0208724 and PCT Publication No. WO 2012 / 061832, each of which is incorporated herein by reference in its entirety.
[0182] Photo-cleavable (PC) linkers have been used in various applications such as photo cleavage induced purification, protein engineering, photo-activation of compounds and biomolecules, and SMUG quality markers for multiplex assays. PC linkers can contain a photo-labile functional group that is cleavable by UV light of a specific wavelength (300-350 nm). PC linkers can include, for example, 10 atomic units that can be cleaved when exposed to UV light in the appropriate spectral range. Such photo-cleavable linkers and phosphoramidite reagents are commercially available from Integrated DNA technologies (IDT), Ambergen, and Glen Research. The use of photo-cleavable nucleotide compositions is described in detail in U.S. Patent Nos. 7,057,031, 7,547,530, 7,897,737, 7,964,352, and 8,361,727, which are incorporated by reference in their entirety.
[0183] In some embodiments, cleavage is enzymatically mediated by incorporating a cleavable nucleotide or nucleobase into the cleavable linker. Examples of such nucleobase or nucleotide moieties include, but are not limited to, uracil, uridine, 8-oxo-guanine, xanthine, hypoxanthine, 5,6-dihydrouracil, 5-methylcytosine, thymine dimer, 7-methylguanosine, 8-oxo-deoxyguanosine, xanthosine, inosine, deoxyinosine, dihydrouridine, bromodeoxyuridine, uridine, 5-methylcytidine, deoxyuridine, 5,6-dihydroxylthymine, thymine diol, 5-hydroxy-5-methylhydantoin, uracil diol, 6-hydroxy-5,6-dihydrothymine, methylpropanediol diacylurea (1,2), or an abasic site.
[0184] In some embodiments, the cleavable linker comprises a sufficient number of cleavable nucleotides to allow for complete cleavage. In some embodiments, the linker comprises 1 to 10 cleavable nucleotides. In some embodiments, the cleavable linker comprises at least one cleavable nucleotide. In some embodiments, the linker comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cleavable nucleotides. In a preferred embodiment, the cleavable linker comprises one or more uracil nucleotides and optionally other standard DNA bases. In some embodiments, following PCR, an additional enzymatic step cleaves the cleavable linker at the cleavable nucleotide or nucleoside position. Examples of such enzymes include, but are not limited to, uracil DNA glycosylase (UDG, also known as uracil-N-glycosylase or UNG), formamidopyrimidine DNA glycosylase (Fpg), RNase H, Endo III, Endo IV, Endo V, Endo VIII, Klenow, or adenosine triphosphate diphosphatase (apyrase). In some embodiments, an enzyme cocktail comprising an enzyme that cleaves uracil bases in nucleic acids and an AP nuclease is used. The effective concentration of the enzyme can be 0.025 U / μΐ to 10 U / μΐ. In a preferred embodiment, the enzyme cocktail is uracil DNA glycosylase and Endo IV. A commercial enzyme cocktail for use in the methods described herein includes UDEM (Epicenter Biotechnologies). In another embodiment, the enzyme cocktail is uracil DNA glycosylase and Endo VIII, which is commercially available as USER (New England Biolabs) or Uracil Cleavage System (Sigma Aldrich). Cleavage leaves a 5' affinity element (such as a biotin moiety) on the short oligonucleotide, which can be removed by a number of methods known to the skilled artisan, for example, by removing the target nucleic acid during nucleic acid purification, such as using a bead-based method, which leaves the small oligonucleotides uncaptured. Cleavage breaks the linkage between the affinity element (such as biotin) and the 5' labeled target fragment. In a preferred embodiment, the cleavable linker is adjacent to and attached to the 5' end of the transposon end sequence of the transposon duplex. In some embodiments, the cleavable linker is linked to biotin. In other embodiments, biotin is immobilized to streptavidin-coated beads.
[0185] Transposome complexes and transposons with 3' linkers
[0186] In other aspects, the linker is attached to the 3' end of the second transposon, wherein the linker is capable of attaching the second transposon to a solid support. If the first transposon and the second transposon are part of a transposome complex, the linker is used to attach the complex to a solid support. In such aspects, the first end of the linker is attached to the 3' end of the second transposon, and the second end of the linker is attached to an affinity element. The affinity element is capable of binding (covalently or non-covalently) to an affinity binding partner on a solid support. In some aspects, the affinity element binds (covalently or non-covalently) to an affinity binding partner on a solid support, providing a solid support-bound transposome complex. In some aspects, the linker is a cleavable linker. These complexes are 3' linker transposome complexes and support-bound 3' linker transposome complexes. In some embodiments, the affinity element is biotin and the affinity binding partner is streptavidin.
[0187] In one embodiment, the linker is covalently attached to the 3' end of the second transposon. In some embodiments, the linker is covalently attached to the 3' end of the second transposon end sequence. For example, the linkers described herein can be covalently and directly attached to the 3' end hydroxyl group of the second transposon, forming an -0- linkage, or can be covalently attached through another group such as a phosphate. Alternatively, the linkers described herein can be covalently attached to the phosphate group of the second transposon or second transposon end sequence, for example, to the 3' hydroxyl group via the phosphate group, forming a -0-P(0)3- linkage.
[0188] In some embodiments, the transposome complexes described herein are immobilized to a solid support via a linker. In some such embodiments, the affinity element is biotin and the solid support comprises streptavidin. In some other embodiments, the solid support comprises or is a bead. In one embodiment, the bead is a paramagnetic bead.
[0189] In some embodiments, the linker and affinity element have the structure of Formula (I):
[0190]
[0191] wherein:
[0192] AE is an affinity element;
[0193] Y is C 2-6 alkylene;
[0194] X 1 is O, NR 1 or S;
[0195] wherein R 1 is H or C 1-10 alkyl;
[0196] n is an integer selected from 1, 2, 3, 4, 5, and 6;
[0197] X 2 is O, CH2, or S;
[0198] R a is H or -OH; and
[0199] Z is absent when R a is H, or Z is CH2when R a is H or OH.
[0200] wherein marks the point of attachment to the second transposon.
[0201] In some embodiments of Formula (I), AE is an optionally substituted biotin or an amino group. In other embodiments, AE is an optionally substituted biotin. In such embodiments, the biotin is optionally substituted with C 1-4 alkyl. In other embodiments, AE is biotin.
[0202] In some embodiments of Formula (I), Y is C 2-6 alkylene. In other embodiments, Y is C 2-5 alkylene. In other embodiments, Y is C 2-4 alkylene. In other embodiments, Y is C 2-3 alkylene. In other embodiments, Y is unbranched alkylene. In other embodiments, Y is C2alkylene. In other embodiments, Y is C3alkylene. In other embodiments, Y is C4alkylene. In other embodiments, Y is ethylene. In other embodiments, Y is propylene. In other embodiments, Y is butylene.
[0203] In some embodiments of Formula (I), X 1 is NR 1 , wherein R 1 is H or C 1-10 alkyl. In some such embodiments, R 1 is H. In some embodiments, R 1 is C 1-3 alkyl.
[0204] In other embodiments, X 1 is O. In other embodiments, X 1 is S.
[0205] In some embodiments of formula (I), n is 1. In other embodiments, n is 2. In other embodiments, n is 3. In other embodiments, n is 4.
[0206] In some embodiments of formula (I), X 2 is CH2. In some other embodiments, X 2 is O. In other embodiments, X 2 is S.
[0207] In some embodiments of formula (I), R a is H. In other embodiments, R a is -OH.
[0208] In some embodiments of formula (I), Z is absent and R a is H. In some embodiments, Z is CH2and R a is H. In some embodiments, Z is CH2and R a is OH.
[0209] In some embodiments, the linker and affinity element have the structure of formula (I’):
[0210]
[0211] wherein AE, Y, X 1 , n, X 2 , R a and Z are as defined herein for formula (I). In some embodiments, R a is H.
[0212] In some embodiments, the linker and affinity element have the structure of formula (Ia):
[0213]
[0214] wherein X 1 , n, X 2 , R a and Z are as defined herein for formula (I). In some embodiments, R a is H.
[0215] In some embodiments, the linker and affinity element have the structure of formula (Ib):
[0216]
[0217] wherein AE is as defined herein for formula (I); and n is 1 or 2.
[0218] In some embodiments of formula (Ib), AE is an optionally substituted biotin or amino group.
[0219] In some embodiments, the AE is biotin.
[0220] In some embodiments, the linker and affinity element have the structure of Formula (Ic):
[0221]
[0222] wherein AE is as defined herein for Formula (I); X 2 is O or CH2; n is 1 or 2; and Z is absent or CH2.
[0223] In some embodiments of Formula (Ic), the AE is an optionally substituted biotin or amino group. In some embodiments, the AE is biotin. In some embodiments, X 2 is O. In some embodiments, X 2 is CH2. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, Z is absent. In some embodiments, Z is CH2. In some embodiments, n is 1, X 2 is O and Z is absent. In some embodiments, n is 1, X 2 is CH2and Z is CH2.
[0224] In some embodiments, the linker and affinity element have a structure selected from:
[0225]
[0226]
[0227] In some embodiments, the linker and affinity element have the structure (I(c)).
[0228] In some embodiments, the adaptor sequence comprises a primer sequence. In some embodiments, the primer sequence is an A14 or B15 primer sequence. In some embodiments, the primer sequence is a P5 primer sequence or a P7 primer sequence. In some embodiments, the transposase is a dimer, each monomer bound to a transposon duplex having an adaptor sequence as described herein, wherein the adaptor sequence in each monomer is the same. In embodiments where the transposase is a dimer, one or both monomers comprises a linker that links the transposome complex to a solid support. Each monomer comprises a first transposon having an adaptor sequence.
[0229] Solid supports
[0230] The terms "solid surface," "solid support," and other grammatical equivalents refer to any material suitable for or can be modified to be suitable for attachment of a transposome complex. As understood by one of skill in the art, the number of possible substrates is large. Possible substrates include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, TEFLON, etc.), polysaccharides, nylon or nitrocellulose, ceramics, resins, silica or silica-based materials (including silicon and modified silicon), carbon, metals, inorganic glasses, plastics, optical fiber bundles, beads, paramagnetic beads, and various other polymers.
[0231] In some such embodiments, the transposome complex is immobilized on a solid support via a linker as described herein. In some other embodiments, the solid support comprises or is a tube, a plate well, a slide, a bead, or a flow cell, or a combination thereof. In some further embodiments, the solid support comprises or is a bead. In one embodiment, the bead is a paramagnetic bead.
[0232] In the methods and compositions presented herein, the transposome complex is immobilized to a solid support. In one embodiment, the solid support is a bead. Suitable bead compositions include, but are not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoria sol, carbon graphite, titanium dioxide, latex or cross-linked dextrans such as Sepharose, cellulose, nylon, cross-linked micelles and TEFLON, as well as any other materials described herein for solid supports. In certain embodiments, the microspheres are magnetic microspheres or beads, e.g., paramagnetic particles, spheres, or beads. The beads need not be spherical; irregular particles can be used. Alternatively or additionally, the beads can be porous. The beads range in size from nanometers, e.g., 100 nm, to millimeters, e.g., 1 mm, with beads of about 0.2 microns to about 200 microns being preferred, and about 0.5 to about 5 microns being particularly preferred, although in some embodiments, smaller or larger beads can be used. The beads can be coated with an affinity binding partner, e.g., the beads can be streptavidin-coated. In some embodiments, the beads are streptavidin-coated paramagnetic beads, e.g., Dynabeads MyOne Streptavidin Cl beads (Thermo Scientific catalog number 65601), Streptavidin MagneSphere Paramagnetic particles (Streptavidin MagneSphere Paramagnetic particles, Promega catalog number Z5481), Streptavidin Magnetic Beads (NEB catalog number S1420S), and MaxBeads Streptavidin (Abnova catalog number U0087). The solid support can also be a slide, e.g., a flow cell or other slide that has been modified such that the transposome complex can be immobilized thereon.
[0233] In some embodiments, the affinity binding partner is present on the solid support or bead at a density of 1000 to about 6000 pmol / mg, or about 2000 to about 5000 pmol / mg, or about 3000 to about 5000 pmol / mg, or about 3500 to about 4500 pmol / mg.
[0234] In one embodiment, the solid surface is the inner surface of a sample tube. In one example, the sample tube is a PCR tube. In another embodiment, the solid surface is a capture membrane. In one example, the capture membrane is a biotin capture membrane (e.g., available from Promega Corporation). In another example, the capture membrane is filter paper. In some embodiments of the disclosure, the solid support comprises an inert substrate or matrix (such as a glass slide, a polymeric bead, etc.) that has been functionalized, e.g., by applying a layer or coating of an intermediate material comprising a reactive group that allows covalent attachment to a molecule (such as a polynucleotide). Examples of such supports include, but are not limited to, polyacrylamide hydrogels supported on an inert substrate (such as glass), particularly polyacrylamide hydrogels as described in WO 2005 / 065814 and US 2008 / 0280773, the contents of which are incorporated herein by reference in their entirety. Methods of tagmentation (fragmenting and labeling) DNA on a solid surface to construct a library of tagmented DNA are described in WO 2016 / 189331 and US 2014 / 0093916 Al, which are incorporated by reference herein in their entirety.
[0235] Some other embodiments of the disclosure relate to a solid support comprising a transposome complex immobilized thereon as described herein, wherein the linker and the affinity element have a structure of Formula (I), Formula (I'), Formula (la), Formula (lb), Formula (Ic), Formula (I(a)), Formula (I(b)), or Formula (I(c)) as described herein. In some embodiments, the transposome complex described herein is immobilized to the solid support via the affinity element. In some such embodiments, the solid support comprises streptavidin as the affinity binding partner and the affinity element is biotin. In some other embodiments, the solid support comprises or is a bead. In one embodiment, the bead is a paramagnetic bead.
[0236] In one embodiment, the transposome complexes are immobilized on a solid support (such as a bead) at a specific density or range of densities. The density of complexes on a bead, as the term is used herein, refers to the concentration of transposome complexes in solution during the immobilization reaction. The complex density assumes that the immobilization reaction is quantitative. Once the complexes are formed at a specific density, that density remains constant for a batch of surface-bound transposome complexes. The resulting beads can be diluted, and the resulting complex concentration in the diluted solution is the preparation density of the beads divided by the dilution factor. The diluted bead stock retains its complex density from preparation, but the complexes are present at a lower concentration in the diluted solution. The dilution step does not change the density of complexes on the beads and thus affects library yield but not insert (fragment) size. In some embodiments, the density is about 5 nM to about 1000 nM, or about 5 to 150 nM, or about 10 nM to 800 nM. In other embodiments, the density is about 10 nM, or about 25 nM, or about 50 nM, or about 100 nM, or about 200 nM, or about 300 nM, or about 400 nM, or about 500 nM, or about 600 nM, or about 700 nM, or about 800 nM, or about 900 nM, or about 1000 nM. In some embodiments, the density is about 100 nM. In some embodiments, the density is about 300 nM. In some embodiments, the density is about 600 nM. In some embodiments, the density is about 800 nM. In some embodiments, the density is about 100 nM. In some embodiments, the density is about 1000 nM.
[0237] In some embodiments, the solid support is a bead or paramagnetic bead, and each bead has bound greater than 10,000, 20,000, 30,000, 40,000, 50,000, or 60,000 transposome complexes.
[0238] Different densities of solid support-bound transposome complexes produce fragments of different lengths (e.g., different insert sizes). For example, as shown in FIGS. 6A, 6B, 6C, 6D, 6E, 6F, 6G, 6H, 6I, 6J, 6K, 6L, 6M, 6N, 6O, 6P, 6Q, 6R, 6S, 6T, 6U, 6V, 6W, 6X, 6Y, 6Z, 7A, 7B, 7C, 7D, 7E, 7F, 7G, 7H, 7I, 7J, 7K, 7L, 7M, 7N, 7O, 7P, 7Q, 7R, 7S, 7T, 7U, 7V, 7W, 7X, 7Y, and 7Z, varying complex densities result in different insert sizes. Insert sizes can be about 50 bp to about 1000 bp, or about 100 to about 600 bp, or about 175 to about 200 bp, or about 500 bp. Figure 7A 、 7B and 7C, varying complex densities result in different insert sizes. Insert sizes can be about 50 bp to about 1000 bp, or about 100 to about 600 bp, or about 175 to about 200 bp, or about 500 bp.
[0239] Methods of making modified oligonucleotides and immobilized transposome complexes
[0240] The present disclosure also provides methods of making modified oligonucleotides, transposome complexes, and solid support-bound transposome complexes as described herein. In these aspects, such methods include treating a transposase with a first and second transposon as described herein under conditions suitable for complex formation. Methods for making solid support-bound transposome complexes include incubating a transposome complex as described herein with a solid support comprising an affinity binding partner under conditions sufficient for the affinity element to bind (covalently or non-covalently) to the affinity binding partner.
[0241] In some embodiments are methods of making modified oligonucleotides. In some aspects, methods of making modified oligonucleotides having a linker attached to an affinity element are known in the art. Certain methods contemplated herein include reacting a linker (or cleavable linker) reagent comprising a first reactive functional group (L-FG1) with a nucleotide comprising a second reactive functional group (N-FG2), whereby the first and second reactive functional groups react to form a (L-(CB)-N) linker nucleotide product having a covalent bond (CB) between the linker and the nucleotide. In some embodiments, the linker reagent comprises an AE moiety (AE-linker-FG1). In other embodiments, the linker reagent comprises a portion of a linker structure, and the AE is installed by a second coupling reaction to yield the complete AE-linker structure.
[0242] The first reactive functional group can be, for example, a carboxyl group, an activated carboxyl group (such as an ester, NHS ester, acyl halide, anhydride, etc.), an azido group, an alkyne, a formyl group, or an amino group. In some embodiments, the first reactive functional group is an activated carboxyl group, preferably an NHS ester.
[0243] The second reactive functional group can be at any suitable position of the nucleotide. In some embodiments, the second reactive functional group is at the 3’ hydroxyl position or the 5’ phosphate position of the nucleotide, either replacing a natural substituent or being attached thereto via a tether, such as an alkylene or heteroalkylene group, or a phosphate group in the case of a nucleotide hydroxyl. In some embodiments, the second reactive functional group comprises a C 2-10 - an alkylamino group. In some embodiments, the second reactive functional group comprises a hexylamino group. In some embodiments, the second reactive functional group is -OP(O)3-(CH2)6-NH2. In a first embodiment, the second reactive functional group is linked to the nucleotide via a phosphate tether through the 3’ hydroxyl of the nucleotide.
[0244] Prior to attachment of the linker, the modified nucleotide can be part of an oligonucleotide, in which case the nucleotide can be, for example, at the 3’ end or the 5’ end of the oligonucleotide. Alternatively, the linker is first attached to the nucleotide, and the modified nucleotide is used as a starting material for the synthesis of an oligonucleotide by standard methods.
[0245] In some embodiments, the linker of Formula (I) is attached to the 3’ position of a nucleotide, such as cytidine. In some embodiments, the method of making a modified nucleotide comprises reacting a compound of Formula (II) with a compound of Formula (III):
[0246]
[0247] wherein AE, Y, n, X 2 , R a , and Z are as defined herein;
[0248] -C(O)X 3 is an activated ester, such as an ester, acyl halide, ester anhydride, or NHS ester; and
[0249] X 4 is an -OH or -NH2 group;
[0250] to form a compound of [Formula (I)]-nucleotide.
[0251] In some embodiments, the compound of Formula (II) is AE-(CH2)4C(O)-O-NHS and the compound of Formula (III) is H2N-(CH2)6-OP(O)(O - )O-nucleotide, and the product is AE-(CH2)4C(O)-NH-(CH2)6-OP(O)(O - )O-nucleotide. In some embodiments, the phosphate is attached at the 3’ hydroxyl group of a nucleotide, such as cytidine. In some embodiments, the compound of [Formula (I)]-nucleotide (or AE-(CH2)4C(O)-NH-(CH2)6-OP(O)(O - )O-nucleotide) is reacted with an additional nucleotide to form a [Formula (I)]-oligonucleotide (or AE-(CH2)4C(O)-NH-(CH2)6-OP(O)(O - )O-oligonucleotide). In some embodiments, the second transposon is a [Formula (I)]-oligonucleotide (or AE-(CH2)4C(O)-NH-(CH2)6-OP(O)(O - )O-oligonucleotide).
[0252] The present disclosure also relates to methods of using the modified oligonucleotides described herein to prepare transposome complexes. Such methods include mixing a transposase, a first transposon, and a second transposon as defined herein, wherein the first and second transposon end sequences anneal to each other to form a transposome complex. As described herein, one of the first and second transposons comprises an affinity element (at the 5' end in the case of the first transposon; at the 3' end in the case of the second transposon). In some embodiments, the method further comprises binding the affinity element to a solid support comprising an affinity binding partner. The binding can occur before or after the transposome complex is formed.
[0253] Preparation of sequencing fragments - amplification of tagged fragments
[0254] In some aspects, a method for preparing sequencing fragments from a target nucleic acid is provided, the method comprising providing a solid support comprising a transposome complex as described herein, the transposome complex immobilized on the solid support as described herein; contacting the solid support with the target nucleic acid under conditions to fragment the target nucleic acid and ligate the first transposon to the 5' end of the fragments, whereby the fragments are immobilized on the solid support. In some aspects, the method further comprises amplifying the fragmented nucleic acid. In some embodiments, the fragmenting conditions are conditions suitable for tagmentation by using the transposome complex to fragment and label the target nucleic acid.
[0255] In some embodiments of the methods described herein, after fragmenting and labeling, the method further comprises removing the transposase from the 5' labeled target fragments to provide non-complexed 5' labeled target fragments. Removal of the transposase can be accomplished under chemical conditions, for example, by treatment with a denaturing agent such as sodium dodecyl sulfate (SDS). Such methods can further comprise generating a fully duplexed version of the 5' labeled target fragments. Generating a full duplex can comprise removing the annealed (but not ligated) second transposon (AE-adapter-second transposon) from the 5' labeled target fragments and extending the 5' labeled target fragments to generate a fully duplexed 5' labeled target fragment. For example, by heating the uncomplexed 5' labeled target fragments to a temperature sufficient to selectively denature the second transposon, leaving the remaining duplex region of the fragment intact, can be used to accomplish generation. Extension can be accomplished in the presence of dNTPs and a suitable polymerase. Alternatively, generation can be accomplished in one reaction by incubating the uncomplexed 5' labeled target fragments in the presence of single nucleotides (dNTPs) and a polymerase. In some embodiments, the incubation comprises heating at one or more temperatures sufficient to denature the annealed second transposon and extend the remaining duplex. In other embodiments, the polymerase is a strand displacement polymerase, which is used to remove the second transposon and extend the remaining duplex to generate a fully duplexed 5' labeled target fragment. Suitable polymerases include KAPA HiFi, Pfu, and similar enzymes. Suitable polymerases include strand displacement polymerases such as Bst, Bsu Vent, Klenow, and similar enzymes.
[0256] In some aspects, the method further comprises amplifying the fully duplexed 5' labeled target fragments. Amplification can be accomplished by any suitable amplification method such as polymerase chain reaction (PCR), rolling circle amplification (RCA), or multiple displacement amplification (MDA). In some embodiments, amplification is accomplished by PCR. In some embodiments, amplification and extension are accomplished in one reaction step by reacting with dNTPs in the presence of a polymerase.
[0257] In some embodiments, amplification is used to add one or more secondary adapter sequences to the fully duplexed 5' labeled target fragments to form sequencing fragments. Amplification is accomplished by incubating the fully duplexed 5' labeled target fragments comprising primer sequences at each end with secondary adapter vectors, single nucleotides, and a polymerase under conditions sufficient to amplify the target fragments and incorporate into the secondary adapter vectors (or their complements), wherein the secondary adapter vectors comprise complements of the primer sequences and secondary adapter sequences.
[0258] In some embodiments, the secondary adapter carrier comprises a primer sequence, an index sequence, a barcode sequence, a purification tag, or a combination thereof. In some embodiments, the secondary adapter carrier comprises a primer sequence. In some embodiments, the secondary adapter carrier comprises an index sequence. In some embodiments, the secondary adapter carrier comprises an index sequence and a primer sequence.
[0259] In some embodiments, the fully duplexed 5' tagged target fragments comprise a different primer sequence at each end. In such embodiments, each secondary adapter carrier comprises a complement of one of the two primer sequences. In some embodiments, the two primer sequences are an A14 primer sequence and a B15 primer sequence.
[0260] In some embodiments, the secondary adapters are added by amplification. In some embodiments, the secondary adapter carriers each comprise one of two primer sequences. In some embodiments, the secondary adapter carriers each comprise one of a plurality of index sequences. In some embodiments, the secondary adapter carriers comprise a secondary adapter with a P5 primer sequence and a secondary adapter with a P7 primer sequence.
[0261] In some embodiments, the sequencing fragments are deposited on a flow cell. In some embodiments, the sequencing fragments hybridize to complementary primers grafted to the surface of the flow cell or surface. In some embodiments, the sequence of the sequencing fragments is detected by array sequencing or next generation sequencing, such as sequencing by synthesis.
[0262] P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina, Inc. for sequencing on various Illumina platforms. Primer sequences are described in U.S. Patent Publication No. 2011 / 0059865 Al, which is incorporated by reference in its entirety. Examples of P5 and P7 primers, which can be terminated at the 5' end with an alkyne, include the following:
[0263] P5: AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO. 1)
[0264] P7: CAAGCAGAAGACGGCATACGAG*AT (SEQ ID NO. 2)
[0265] and derivatives. In some examples, the P7 sequence comprises a modified guanine at the G* position, such as 8-oxo-guanine. In other examples, * indicates that the bond between G* and the adjacent 3' A is a phosphorothioate bond. In some examples, the P5 and / or P7 primers include a non-natural linker. Optionally, one or both of the P5 and P7 primers can comprise a poly-T tail. The poly-T tail is typically at the 5' end of the sequence as shown above, such as between the 5' base and the terminal alkyne unit, but can be at the 3' end in some cases. The poly-T sequence can comprise any number of T nucleotides, such as 2 to 20. While P5 and P7 primers are given as examples, it should be understood that any suitable amplification primers can be used in the examples provided herein.
[0266] In some embodiments, the amplification step of the method comprises PCR or isothermal amplification. In some embodiments, the amplification step of the method comprises PCR.
[0267] BRIEF DESCRIPTION OF DRAWINGS
[0268] Figure 1 Exemplary steps of a method of preparing transposome complexes and immobilizing them on a solid surface (such as a bead) through an affinity element linked to the 5' end of the first transposon are illustrated. In this example, two populations of annealed first and second transposons (130a and 130b) are generated, with the oligonucleotides comprising an annealed double-stranded region (comprising transposon end sequences) and a single-stranded region, where in each population the first transposon comprises one of two adapter sequences at the 5' end and an affinity element (110, where * indicates the affinity element), such as biotin. For example, a plurality of biotinylated first and second transposons comprising two adapter sequences (e.g., primer sequences such as A14 and B15) are generated. As described, the strand of the duplex transposon sequence that is transferred into the template nucleic acid is the first transposon, which has an affinity element (e.g., biotin). In step 115, the oligonucleotides of each population (130a and 130b) are typically complexed with a transposase monomer, such as Tn5 (135), in separate reactions to generate two discrete populations of transposome complexes (140), each having a different adapter sequence (e.g., primer sequence such as A14 and B15). After the two complex populations are formed, they are immobilized on a substrate, in this example a bead (120). In some embodiments, the two populations are combined prior to immobilization, resulting in a solid surface or bead comprising complexes from each population. In other embodiments, the two populations are immobilized separately, resulting in two solid surfaces or beads, each comprising one of the two complex types. After the transposome complexes are formed, the transposomes 140 are bound to a surface 145 coated with an affinity binding partner, such as streptavidin.
[0269] Figure 2 An example of tagmentation and library preparation process 200 on a bead surface after immobilizing transposomes using the 5' linker strategy described herein is illustrated. Shown in process 200 is a bead 205 having a transposome 140 bound thereto. A sample of DNA 210 is added to the bead. When the DNA 210 comes into contact with the transposome 140, the DNA is tagmented (fragmented and labeled) and bound to the bead 205 via the transposome 140. The DNA that has been bound and tagmented can be amplified via PCR to produce a pool of bead-free amplicons 215. The PCR step can be used to incorporate secondary adapter sequences, such as primer sequences (e.g., P5 and P7). The amplicons 215 can be transferred to the surface of a flow cell 220, for example, by grafting or hybridizing to complementary primers on the surface of the flow cell. A cluster generation scheme (e.g., a bridge amplification scheme or any other amplification scheme that can be used for cluster generation) can be used to generate a plurality of clusters 225 on the surface of the flow cell. The clusters are clonal amplification products of the tagmented DNA. The clusters are now ready for the next step in the sequencing scheme. One example of a tagmentation process on a bead surface is described in detail in PCT Publication No. WO 2016 / 189331, which is incorporated by reference herein in its entirety.
[0270] Figure 3 Problems that can arise when using 5' ligated transposome complexes are illustrated. Step 300 illustrates a tagmentation process of transposome complexes 140 immobilized on beads 305 with genomic DNA 315, followed by subsequent amplification and target enrichment, including capture of non-target nucleic acids. The immobilized library of tagmented genomic DNA is depicted at 310. Streptavidin-coated capture beads with tagmented DNA thereon can be washed (320) using a wash buffer comprising, for example, 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20, thereby denaturing the transposase from the transposome complex. The supernatant can then be removed after the wash step via magnetic capture of the streptavidin-coated paramagnetic particles (e.g., beads), and the capture beads comprising the immobilized tagmented library can be retained and further washed using 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, 0.1% Tween 20. The bound oligonucleotides are extended at 330 to form bound duplexes with perfect complementarity.
[0271] At 340, target amplification via thermal cycling is performed to amplify the tagmented DNA by methods known to the skilled artisan. For example, a solution of PCR reagents required for efficient amplification (e.g., a mixture comprising minimal amounts of PCR buffer, deoxynucleotides, divalent cations, and DNA polymerase) and additives can be added to the solution containing the beads, and the tagmented DNA bound to the capture beads can be amplified by thermal cycling (e.g., 10 thermal cycles) by methods known to one of skill in the art. At 350, the amplified tagmented DNA can optionally be purified and eluted using, for example, a purification column (e.g., Zymo spin column). The amplified tagmented DNA can also optionally be purified using SPRI or Ampure XP beads (Beckman Coulter), and the purification method is not limited to the present disclosure.
[0272] At step 360, the tagmented library can be enriched using a protocol as described in the NEXTERA Rapid Capture Enrichment protocol (Illumina) or any other target capture method. Biotinylated genomic fragments present from library preparation are in the post-amplification mixture (370) and can compete with the biotinylated target probes (380) which serve as whole genome hybridization probes during target enrichment. The presence of these biotinylated genomic fragments at this stage can compromise enrichment efficiency. Additionally, biotinylated genomic fragments can be primed and extended by the polymerase during PCR amplification to generate free biotinylated adaptors that were not consumed in the tagmentation reaction, thereby adding additional off-target capture probes to the target enrichment step.
[0273] The present disclosure provides several solutions to this problem. In one method described herein, one or more cleavable linkers are included between the affinity element and the adapter sequence of the first transposon. Once tagmentation is complete and the tagmented nucleic acids are amplified, the cleavable linkers can be cleaved, releasing the biotinylated moiety and minimizing or eliminating off-target capture. This modification substantially and surprisingly reduces off-target capture and improves enrichment relative to other bead-based tagmentation methods. Second, the affinity element is moved over the 3’ end of the second transposon and attached by an optionally cleavable linker.
[0274] Figure 4 Figure 1 illustrates steps of a method 100 of fragmenting and labeling DNA using a transposome complex immobilized on a solid surface with cleavable linkers. With reference to Figure 1, steps 110, 120, 130, 140, and 150 are as described in Figure 4 , steps 410, 420, 430, 440, and 450 are as described in Figure 3The (310, 320, 330, 340, and 350, respectively), except for the biotinylated genomic fragments present in the post-amplification mixture (470), contain cleavable linkers (e.g., linkers comprising one or more uracils). In step 460, the biotin is cleaved from the genomic fragments by cleaving the linkers using an appropriate cleaving agent. For the uracil example, cleavage is achieved with a uracil cleaving enzyme (e.g., Uracil DNA Excision Mix from Epicenter). During the enrichment step 480, off-target genomic fragments are no longer biotinylated and thus are not captured like the biotinylated target probes (490). In this way, the method reduces off-target capture and improves the efficiency of target enrichment compared to the 5' ligation method without cleavable linkers.
[0275] In Figure 5A A bead-based tagmentation method using adaptor sequences comprising an affinity element such as biotin at the 5' end is shown in. Briefly, affinity elements at the 5' end of two types of adaptor oligos 501 and 502 are used to attach two transposome populations to a surface (e.g., one with A14 adaptor sequence and one with B15 adaptor sequence). ME and ME' are transposon end sequences. A tagmentation event produces 5' tagged fragments from a target nucleic acid such as genomic DNA. As shown, some fragments include A14 at the 5' end of one strand and B15 at the 5' end of the other strand of the fragment. The fragments are extended and / or reactions, optionally in the presence of secondary adaptor carriers, by amplification such as PCR to make complete duplexes or amplicons that optionally comprise secondary adaptors (e.g., primer sequences such as P5 and P7, and / or index sequences, as shown in the figure below). When biotin / streptavidin is used, the affinity bond breaks during PCR, leaving biotinylated fragment amplicons in solution, which can complicate subsequent enrichment efforts. Alternatively, in Figure 5B In, the attachment of the affinity element and linker is instead at the 3' position on the second transposon. In this case, the affinity element and linker are attached to the 3' end of the complementary transposon end sequence 503 (ME' sequence). In this configuration, the first transposons 501 and 502 do not comprise an affinity element. Through this process, a tagmentation event creates untagged fragmented genomic DNA because the first transposon (lacking an affinity element) is transferred to the fragment, and the affinity element is only attached due to the second transposon hybridizing to the first transposon. The adaptor sequences A14-ME, ME, B15-ME, ME', A14, B15, and ME' are provided below:
[0276] A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 3)
[0277] B15-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO:4)
[0278] ME': 5'-phos-CTGTCTCTTATACACATCT-3' (SEQ ID NO:5)
[0279] A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO:6)
[0280] B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO:7)
[0281] ME: AGATGTGTATAAGAGACAG (SEQ ID NO.:8)
[0282] Target nucleic acids
[0283] The target nucleic acid can be of any type, including DNA, RNA, cDNA, etc. For example, the target nucleic acid can be in various states of purification, including purified nucleic acids. However, the nucleic acid need not be completely purified or purified at all, and can be part of a biological sample, such as a raw sample lysate, bodily fluid, blood, plasma, or serum, or can be otherwise mixed with proteins, other nucleic acid species, other cellular components, and / or any other contaminants. In some embodiments, the biological sample includes a mixture of nucleic acids (such as DNA), proteins, other nucleic acid species, other cellular components, and / or any other contaminants in approximately the same proportions as found in vivo. For example, in some embodiments, the components are present in the same proportions as found in intact cells. Because the methods provided herein allow the nucleic acid or DNA to be bound to the solid support by the tagmentation process, other contaminants can be removed by washing the solid support after tagmentation has occurred. The biological sample can comprise, for example, a crude cell lysate or whole cells. For example, a crude cell lysate applied to the solid support in the methods described herein need not be subjected to one or more separation steps traditionally used to separate nucleic acids from other cellular components.
[0284] Thus, in some embodiments, the biological sample can include not only purified nucleic acids of any origin, but also unpurified nucleic acids present in blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirates, fecal and macerated tissue, or lysates thereof, or any other biological sample comprising nucleic acid or DNA material. The target nucleic acid can be from a tissue sample, a tumor sample, a cancer cell, or a biopsy sample.
[0285] The target nucleic acid can be from any species, from a mixture of species. For example, the target nucleic acid can be from a mammal (such as a human, dog, cat, cow, pig, sheep, or other domesticated animal), or other species such as a fish, bacteria, virus, fungus, or archaea. The nucleic acid can be from an environmental sample, such as soil or water.
[0286] In some embodiments, the target nucleic acid is DNA. In one such embodiment, the DNA is double stranded. In some additional embodiments, the double stranded DNA comprises genomic DNA. In some other embodiments, the target nucleic acid is RNA or a derivative thereof, or cDNA.
[0287] In some embodiments, a biological sample (raw sample or extract) is treated prior to the tagmentation methods described herein to purify the target nucleic acid. In some embodiments, the biological sample is a raw sample or raw sample lysate (e.g., blood or saliva). In some embodiments, the treatment method comprises providing a raw sample, raw sample lysate, or pre-processed sample (e.g., a blood or saliva sample), mixing the sample with a lysis buffer and proteinase K, incubating the mixture to lyse cells in the sample and release DNA from the cells, thereby providing one or more target nucleic acids for the tagmentation methods described herein.
[0288] Components in a raw sample or raw sample lysate (such as blood), or additives in a pre-processed sample (such as stabilizers in an Oragene collection tube for saliva collected in the tube), can inhibit the tagmentation reaction. Accordingly, provided herein are methods for treating a raw sample, raw sample lysate, or pre-processed sample to overcome this problem. In some embodiments, the method comprises providing a raw sample, raw sample lysate, or pre-processed sample (e.g., a blood or saliva sample), mixing the sample with a lysis buffer, proteinase K, and DNA purification beads (e.g., SPRI beads, beads comprising carboxyl groups, wherein the beads are optionally magnetic beads), incubating the mixture to lyse cells in the sample and release DNA from the cells, thereby capturing the DNA on the DNA purification or SPRI beads and separating the beads comprising the captured DNA from the mixture. This separation serves to remove potential tagmentation inhibitors present in the supernatant. The method further comprises optionally washing the beads comprising the captured DNA, and eluting the DNA from the beads to provide one or more target nucleic acids.
[0289] Sequencing methods
[0290] Some methods provided herein include methods of analyzing nucleic acids. Such methods include preparing a library of template nucleic acids of a target nucleic acid, obtaining sequence data from the library of template nucleic acids, and assembling sequence representations of the target nucleic acid. In some embodiments, the methods described herein can be used in next generation sequencing workflows, including but not limited to sequencing by synthesis (SBS). For example, exemplary SBS procedures, fluidic systems, and detection platforms that can be readily adapted for use with nucleic acid libraries produced by the methods of the present disclosure are described in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497; US 7,057,026; WO 91 / 06678; WO 07 / 123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281; and US 2008 / 0108082, each of which is incorporated herein by reference.
[0291] Some SBS embodiments include detecting released protons as nucleotides are incorporated into extension products. For example, sequencing based on detection of released protons can use an electronic detector and related technology commercially available from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies), or the sequencing methods and systems described in US 2009 / 0026082 Al; US 2009 / 0127589 Al; US 2010 / 0137143 Al; or US 2010 / 0282617 Al, each of which is incorporated herein by reference.
[0292] Another useful sequencing technology is nanopore sequencing (see, e.g., Deamer et al. Trends Biotechnol. 18, 147-151 (2000); Deamer et al. Acc. Chem. Res. 35:817-825 (2002); Li et al. Nat. Mater. 2:611-615 (2003), the disclosures of which are incorporated herein by reference). The methods described herein are not limited to any particular type of sequencing instrument used. EMBODIMENTS
[0293] The following examples are provided to describe, but not limit, the disclosure provided herein.
[0294] Example 1: Tagmentation on solid surfaces using linkers with enzymatically cleavable nucleotides
[0295] Transposons were formed by annealing two sets of oligonucleotides, represented as any one of SEQ ID NOs: 9-11 (modified A14-ME) and any one of SEQ ID NOs: 12-14 (modified B15-ME), both spanning a 19 base chimeric end (ME) sequence (SEQ ID NO: 8, shown in lower case) base pairing with a complementary chimeric end sequence (ME'; SEQ ID NO: 5). The oligonucleotides represented by SEQ ID NOs: 9 to SEQ ID NO: 14 were 5' biotinylated to allow for subsequent surface binding to streptavidin-coated paramagnetic beads. Annealed transposons were prepared by combining 50 mM of each biotinylated oligonucleotide with 50 mM ME' (SEQ ID NO: 5) in the presence of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 25 mM NaCl, and heating at 95 °C for 10 minutes and cooling to room temperature for 2 hours. The annealed transposons were then mixed with transposase at a final concentration of 2 mM and incubated at 37 °C overnight.
[0296] Examples of cleavable linker sequences having cleavable nucleotide moieties are provided in SEQ ID NOs: 9-14. The sequences labeled SEQ ID NOs: 9-14 comprise a 19 base chimeric end (ME) sequence (shown in lower case) and read 1 and read 2 sequences A14 and B15 (shown in italics). The sequences labeled SEQ ID NO: 9 and SEQ ID NO: 12 comprise three uracil nucleotides (underlined) after a series of thymine residues (bold). Similarly, the sequences labeled SEQ ID NO: 10 and SEQ ID NO: 13 comprise three uracil nucleotides at the 3' of a series of thymine residues. SEQ ID NO: 11 and SEQ ID NO: 14 contain one uracil nucleotide after a series of thymine residues. As referenced herein, the thymine residues are part of the cleavable linker and serve to link the biotin to the cleavable moiety, which is 5' of the transposon and / or adapter sequence. In some embodiments, the cleavable linker comprises 1-10 cleavable uracil nucleotides. In some embodiments, the cleavable linker comprises at least one cleavable uracil nucleotide. In some embodiments, the cleavable linker comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 cleavable uracil nucleotides. SEQ ID NO: 8 is a 19 base chimeric end (ME) sequence and SEQ ID NO: 5 is its complement.
[0297] SEQ ID NO: 9 (modified A14-ME#1)
[0298] 5' biotin
[0299] SEQ ID NO: 10 (modified A14-ME#2)
[0300] 5' biotin
[0301] SEQ ID NO: 11 (modified A14-ME#3)
[0302] 5' biotin
[0303] SEQ ID NO: 12 (modified B15-ME#1)
[0304] 5' biotin
[0305] SEQ ID NO: 13 (modified B15-ME#2)
[0306] 5' biotin
[0307] SEQ ID NO: 14 (modified B15-ME#3)
[0308] 5' biotin
[0309] Once transposomes are formed, the transposomes are immobilized to streptavidin-coated beads. The beads are then washed with a dilution solution of transposomes in HT1 buffer (Illumina). HT1 contains the high salt required for biotin-streptavidin binding to the beads. The beads are incubated with the transposomes while mixing on a mixer for 1 hour. After mixing, the beads are resuspended in a stock buffer containing 15% glycerol and other buffering agents such as Tris.
[0310] Next, tagmentation is performed. For example, a tagmentation solution is added to a sample containing the immobilized transposomes and incubated at 55 °C for about 15 minutes. The tagmentation reaction includes DNA (e.g., about 50 pg to 5 μg of DNA) and a tagmentation buffer. In one example, the tagmentation buffer includes components necessary for the tagmentation reaction to occur, such as a buffer including 10 mM Tris acetate (pH 7.6), 5 mM magnesium acetate, and 10% dimethylformamide, as described in U.S. Patent Nos. 9,080,211, 9,085,801, and 9,115,396, each incorporated herein by reference. An immobilized library of tagged DNA fragments is generated.
[0311] Example 2: PCR amplification and enzymatic cleavage of tagmented DNA
[0312] The streptavidin-coated capture beads with tagmented DNA thereon are washed as described in Example 1 with a wash buffer comprising 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20 (e.g., washed three times) to denature the transposase from the transposome complex. The supernatant is removed after the washing steps via magnetic capture of the streptavidin-coated paramagnetic particles (e.g., beads) and the beads comprising the immobilized tagmented library are retained and further washed with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20.
[0313] GAP filling of the DNA fragments to fill the gap between the 5’ end of the ME’ sequence and the 3’ end of the fragment (see, e.g., Figure 5B ) is performed by adding, e.g., NEM mix (NEXTERA Rapid Capture Kit, Illumina) and incubating at 72 °C for 3 min.
[0314] Target amplification is performed via thermal cycling to amplify the tagmented DNA by methods known to the skilled artisan. In some examples, a solution of PCR reagents, such as a premix (e.g., NEM mix (NEXTERA Rapid Capture Kit, Illumina), which comprises minimal amounts of PCR buffer, deoxynucleotides, divalent cations, DNA polymerase), and additives necessary for efficient amplification are added to the beads, and the tagmented DNA bound to the beads is amplified by thermal cycling (e.g., 10 thermal cycles).
[0315] The supernatant containing the amplified tagmented DNA is removed from the reaction chamber and transferred to a new reaction chamber (e.g., tube, well, etc.). The amplified fragment mixture is treated with one or more enzymes that cleave bases in the cleavable adapters. Any of a number of known nucleotide backbone cleaving enzymes can be used to digest off-target products to prevent off-target hybridization to the genome. Examples of suitable enzymes include, but are not limited to, uracil DNA glycosylase (UDG, also known as UNG), formamidopyrimidine DNA glycosylase (Fpg), RNAse H, Endo IV, Endo VIII, Klenow, or apyrase.
[0316] The amplified tagmented DNA is purified using SPRI or Ampure XP beads (Beckman Coulter), the purification method is not limited to the present disclosure. The tagmented library can be enriched using a protocol as described in the NEXTERA Rapid Capture Enrichment protocol (Illumina) or any other target capture method. The enriched DNA library is now ready for sequencing.
[0317] Example 3: Enzymatic cleavage of reads using cleavable linkers containing uracil
[0318] Briefly, for each test condition, 50 ng of NA12878 genomic DNA (Coriell Institute) was used. As a control reaction, the DNA was tagmented and libraries were prepared and enriched according to the NEXTERA Rapid Capture Enrichment (Illumina) protocol, according to the manufacturer’s recommendations. Cleavable linkers with uracil, SEQ ID NO: 9 and SEQ ID NO: 13 were used.
[0319] Briefly, each 50 μL reaction contained 5X tagmentation buffer, 50 ng DNA, 5 μL of 250 nM transposome-conjugated Dynal paramagnetic beads (Life Technologies) with cleavable uracil linkers described in SEQ ID NO: 9 and SEQ ID NO: 13. The reaction was incubated at 55°C for 15 minutes, then 15 μL of stop tagmentation (ST) buffer was added, followed by an additional 5 minutes incubation at room temperature. The sample was placed on a magnet and the supernatant was removed. The beads were resuspended in 50 μL NEM (Illumina) and incubated at 72°C for 5 minutes, then cooled to 10°C. The sample was placed on a magnet, and the supernatant was removed and washed in HT2 wash buffer (Illumina).
[0320] PCR reactions were prepared by adding 40 μL EPM, 10 μL each of index primers (e.g., P5’-Index-A14’ and P7’-Index-B15’), and water. PCR amplification was performed as follows: 72°C for 3 minutes; 98°C for 30 seconds, followed by 10 cycles of 98°C for 10 seconds; 65°C for 30 seconds; 72°C for 60 seconds. The PCR product was treated with 5 μL USER enzyme mix (1 U / μl - NEB part number M5505L) and incubated at 37°C for 30 minutes, then size selected using SPRI (solid phase reversible immobilization) based paramagnetic AMPure XP beads (Beckman Coulter catalog number A63880) according to the manufacturer’s recommendations. First, 100 μL of user-treated PCR product was mixed with 55 μL water and 105 μL paramagnetic beads. The sample was removed from the magnet for 5 minutes, placed on the magnet for 5 minutes, then the supernatant was removed to a second size selection (250 μL supernatant + 30 μl paramagnetic beads). The beads were washed in 80% ethanol, air dried, and eluted in 25 μl RSB (Illumina).
[0321] Enrichment of USER enzyme treated size selected samples was performed using the TruSight One probe set (Illumina) according to the NEXTERA Rapid Capture Enrichment Kit protocol, following the manufacturer's recommendations (Illumina). Samples were sequenced on a HiSeq 2500 according to the manufacturer's recommendations (Illumina).
[0322] Table 1: Read enrichment using enzymatic cleavage of cleavable linkers
[0323] Test conditions Percent of reads enriched Solution-based tagmentation and enrichment 70.4 Uracil linker (-enzyme) 45.0 Uracil linker (+ enzyme) 67.4
[0324] As shown in Table 1, performing solution-based tagmentation and enrichment (e.g., NEXTERA Rapid Capture) resulted in 70% read enrichment. Using transposomes immobilized to beads via linkers containing uracil but without enzymatic cleavage treatment, the percentage of read enrichment was significantly lower at 45%. However, when the uracil in the linker was cleaved via enzymatic treatment, enrichment increased to 67%, recapturing the level of enrichment to non-immobilized or solution-based tagmentation and enrichment.
[0325] Example 4: 6-plex and 12-plex exon enrichment with and without enzymatic cleavage of uracil linkers
[0326] The following example demonstrates an exon enrichment experiment using a 5 thymidine (5T) linker compared to a 2 thymidine and 3 uracil (2T3U) linker without enzymatic cleavage and a 2T3U + ENZ with enzymatic cleavage compared to the TruSeq Rapid Exome Kit (Illumina).
[0327] The experimental procedure was as described in Example 3 except that 7.5 μΐ^of transposome immobilized beads were used and the gap fill step was omitted. Enrichment was performed using the TruSeq Rapid Exome Kit (Illumina). Sequencing was performed on a HiSeq 2500 according to the manufacturer's recommendations (Illumina).
[0328] Table 2: Exon read enrichment using enzymatically cleaved linkers
[0329]
[0330] As shown in Table 2, only the 2T3U linker with enzymatic cleavage showed comparable enrichment metrics to NEXTERA solution-based using the TruSeq Rapid Exome Kit (Illumina) or standard surface-based tagmentation (with 5T residues).
[0331] Example 5: Comparison of 5' and 3' bio-oligo methods
[0332] Certain bead-based tagmentation methods use an adaptor sequence that is biotinylated at the 5' end, as shown in Figure 5A Briefly, 5' biotinylated adaptor oligos 501 and 502 attach transposomes to the surface. The tagmentation event creates 5' biotinylated fragmented whole genomic DNA, which can contaminate subsequent enrichment steps. In one embodiment, the attachment of biotin is changed to a 3' position on the complementary strand (second transposon) to attach the transposomes to the surface, as shown in Figure 5B Briefly, oligos 501 and 502 do not contain biotin. In this example, biotin is attached to the transposon end sequence 503 on the complementary strand (ME' sequence). In this configuration, the tagmentation event creates genomic DNA fragments that do not contain biotin.
[0333] In another embodiment, a linker is positioned between the 3' oligo 503 and the biotin. This can help reduce any steric hindrance of transpositional activity that can occur on the solid surface.
[0334] The following example illustrates the use of a 3' biotinylated oligo with a linker of Formula (I(a)) (glycerol type linker) in the preparation of sequencing libraries. According to the manufacturer's recommendations (Illumina), DNA was tagmented and libraries were prepared and enriched according to the NEXTERA Rapid Capture Enrichment protocol as a control reaction. Following the experimental protocol described in Example 3, the difference was that the tagmented amplified DNA was enriched according to the manufacturer's recommended protocol using the Xgen Lockdown Hybrid Capture Kit protocol (Integrated DNA Technologies, IDT) using the Exome Panel. Essentially, a less than ideal enrichment was observed overall because a suboptimal blocking oligo was used as a substitute for the recommended universal blocking oligo provided with the Xgen Lockdown Kit. However, the experimental focus did not require an optimal blocking probe, only the ability to observe a measurable change in the experimental focus. It is not expected that the suboptimal blocking oligo affected the experimental focus.
[0335] Table 3: Percent read enrichment of 3' biotinylated, 3'-spacer-biotin, 5' biotinylated adaptor compared to solution-based tagmentation
[0336] Test conditions Percent of reads enriched Solution-based tagmentation and enrichment 37.5 3' biotin 32.7 3' biotin with linker 33.8 5' biotin with uracil linker + enzymatic cleavage 9.2
[0337] As shown in Table 3, 5' biotin with uracil linker + enzymatic cleavage showed significantly lower enrichment compared to control and 3' biotin (with or without linker). The lower read enrichment of the 5' biotin with uracil linker + enzymatic cleavage method can be a result of incomplete cleavage by the enzyme mix. The experiment with 3' ligation showed that comparable read enrichment to the solution-based control was achieved.
[0338] Example 6: Preparation of P biotinylated beads for small inserts (150-200 bp)
[0339] Step 1. Anneal transposon
[0340] A14-ME and B15-ME were each annealed to ME'-linker-biotin oligos (prepared as described below) to create two double stranded complexes, both with a chimeric end (ME) specifically recognized by the transposase and either A14 or B15 sequence for PCR to add a secondary adaptor. A14-ME, B15-ME, and ME' oligos were resuspended to 200 nM. In a 96 well PCR plate, the preparations shown in Table 4 below were added to 2 wells (1 well for A14:ME' and 1 well for B15-ME'). The well plate was placed in a thermal cycler at 95 °C for 10 minutes, then removed from the thermal cycler and placed on a bench top at room temperature for 2 hours.
[0341] Table 4. Preparation conditions for annealing reaction (50 μΜ)
[0342] Annealing reaction Top adapter ME' 10xTEN [dH2O] Total μL A14: ME'-linker-biotin 6.250 6.25 2.5 10.000 25 B15: ME'-linker-biotin 6.250 6.25 2.5 10.000 25
[0343] Step 2. Transposome formation
[0344] Tn5 transposase was added to the annealed transposons described above to form transposome complexes containing A14-ME / ME'-linker-biotin and B15-ME / ME'-linker-biotin complexes. The following reactions were set up in a 96 well PCR plate using the annealed oligos prepared from the previous step. One well was used for A14-ME and one well was used for B15-ME. Each well was incubated in a thermal cycler at 37 °C overnight to provide two populations of transposome complexes; the contents of the two wells were then mixed together. After the mixing step, approximately 220 uL was removed and added to another well. Approximately 220 uL of standard storage buffer was added (totaling 440 uL).
[0345] Table 5. Transposome formation conditions
[0346] Transposon μL Standard storage buffer 50 μΜ transposase EZ-Tn5 A14: ME'-linker-biotin 4.9 112.7 μL 4.9 μL B15: ME'-linker-biotin 4.9 112.7 μL 4.9 μL
[0347] Step 3. Streptavidin bead loading
[0348] The above formed transposome complex containing biotin linkages is added to streptavidin beads. The density of the complex on the beads can be adjusted to control the insert size in the tagmentation product. The streptavidin beads are mixed well. About 200 uL of streptavidin beads are placed into a 1.5 ml tube and placed on a tube magnet. The beads are washed twice with 1 mL of HT1, between washes the beads are resuspended and centrifuged. After the second wash, the beads are resuspended completely with 600 uL of HT1. 400 uL of the above prepared transposome complex is added to the tube with HT1. The mixture is mixed on a rotating mixer for 1 hour and placed on a magnet and the supernatant is removed. The mixture is resuspended in 500 uL of 15% standard storage buffer. The resulting 1000 nM density of complex is diluted and stored at a concentration of 400 nM in solution. Thus, the stock solution contains beads with a complex density of 1000 nM, which is diluted to a concentration of 400 nM. The dilution step does not change the density of the complex on the beads, but only changes the final concentration of the complex in the stock solution.
[0349] Step 4. Tagmentation
[0350] The DNA sample is tagmented to prepare fragments by cutting and adding transposon sequences to the DNA sample using bead loaded transposomes. In a 96 well PCR plate, 5x Mg tagmentation buffer (10 uL), DNA (>50 ng; 10 uL), dH20 (20 uL), and transposome beads (prepared as per step 3; 10 uL) are combined. The mixture is mixed well and incubated at 55 °C for 5 minutes, then at 20 °C for 2 minutes. The tagmentation process is terminated by inactivating the transposase enzyme by treatment with SDS. 10 uL of SDS is added and mixed well with the reaction mixture from the above step. The mixture is then incubated at room temperature on a benchtop for 5 minutes and placed on a magnetic stirrer. Once the solution is clear, the supernatant is removed.
[0351] Step 5. Wash to stop tagmentation
[0352] The SDS is washed off the beads to prepare the sample for PCR. After the tagmentation is stopped, the reaction mixture is removed from the magnet and 100 uL of wash buffer is added. The sample is vortexed at 1600 rpm for 20 seconds. It is then placed on a magnetic stirrer again and once the solution is clear, the supernatant is removed. The wash step is repeated a total of three times. Once the wash is complete, all the supernatant is removed and the sample is removed from the magnetic stirrer.
[0353] Step 6. PCR
[0354] The samples from Step 5 were PCR amplified with primers that recognize A14 and B15 and add a secondary adaptor. The primers also contain index sequences and sequencing primers (P5 and P7). The premixes shown in Table 6 were added to each sample well. The beads were resuspended in the premix and placed in a thermocycler using the program shown in Table 7. This step is used to remove untransferred / biotinylated strands, extend, and amplify to introduce P5 and P7 in one process.
[0355] Table 6. PCR premixes
[0356]
[0357] Table 7. Thermocycler program
[0358] 72 °C 3 min 98 °C 3 min 98 °C 20 sec 65 °C 30 sec (9 cycles) 72 °C 1 min Repeat the first 3 steps 8 more times (9 cycles total) 72 °C 3 min Hold at 10 °C
[0359] The samples were removed from the thermocycler and placed on a magnetic stirrer. Then 45 μΐ of sample was transferred from the PCR plate to a MIDI plate. 77 uL of water was added to the MIDI plate samples and 88 μΐ^of Ampure SPRI beads were added to each sample / water. The mixture was mixed well, incubated at room temperature for 5 minutes, and then placed on a magnetic stirrer. Once the solution was clear, 200 μΐ^of sample was added to a new well on the same MIDI plate. 20 μΐ^of Ampure SPRI beads were added and the sample was mixed well and left at room temperature for 5 minutes. It was then placed on the magnetic stirrer again.
[0360] Once the solution was clear, the supernatant was removed and discarded. The plate was left on the magnetic stirrer and 200 μΐ^of 80% ethanol was added without disturbance to precipitate. The ethanol was subsequently removed. The ethanol wash step was repeated a total of two more times. Once the wash was complete, any excess ethanol was removed with a pipette while the plate was placed on a stirrer. The samples were dried at room temperature for 5 minutes. 27 μΐ^of water was added and mixed well. The samples were left at room temperature for 2 minutes and placed back on the magnetic stirrer. 25 μΐ^of sample was transferred to a clean plate and stored at -20 °C.
[0361] Example 7. A14-ME and B15-ME transposons
[0362] A14-ME and B15-ME transposons were each annealed to ME' containing 3' biotin. The 3' biotin was coupled to ME' to form 3'-(l(a)) and 3'-(l(c)) linkers. The annealing reactions were in a 25 μΐ, volume using NaCl buffer. The resulting double stranded transposons were each complexed with transposase in an overnight reaction at 37 °C. After formation of the transposome complexes, the A14 and B15 transposome complexes were mixed together in equal volumes and loaded onto streptavidin beads at a concentration of 300 nM to yield a density of 300 nM of bound complexes. Once attached to the beads, the mixture of 300 nM density of (l(a)) and (l(c)) was further diluted to a concentration of 120 nM. Thus, the density of the beads was still 300 nM but the concentration of the complexes in the dilution solution was 120 nM. The dilution step did not change the density of the complexes on the beads and thus affected library yield but not insert size.
[0363] The resulting two types of bead-linked transposomes 3'-(l(a)) and 3'-(l(c)) were stored at 25 °C for 28 days and 56 days. The Arrhenius equation was used to estimate these to 4 months (28 days) and 8 months (56 days) of acceleration. After the end of the accelerated aging, both types of bead-linked transposomes were obtained through the tagmentation and library preparation steps to assess the activity of the transposomes.
[0364] The bead-linked transposome complexes were added to gDNA with a magnesium-based buffer and left at 55 °C for 5 minutes. Once complete, SDS buffer was added to the reaction and the mixture was incubated at room temperature for 5 minutes. The mixture was then placed on a magnetic stirrer and washed three times with NaCl and Tris buffer. After washing, a PCR master mix with indexed sequence secondary adapter vectors was added to the beads and fully resuspended. The sample was then PCR amplified to produce additional amplicons. After PCR, SPRI cleanup was performed to remove the extra vectors. The sample was run on a BioAnalyzer to measure activity (yield of the library preparation method). As shown in Figure 6A Library yield from the streptavidin bead-based solid phase tagmentation using transposome complexes with 3'-biotinylated linkers of formula (l(a)) (3'-(l(a)); glycerol linker) and formula (l(c)) (3'-(l(c)); hexyl linker) was compared. Linker 3'-(l(c)) provided a significant library yield. Linker 3'-(l(a)) provided a lower yield but still had a sequencable yield. The LSC line in the graph is an arbitrary lower specification limit.
[0365] Figure 6BAccelerated stability data for sample libraries prepared using a streptavidin bead based solid phase tagmentation with transposome complexes having 3'-(l(a)) linkers prepared after 4 months of aging (28 days of accelerated storage conditions at 25°C) compared to sample libraries prepared from non-aged controls of the same linkers at 4°C for 28 days. Figure 6C Accelerated stability data for sample libraries prepared using transposome complexes having 3'-(l(c)) linkers after 4 months and 8 months of aging (28 days and 56 days of accelerated storage conditions at 25°C) compared to sample libraries prepared from non-aged controls of the same linkers at 4°C for 28 days and 56 days, respectively.
[0366] Example 8. A14-ME and B15-ME transposons
[0367] A14-ME and B15-ME transposons were each annealed to ME' containing 3' biotin. The 3' biotin was coupled to ME' via 3'-(l(c)) linkers. Annealing reactions were performed in a 25 μΐ volume using NaCl buffer. The resulting double stranded transposons were each attached to transposase in an overnight reaction at 37°C. After transposomes were formed, A14 and B15 transposome complexes were mixed together in equal volumes and loaded onto streptavidin beads at various densities (10 nM to 800 nM).
[0368] Bead-bound transposomes at various densities were added to gDNA along with a magnesium-based buffer and placed at 55°C for 5 minutes. Once complete, SDS buffer was added to the reaction and incubated at room temperature for 5 minutes. The mixture was then placed on a magnetic stirrer and washed three times with NaCl and Tris buffer. After washing, a PCR master mix with secondary adapter vectors containing index sequences was added to the beads and resuspended completely. PCR reactions were then run on the samples to amplify the fragments. After PCR, SPRI size selection was performed at various SPRI ratios to yield different insert sizes. Samples were run on the BA and HiSeq2500 Rapid Output to measure activity.
[0369] Figure 7A Target insert sizes of DNA molecules prepared using a streptavidin bead based solid phase library preparation are shown as a function of bead density, where the beads contain immobilized transposome complexes bound thereon via 3'-(l(c)) linkers. Figure 7B Target insert sizes of DNA molecules are shown as a function of SPRI conditions using streptavidin beads with immobilized transposome complexes having highly active Tn5 transposase and 3'-(l(c)) linkers, where the complex density was 100 nM; and Figure 7CTarget insert size of DNA molecules as a function of SPRI conditions is shown using streptavidin beads with immobilized transposome complexes having high-activity Tn5 transposase and 3'-(l(c)) linkers, where complex density is 600 nM.
[0370] Example 9. Integrated extraction protocol for blood and saliva Figure 5A
[0371] Fresh whole blood was processed using the Flex Lysis Reagent kit (Illumina, Cat# 20015884). Fresh whole blood was collected into EDTA collection tubes and stored at 4°C prior to processing. A lysis premix was prepared by mixing the following volumes of each sample: 7 μΐ blood lysis buffer, 2 μΐ Proteinase K, and 31 μΐ nuclease-free water. For each sample, 10 μΐ blood, 40 μΐ lysis premix, and 20 μΐ SPRI beads were added to one well of a 96-well PCR plate and mixed by flicking 10 times. The plate was sealed and incubated at 56°C for 10 minutes on a thermal cycler with a heated lid. The plate was then placed on a plate magnet for 5 minutes, the supernatant was discarded, and 150 μΐ of 80% ethanol was added. After incubating on the magnet for 30 seconds, the ethanol was discarded and the plate was removed from the magnet. The beads were re-suspended in 30 μΐ water and prepared for library preparation.
[0372] Saliva was collected in Oragene DNA Saliva Collection tubes (DNA Genotek, Cat# OGR-500, OGD-510), which were incubated at 50°C for at least 1 hour to lyse the cells, then mixed well by vortexing. For each sample, 20 μΐ water and 30 μΐ saliva were added to one well of a 96-well PCR plate and mixed slowly by flicking. Then 20 μΐ SPRI beads were added to the sample well and the beads were mixed well by flicking the solution 10 times. The plate was incubated at room temperature for 5 minutes, then placed on a plate magnet for 5 minutes. The supernatant was removed and 150 μΐ of 80% ethanol was added to the bead pellet. The plate was then left on the magnet for 30 seconds, then the ethanol was removed and the plate was removed from the magnet. The beads were re-suspended in 30 μΐ water and prepared for library preparation.
[0373] A number of implementations have been described. Nevertheless, it will be understood that various modifications can be made. Accordingly, other implementations are within the scope of the following claims.
Claims
1. A transposome complex comprising: a. a transposase, b. a first transposon comprising: i. a 3' portion comprising a first transposon end sequence; and ii. a first adaptor sequence at the 5' end of the first transposon end sequence; c. a second transposon comprising a second transposon end sequence that is complementary to at least a portion of the first transposon end sequence; and d. a cleavable linker having a first end attached to the 5' end of the first transposon and a second end attached to an affinity element.
2. The complex of claim 1, wherein the cleavable linker comprises one or more photo- or enzymatically cleavable nucleotides.
3. The complex of claim 2, wherein the one or more photo- or enzymatically cleavable nucleotides are independently selected from the group consisting of uracil, uridine, 8-oxo-guanine, xanthine, hypoxanthine, 5,6-dihydrouracil, 5-methylcytosine, thymine dimer, 7-methylguanosine, 8-oxo-deoxyguanosine, xanthosine, inosine, dihydrouridine, bromodeoxyuridine, uridine, or 5-methylcytidine.
4. The complex of claim 3, wherein the cleavable nucleotide is uracil.
5. The complex of claim 1, wherein the cleavable linker comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 photo- or enzymatically cleavable nucleotides.
6. A modified oligonucleotide comprising a first transposon and a second transposon, wherein the first transposon comprises (a) a 3' portion comprising a first transposon end sequence and (b) a first adaptor sequence at the 5' end of the first transposon end sequence, and the second transposon comprises a second transposon end sequence that is complementary to and anneals to at least a portion of the first transposon end sequence, and wherein a first end of a cleavable linker is attached to the 3' end of the second transposon and a second end of the cleavable linker is attached to an affinity element.
7. A modified oligonucleotide comprising a first transposon and a second transposon, wherein the first transposon comprises (a) a 3' portion comprising a first transposon end sequence and (b) a first adaptor sequence at the 5' end of the first transposon end sequence, and the second transposon comprises a second transposon end sequence that is complementary to and anneals to at least a portion of the first transposon end sequence, and wherein a first end of a cleavable linker is attached to the 5' end of the first adaptor sequence and a second end of the cleavable linker is attached to an affinity element.
8. A method of preparing a sample for sequencing comprising: a. providing the complex of any one of claims 1-5; b. applying a nucleic acid to the complex under conditions suitable for tagmentation, thereby immobilizing fragments of the nucleic acid to a solid support; c. amplifying the immobilized, tagmented nucleic acid; d. cleaving the cleavable portion; and e. enriching the targeted amplified nucleic acid, thereby preparing a sample for sequencing.
9. The method of claim 8, wherein the cleaving is accomplished with an enzyme selected from at least one of (a) a glycosylase or (b) an apurinic / apyrimidinic (AP) endonuclease.
10. The method of claim 9, wherein the glycosylase is uracil DNA glycosylase, MUG, SMUG, TDG, or MBD4.
11. The method of claim 9, wherein the glycosylase is uracil DNA glycosylase.
12. The method of claim 9, wherein the AP endonuclease is Endo VIII, Endo IV, or Endo V.
13. The method of claim 12, wherein the AP endonuclease is Endo VIII.
14. The method of any one of claims 8-13, wherein the amplifying comprises one or more of PCR or isothermal amplification.
15. A transposome complex comprising: (i) a transposase, (ii) a first transposon comprising: (a) a 3’ portion comprising a first transposon end sequence; and (b) a first adaptor sequence at the 5’ end of the first transposon end sequence; (iii) a second transposon comprising a second transposon end sequence complementary to at least a portion of the first transposon end sequence; and (iv) a cleavable linker having a first end attached to the 3’ end of the second transposon and a second end attached to an affinity element, wherein the cleavable linker and affinity element have the structure of Formula (I): (I) wherein: AE is the affinity element; Y is C 2-6 alkylene; X 1 is O, NR 1 or S; wherein R 1 is H or C 1-10 alkyl; n is an integer from 1 to 6; X 2 is O, CH2or S; R a is H or -OH; and when R a is H, Z is absent, or when R a is H or OH, Z is CH2; wherein labeled with a connection point to the second transposon.
16. The complex of claim 15, wherein the phosphate group in Formula (I) is attached to the 3’ hydroxyl of the terminal nucleotide of the second transposon.
17. A transposome complex comprising: (i) a transposase, (ii) a first transposon comprising: (a) a 3’ portion comprising a first transposon end sequence; and (b) a first adaptor sequence at the 5’ end of the first transposon end sequence; (iii) a second transposon comprising a second transposon end sequence complementary to at least a portion of the first transposon end sequence; and (iv) a linker having a first end attached to the 5’ end of the first transposon and a second end attached to an affinity element, wherein the linker and affinity element have the structure of Formula (I): (I) wherein: AE is the affinity element; Y is C 2-6 alkylene; X 1 is O, NR 1 or S; wherein R 1 is H or C 1-10 alkyl; n is an integer from 1 to 6; X 2 is O, CH2or S; R a is H or -OH; and when R a is H, Z is absent, or when R a is H or OH, Z is CH2; wherein labeled with a connection point to the first transposon.
18. The complex of claim 17, wherein the phosphate group in Formula (I) is attached to the 5’ position of the terminal nucleotide of the first transposon.
19. The complex of any one of claims 15-18, wherein AE comprises or is an optionally substituted biotin or amino group.
20. The complex of claim 19, wherein AE is biotin.
21. The complex of any one of claims 15, 16-18, and 20, wherein Y is C 2-6 alkylene, C 2-5 alkylene, C 2-4 alkylene, or C 2-3 alkylene.
22. The complex of claim 21, wherein Y is an ethylene, propylene, or butylene group.
23. The complex of any one of claims 15-18, 20, and 22, wherein X 1 is NR 1 and wherein R 1 is H or C 1-10 alkyl.
24. The complex of claim 23, wherein R 1 is H. 25. The complex of any one of claims 15-18, 20, 22, and 24, wherein n is 1 or 2.
26. The complex of any one of claims 15-18, 20, 22, and 24, wherein X is CH2. 2 is CH2.
27. The complex of any one of claims 15-18, 20, 22, and 24, wherein X 2 is O. 28. The complex of any one of claims 15-18, 20, 22, and 24, wherein R a is H and Z is absent.
29. The complex of any one of claims 15-18, 20, 22, and 24, wherein R a is H and Z is CH2.
30. The complex of any one of claims 15-18, 20, 22, and 24, wherein R a is -OH and Z is CH2.
31. The complex of any one of claims 15-18, 20, 22, and 24, wherein the linker and affinity element have the structure of Formula (I’): (I’) wherein Z is absent or CH2.
32. The complex of any one of claims 15-18, wherein the linker and affinity element have the structure of Formula (la): (Ia).
33. The complex of any one of claims 15-18, wherein the linker and affinity element have the structure of Formula (lb) or Formula (lc): (Ib) (Ic) wherein n is 1 or 2; X 2 is O or CH2; and Z is absent or CH2.
34. The complex of any one of claims 15-18, wherein the linker and affinity element have a structure selected from the group consisting of: (I(a)), (I(b)), and (I(c)).
35. The complex of any one of claims 1, 5, 15-18, 20, 22, and 24, wherein the transposase is a Tn5 transposase.
36. The complex of claim 35, wherein the Tn5 transposase is a wild-type Tn5 transposase or a hyperactive Tn5 transposase or a mutant thereof.
37. The complex of claim 35 or 36, wherein the transposase is conjugated to a purification tag.
38. The complex of any one of claims 1-4, 15-18, 20, 22, and 24, wherein the first transposon end sequence and the second transposon end sequence are ME and ME’, wherein ME is AGATGTGTATAAGAGACAG (SEQ ID NO.: 8), and wherein ME’ is 5’-phos-CTGTCTCTTATACACATCT-3’ (SEQ ID NO: 5).
39. The complex of any one of claims 1, 5, 15-18, 20, 22, and 24, wherein the adapter sequence comprises a universal sequence, a primer sequence, or a sequencing-related sequence.
40. The complex of any one of claims 1, 5, 15-18, 20, 22, and 24, wherein the first adapter sequence comprises a primer sequence.
41. The complex of claim 40, wherein the first adapter sequence comprises A14 or B15, wherein A14 is 5’-TCGTCGGCAGCGTC-3’ (SEQ ID NO: 6), and wherein B15 is 5’-GTCTCGTGGGCTCGG-3’ (SEQ ID NO: 7).
42. A first complex of claim 41, wherein the first adapter comprises a first primer sequence, and a second complex of claim 41, wherein the first adapter comprises a second primer sequence.
43. The complex of claim 42, wherein the first primer sequence comprises A14 and the second primer sequence comprises B15, wherein A14 is 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 6), and wherein B15 is 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 7).
44. The complex of any one of claims 1, 5, 15-18, 20, 22, and 24, wherein the affinity element binds to an affinity binding partner on a solid support, whereby the complex binds to the solid support.
45. The complex of claim 44, wherein the affinity element is biotin and the affinity binding partner is streptavidin.
46. The complex of claim 44, wherein the solid support is a tube, a plate well, a slide, a bead, or a flow cell.
47. The complex of claim 46, wherein the solid support is a bead or a paramagnetic bead.
48. A method for generating a library of tagged nucleic acid fragments from a double- stranded target nucleic acid, the method comprising incubating the target nucleic acid with a bound complex of any one of claims 1-5 and 15-47 under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to ligate the 3' end of the first transposon to the 5' end of the target fragments to produce a plurality of 5' tagged target fragments.
49. The method of claim 48, further comprising amplifying one or more of the 5' tagged target fragments.
50. The method of claim 49, wherein the amplifying comprises generating and / or amplifying fully duplexed 5' tagged target fragments.
51. The method of any one of claims 8-14 and 48-50, wherein the nucleic acid is selected from at least one of: (a) DNA, (b) RNA or a derivative thereof, or (c) cDNA.
52. The method of claim 51, wherein the DNA is double-stranded.
53. The method of claim 52, wherein the double-stranded DNA is genomic DNA.
54. The method of claim 53, wherein the genomic DNA is from a single cell, a tissue, a tumor, blood, plasma, urine, or cell-free nucleic acid.
55. The method of claim 49, wherein the amplifying comprises incubating at least one fully duplexed 5' tagged target fragment comprising a primer sequence at each end with a secondary adaptor carrier, a single nucleotide, and a polymerase under conditions sufficient to amplify the target fragment and incorporate into a secondary adaptor carrier, wherein the secondary adaptor carrier comprises a complement of the primer sequence and a secondary adaptor sequence, thereby producing a library of sequencing fragments.
56. The method of claim 55, wherein the secondary adaptor carrier comprises a primer sequence, an index sequence, a barcode sequence, a purification tag, or a combination thereof.
57. The method of claim 56, wherein the secondary adaptor carrier comprises an index sequence and a primer sequence.
58. The method of claim 55, wherein the fully duplexed 5' tagged target fragments comprise different primer sequences at each end.
59. The method of claim 58, wherein the different primer sequences are A14 and B15, wherein A14 is 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 6), and wherein B15 is 5'- GTCTCGTGGGCTCGG-3' (SEQ ID NO: 7).
60. The method of claim 55, wherein the secondary adaptor carriers each comprise one of two primer sequences.
61. The method of claim 60, wherein the two primer sequences are a P5 primer sequence and a P7 primer sequence, and one of a plurality of index sequences, wherein P5 is AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO. 1), and wherein P7 is CAAGCAGAAGACGGCATACGAG AT (SEQ ID NO. 2).
62. The method of claim 55, wherein the fragments hybridize to complementary primers grafted to a flow cell or a solid support.
63. The method of claim 55, further comprising sequencing one or more of the 5' tagged target fragments or amplification products thereof.
64. A modified oligonucleotide comprising a first transposon and a second transposon, wherein the first transposon comprises (a) a 3' portion comprising a first transposon end sequence and (b) a first adaptor sequence at the 5' end of the first transposon end sequence, and the second transposon comprises a second transposon end sequence that is complementary to and anneals to at least a portion of the first transposon end sequence, and wherein a first end of a linker is attached to the 5' end of the first adaptor sequence and a second end of the linker is attached to an affinity element, wherein the linker and the affinity element have the structure of Formula (I) of any one of claims 15-30, the structure of Formula (I') of claim 31, the structure of Formula (Ia) of claim 32, the structure of Formula (Ib) or Formula (Ic) of claim 33, or the structure of Formula (I(a)), Formula (I(b)), or Formula (I(c)) of claim 34.
65. A method for making a solid support-bound transposome complex, the method comprising treating a transposase with a modified oligonucleotide of claim 6, 7, or 64 under conditions sufficient to bind the transposase to the modified oligonucleotide in a transposome complex.
66. The method of claim 65, further comprising incubating the transposome complex with a solid support comprising an affinity binding partner under conditions sufficient to bind the affinity element to the affinity binding partner.